Difference between revisions of "BGIOSGA029617"

From RiceWiki
Jump to: navigation, search
(Annotated Information)
Line 3: Line 3:
 
==Annotated Information==
 
==Annotated Information==
 
===Function===
 
===Function===
Please input function information here.
+
Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells
  
 
===Expression===
 
===Expression===
Please input expression information here.
+
qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. We also speculated that it was involved in panicle development(Fig. [[File:Example.jpg]]
 
+
Fig. 1 Expression pattern of OsZHD1. a. qRT-PCR of OsZHD1 transcription levels in different organs in WT. GUS activity was detected in GUS lines root (b), seedling (c), leaf sheath (d), leaf blade (e), glumes of young panicle (h) and flowering spikes (i), while not in negative line leaf blade (f), glumes of young panicle (g). qRT-PCR analysis of OsZHD1 expression in WT developing leaves (j) and developing panicles (k).
===Evolution===
 
Please input evolution information here.
 
 
 
You can also add sub-section(s) at will.
 
  
 
==Labs working on this gene==
 
==Labs working on this gene==

Revision as of 05:17, 28 May 2014

Please input one-sentence summary here.

Annotated Information

Function

Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells

Expression

qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. We also speculated that it was involved in panicle development(Fig. Example.jpg Fig. 1 Expression pattern of OsZHD1. a. qRT-PCR of OsZHD1 transcription levels in different organs in WT. GUS activity was detected in GUS lines root (b), seedling (c), leaf sheath (d), leaf blade (e), glumes of young panicle (h) and flowering spikes (i), while not in negative line leaf blade (f), glumes of young panicle (g). qRT-PCR analysis of OsZHD1 expression in WT developing leaves (j) and developing panicles (k).

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information

Gene Name

BGIOSGA029617

Description

Putative uncharacterized protein

Definition

Oryza sativa Indica Group BGIOSGA029617, complete gene.

LocusTag

OJ1005_D12.28

Ensembl Transcript ID

BGIOSGA029617-TA

Ensembl Protein ID

BGIOSGA029617-PA

Length

840

Source

Oryza sativa Indica Group

 ORGANISM  Oryza sativa Indica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 9

Location

Chromosome 9:16349452..16350291

Sequence Coding Region

16349452..16350291

Genome Context

<gbrowseImage1> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</cdnaseq>

Protein Sequence

<aaseq>MDFDDHDDGDEEMPPMPVSSSYETPPQHGLAGGGMAPKPPGEIGSHVKGPSCGGGRYRECLKNHAVGIGGHAVDGCGEFMAAGEEGTIDALRCAACNCHRNFHRKESESLAGEGSPFSPAAVVPYGATPHHQFSPYYRTPAGYLHHHQHHMAAAAAAAAAAAGGHPQRPLALPSTSHSGRDDGDDLSGMVGPMSAVGPLSGMSLGAGPSGSGSGKKRFRTKFTQEQKDKMLAFAERVGWRIQKHDEAAVQQFCDEVGVKRHVLKVWMHNNKHTLGKKLP</aaseq>

Gene Sequence

<dnaseqindica>1..840#ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</dnaseqindica>

External Link(s)

EnsemblPlants:BGIOSGA029617