Difference between revisions of "BGIOSGA029617"
(→Labs working on this gene) |
(→References) |
||
| Line 12: | Line 12: | ||
==References== | ==References== | ||
| − | + | [1] Xu Y, Wang Y H, Long Q Z, et al. Overexpression of OsZHD1, a zinc finger homeodomain class homeobox transcription factor, induces abaxially curled and drooping leaf in rice[J]. Planta, 2014, 239: 803-816. | |
| + | [2] Windhovel A, Hein I, Dabrowa R, Stockhaus J. Characterization of a novel class of plant homeodomain proteins that bind to the C4 phosphoenolpyruvate carboxylase gene of Flaveria trinervia[J]. Plant molecular biology, 2001, 45(2): 201-214. | ||
| + | [3] Bürglin T R. A comprehensive classification of homeobox genes[M]. In: Duboule D (ed) Guidebook to the homeobox genes. pp. 25-71. Oxford: Oxford University Press. | ||
| + | [4] Mukherjee K, Brocchieri L, Burglin T R. A comprehensive classification and evolutionary analysis of plant homeobox genes[J]. Molecular biology and evolution, 2009, 26(12):2775-2794. | ||
| + | [5] Tran L S, Nakashima K, Sakuma Y, et al. Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis[J]. The plant journal, 2007, 49(1): 46-63. | ||
| + | [6] Park H C, Kim M L, Lee S M, et al. Pathogen-induced binding of the soybean zinc finger homeodomain proteins GmZF-HD1 and GmZF-HD2 to two repeats of ATTA homeodomain binding site in the calmodulin isoform 4 (GmCaM4) promoter[J]. Nucleic Acids Research, 2007, 35(11): 3612-3623. | ||
==Structured Information== | ==Structured Information== | ||
Revision as of 05:26, 28 May 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
Leaf rolling is considered as an important agronomic trait in rice (Oryza sativa L.), but little is known on the molecular mechanism of rice leaf rolling. OsZHD1 (Os09g29130) encodes a ZF-HD class homeobox transcription factor, and its overexpression is responsible for a novel abaxially curled and drooping leaf mutant Abaxially Curled and drooping Leaf-Dominant (ACL-D). Histological analysis indicated that the number of bulliform cells was increased in both ACL-D and OsZHD1 artificial overexpression lines. Moreover, the arrangement of bulliform cells became abnormal. These results demonstrated that OsZHD1 plays an important role in rice morphogenesis, especially the formation and distribution of bulliform cells
Expression
qRT -PCR analysis revealed the expression of OsZHD1 in various tissues, including 14-day-old green seedlings, mature leaf blade, leaf sheath, internode, node, pulvinus, root, and young panicle, with relatively high expression in seedlings and leaf sheath (Fig. 1a). Furthermore, the β-glucuronidase (GUS) activity could be detected in the root, seedlings, leaf sheath, pulvinus, leaf blade, and spikelet in transgenic plants carrying an OsZHD1 promoter-GUS reporter gene, the GUS activity of both root and young spikelet was obviously weaker than other tissues, which was consistent with the result of qRT-PCR. The expression of OsZHD1 increased as leaf development processed (Fig. 1j), suggesting that it might have an important function in leaf development. It was also speculated that it was involved in panicle development.
Labs working on this gene
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University.
References
[1] Xu Y, Wang Y H, Long Q Z, et al. Overexpression of OsZHD1, a zinc finger homeodomain class homeobox transcription factor, induces abaxially curled and drooping leaf in rice[J]. Planta, 2014, 239: 803-816. [2] Windhovel A, Hein I, Dabrowa R, Stockhaus J. Characterization of a novel class of plant homeodomain proteins that bind to the C4 phosphoenolpyruvate carboxylase gene of Flaveria trinervia[J]. Plant molecular biology, 2001, 45(2): 201-214. [3] Bürglin T R. A comprehensive classification of homeobox genes[M]. In: Duboule D (ed) Guidebook to the homeobox genes. pp. 25-71. Oxford: Oxford University Press. [4] Mukherjee K, Brocchieri L, Burglin T R. A comprehensive classification and evolutionary analysis of plant homeobox genes[J]. Molecular biology and evolution, 2009, 26(12):2775-2794. [5] Tran L S, Nakashima K, Sakuma Y, et al. Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis[J]. The plant journal, 2007, 49(1): 46-63. [6] Park H C, Kim M L, Lee S M, et al. Pathogen-induced binding of the soybean zinc finger homeodomain proteins GmZF-HD1 and GmZF-HD2 to two repeats of ATTA homeodomain binding site in the calmodulin isoform 4 (GmCaM4) promoter[J]. Nucleic Acids Research, 2007, 35(11): 3612-3623.
Structured Information
| Gene Name |
BGIOSGA029617 |
|---|---|
| Description |
Putative uncharacterized protein |
| Definition |
Oryza sativa Indica Group BGIOSGA029617, complete gene. |
| LocusTag |
OJ1005_D12.28 |
| Ensembl Transcript ID |
BGIOSGA029617-TA |
| Ensembl Protein ID |
BGIOSGA029617-PA |
| Length |
840 |
| Source |
Oryza sativa Indica Group ORGANISM Oryza sativa Indica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 9:16349452..16350291 |
| Sequence Coding Region |
16349452..16350291 |
| Genome Context |
<gbrowseImage1> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=IndicaChromosome09:16349452..16350291 source=RiceIndica09 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</cdnaseq> |
| Protein Sequence |
<aaseq>MDFDDHDDGDEEMPPMPVSSSYETPPQHGLAGGGMAPKPPGEIGSHVKGPSCGGGRYRECLKNHAVGIGGHAVDGCGEFMAAGEEGTIDALRCAACNCHRNFHRKESESLAGEGSPFSPAAVVPYGATPHHQFSPYYRTPAGYLHHHQHHMAAAAAAAAAAAGGHPQRPLALPSTSHSGRDDGDDLSGMVGPMSAVGPLSGMSLGAGPSGSGSGKKRFRTKFTQEQKDKMLAFAERVGWRIQKHDEAAVQQFCDEVGVKRHVLKVWMHNNKHTLGKKLP</aaseq> |
| Gene Sequence |
<dnaseqindica>1..840#ATGGACTTCGATGACCATGACGACGGCGACGAGGAGATGCCGCCGATGCCGGTGAGCTCGAGCTACGAGACTCCGCCGCAGCATGGCCTTGCCGGCGGTGGGATGGCGCCCAAGCCTCCTGGTGAGATTGGCAGCCATGTGAAGGGCCCCAGCTGCGGTGGCGGCAGGTACCGCGAGTGCCTCAAGAACCACGCGGTTGGCATCGGCGGCCACGCCGTGGACGGCTGCGGCGAGTTCATGGCGGCCGGCGAGGAGGGCACCATCGACGCGCTCCGCTGCGCCGCGTGCAACTGCCACCGCAACTTCCACCGGAAGGAGTCCGAGTCGCTCGCCGGCGAGGGCTCGCCCTTCTCCCCGGCCGCCGTCGTCCCCTACGGCGCCACGCCGCACCACCAGTTCTCCCCGTACTACCGCACCCCTGCCGGTTACCTCCACCACCACCAGCACCACATGGCCGCGGCAGCCGCGGCCGCCGCCGCTGCAGCCGGCGGCCACCCGCAGCGGCCCCTCGCGCTCCCGTCCACCTCCCACAGCGGCCGCGACGACGGCGACGACCTGTCCGGGATGGTGGGGCCCATGTCGGCGGTGGGGCCGCTCAGCGGCATGTCCCTCGGCGCCGGCCCGTCCGGCTCCGGCTCCGGCAAGAAGCGGTTCCGCACCAAGTTCACCCAGGAGCAGAAGGACAAGATGCTGGCGTTCGCCGAGCGCGTCGGGTGGCGCATCCAGAAGCACGACGAGGCCGCCGTGCAGCAGTTCTGCGACGAGGTCGGCGTCAAGCGCCACGTGCTCAAGGTGTGGATGCACAACAACAAGCACACCCTGGGCAAGAAGCTGCCATGA</dnaseqindica> |
| External Link(s) |
