Difference between revisions of "OsCEBiP"
(→Structured information) |
(→Structured information) |
||
| Line 25: | Line 25: | ||
Definition = Oryza sativa Japonica Group LysM RLK mRNA for LysM receptor-like kinase, complete cds.| | Definition = Oryza sativa Japonica Group LysM RLK mRNA for LysM receptor-like kinase, complete cds.| | ||
Chromosome = Chromosome 9| | Chromosome = Chromosome 9| | ||
| + | preset=GeneLocation | ||
| + | </gbrowseImage2>| | ||
Coding Sequence= | Coding Sequence= | ||
<cdnaseq>ATGTTCTCTCTCCCCGCCCTCCTCATCGGCGCCTGTGCCTTCGCGGCGGCGGCGGTTGCGGCGTCCGGCG | <cdnaseq>ATGTTCTCTCTCCCCGCCCTCCTCATCGGCGCCTGTGCCTTCGCGGCGGCGGCGGTTGCGGCGTCCGGCG | ||
Revision as of 14:10, 26 May 2014
Contents
Annotated Information
Function
OsCEBiP is a glycoprotein of rice consisting of 328 aa and has two lysin motifs (LysM) in the extracellular portion. OsCEBiP RNAi results in a significant reduction in the elicitor-induced oxidative burst and gene responses, indicating that OsCEBiP contributes to the perception of chitin. OsCEBiP lacks an
intracelluar kinase domain, so it has to work with annother protein to transduce extracelluar signal into cell. Its partner is OsCERK1.
Localization
OsCEBiP is localized at the plasma membrane of rice, together with OsCERK1.
Evolution
OsCEBiP is a homologous gene to CEBiP, which is discovered in Arabidopsis.
Labs working on this gene
References
Structured information
| Gene Name |
OsCEBiP |
|---|---|
| Description |
LysM receptor-like kinase |
| Version |
AB510402.1 GI:299507947 |
| Length |
1818 bp |
| Definition |
Oryza sativa Japonica Group LysM RLK mRNA for LysM receptor-like kinase, complete cds. |
| Source |
Oryza sativa Japonica Group |
| Chromosome |
Chromosome 9 |
| Location |
{{{AP}}} |
| Sequence Coding Region |
{{{CDS}}} |
| Expression | |
| Genome Context |
{{{GCID}}} |
| Gene Structure |
{{{GSID}}} |
| Coding Sequence |
{{{CDNA}}} |
| Protein Sequence |
{{{AA}}} |
| Gene Sequence |
{{{DNA}}} |
| External Link(s) |
NCBI Gene:OsCEBiP, {{{Link}}} |