Difference between revisions of "Chalk5"

From RiceWiki
Jump to: navigation, search
Line 2: Line 2:
 
GeneName = chalk5|
 
GeneName = chalk5|
 
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
 
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
Function = Chalk5, influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
+
Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in
+
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
 +
Expression = Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in
 
Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
 
Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
Expression = In the rice chalk5 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level.  The multiple initiation sites of the
 
rice mitochondrial atp1 gene is also regulated in different ways.|
 
 
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
 
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
 
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
 
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|

Revision as of 01:18, 28 May 2014

Gene Name

chalk5

Description

{{{Description}}}

Version

GeneID:6450183

Length

1530 bp

Definition

Oryza sativa Japonica Group atp1, Mitochondrion gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Mitochondrion

Location

Mitochondrion:352379..353908

Sequence Coding Region

352379..353908

Genome Context

<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1>

Gene Structure
(RNA Editing)

<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2>

Protein Sequence

<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>

Gene Sequence

<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>

External Link(s)

NCBI Gene:atp1