Difference between revisions of "Chalk5"
| Line 2: | Line 2: | ||
GeneName = chalk5| | GeneName = chalk5| | ||
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).| | Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).| | ||
| − | Function = | + | Function = Chalk5, influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness |
| − | Expression = In the rice | + | of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in |
| + | Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.| | ||
| + | Expression = In the rice chalk5 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the | ||
rice mitochondrial atp1 gene is also regulated in different ways.| | rice mitochondrial atp1 gene is also regulated in different ways.| | ||
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.| | ||
Revision as of 01:03, 28 May 2014
| Gene Name |
chalk5 |
|---|---|
| Description |
{{{Description}}} |
| Version |
GeneID:6450183 |
| Length |
1530 bp |
| Definition |
Oryza sativa Japonica Group atp1, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:352379..353908 |
| Sequence Coding Region |
352379..353908 |
| Genome Context |
<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq> |
| Gene Sequence |
<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica> |
| External Link(s) |