Difference between revisions of "Chalk5"

From RiceWiki
Jump to: navigation, search
Line 4: Line 4:
 
Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
 
Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
 
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
 
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
−
Expression = Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in
+
Expression =Two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
−
Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
 
 
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
 
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
 
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
 
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
−
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
+
References =AU  - Li, Yibo, Fan, Chuchuan, Xing, Yongzhongetc. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice
−
            Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
+
Nat Genet 2014/04//print Nature Publishing Group, a division of Macmillan Publishers Limited. All Rights Reserved.1061-4036
−
            Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
 
−
            Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
 
−
            Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
 
−
            Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
 
−
            Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
 
−
            Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from< i> Camellia sinensis</i> related to selenium or sulfur metabolism and functional expression in< i> Escherichia coli</i>[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
 
−
            Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
 
−
            Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|
 
  
 
Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
 
Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)

Revision as of 01:37, 28 May 2014

Gene Name

chalk5

Description

{{{Description}}}

Version

GeneID:6450183

Length

1530 bp

Definition

Oryza sativa Japonica Group atp1, Mitochondrion gene.

Source

Oryza sativa Japonica Group 

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Mitochondrion

Location

Mitochondrion:352379..353908

Sequence Coding Region

352379..353908

Genome Context

<gbrowseImage1> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1>

Gene Structure
(RNA Editing)

<gbrowseImage2> name=NC_011033:352379..353908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2>

Protein Sequence

<aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>

Gene Sequence

<dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>

External Link(s)

NCBI Gene:atp1

Retrieved from "https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Chalk5&oldid=173367"