|
|
| Line 1: |
Line 1: |
| − | {{Mitochondrion|
| |
| − | GeneName = chalk5|
| |
| − | Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
| |
| − | Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
| |
| − | of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
| |
| − | Expression =Two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
| |
| − | Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
| |
| − | Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
| |
| − | References =AU - Li, Yibo, Fan, Chuchuan, Xing, Yongzhongetc. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice
| |
| − | Nat Genet 2014/04//print Nature Publishing Group, a division of Macmillan Publishers Limited. All Rights Reserved.1061-4036
| |
| | | | |
| − | Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
| |
| − | Description = ATP synthase F0 subunit 1|
| |
| − | Version = GeneID:6450183|
| |
| − | Length = 1530 bp|
| |
| − | Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
| |
| − | Source = Oryza sativa Japonica Group
| |
| − |
| |
| − | ORGANISM Oryza sativa Japonica Group
| |
| − | Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
| |
| − | Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
| |
| − | clade; Ehrhartoideae; Oryzeae; Oryza.
| |
| − | |
| |
| − | Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
| |
| − | AP = Mitochondrion:352379..353908|
| |
| − | CDS = 352379..353908|
| |
| − | GCID = <gbrowseImage1>
| |
| − | name=NC_011033:352379..353908
| |
| − | source=Rice_Japonica_Mitochondrion
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage1>|
| |
| − | GSID = <gbrowseImage2>
| |
| − | name=NC_011033:352379..353908
| |
| − | source=Rice_Japonica_Mitochondrion
| |
| − | preset=GeneLocation
| |
| − | </gbrowseImage2>|
| |
| − | AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
| |
| − | DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
| |
| − | Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
| |
| − | }}
| |
| − | [[Category:Genes]]
| |
| − | [[Category:Japonica mRNA]]
| |
| − | [[Category:Oryza Sativa Japonica Group]]
| |
| − | [[Category:Japonica Genes]]
| |
| − | [[Category:Japonica Mitochondrion]]
| |
| − | [[Category:Mitochondrion]]
| |