Difference between revisions of "Os02g0799100"
Zhangziliang (talk | contribs) (→Evolution) |
Zhangziliang (talk | contribs) (→Evolution) |
||
| Line 40: | Line 40: | ||
===Evolution=== | ===Evolution=== | ||
| + | [[File:Figure S2.jpg|right|thumb|250px|''Alignment of OsSGO1 with ZmSGO1 in maize (from reference <ref name="ref2" />).'']] | ||
''SGO1'' gene is the first meiosis specificity expressed gene in yeast cDNA library screening conducted in Watanabe Lab, as well as to the lack of corresponding mutant phenotype analysis, identified as the homologous gene of Drosophila melanogaster Mei - S332 <ref name="ref4" /><ref name="ref5" />. Many researches of SGO function have been investigated in animals and yeast <ref name="ref6" />, while relatively few has been reported in plants. In plants, ''SGO1'' gene is first found in maize, and the mutant of premature-dissociation centromeric cohesion which locates in the centromere at the stage of anaphase Ⅰ. And the phenotype is due to the deletion of ZmSGO1 protein. ZmSGO1 is found to be located in the centromere from the eptotene stage Previous studies indicates that ZmSGO1 plays an important role in protecting of centromeric cohesion during meiosis I. The OsSGO1 protein sequence,which comprises 486 amino acid residues, shows a high similarity toZmSGO1(209/537 residues identical and 278/537 residues positive(Figure S2) <ref name="ref7" />. | ''SGO1'' gene is the first meiosis specificity expressed gene in yeast cDNA library screening conducted in Watanabe Lab, as well as to the lack of corresponding mutant phenotype analysis, identified as the homologous gene of Drosophila melanogaster Mei - S332 <ref name="ref4" /><ref name="ref5" />. Many researches of SGO function have been investigated in animals and yeast <ref name="ref6" />, while relatively few has been reported in plants. In plants, ''SGO1'' gene is first found in maize, and the mutant of premature-dissociation centromeric cohesion which locates in the centromere at the stage of anaphase Ⅰ. And the phenotype is due to the deletion of ZmSGO1 protein. ZmSGO1 is found to be located in the centromere from the eptotene stage Previous studies indicates that ZmSGO1 plays an important role in protecting of centromeric cohesion during meiosis I. The OsSGO1 protein sequence,which comprises 486 amino acid residues, shows a high similarity toZmSGO1(209/537 residues identical and 278/537 residues positive(Figure S2) <ref name="ref7" />. | ||
Revision as of 09:37, 31 May 2014
The Ossgo1gene encodes the protein OsSGO1 which maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis.
Contents
Annotated Information
Function
Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments [1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1 [2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition [3]. OsSGO1 is specifically required to protect centromeric cohesion during meiosis.OsSGO1 transfers from nucleoli onto centromeres at the onset of prophase in both meiosis and mitosis.The relocalization of OsSGO1 onto centromeres is OsAM1-dependent.The maintenance of SCs in prophase I is affected in Ossgo1 [2].
Mutation
An OsSGO1-RNAi vector is transformed into rice calli by Agrobacterium-mediated DNA transfer. OsSGO1-RNAi lines isobtained by screening the plants regenerated from the transformed calli by PCR. One single Tos17-insertion mutant line of the OsSGO1 gene, Ossgo1-1, is identified by screening the public insertion line collections. Sequence analysis of its PCR products confirmed that Tos17 is inserted into exon 15, only 5 bp upstream from the stop codon(Figure S1). [2] .
Expression(Mutant VS Wild type)
OsSGO1 is expressed most highly in the roots, secondly in the panicles, and at a relatively low level in leaves(Figure S3)[2]. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophase Ⅰand anaphase II, respectively, which finally leads to sterile pollen formation[1]. The homozygous Ossgo1-1 mutant grows normally in the vegetative stage but is sterile during the flowering phase, and its pollen is completely non-viable when evaluated by 1% I2-KI solution staining (Figure S4). The transcription level of OsSGO1 is slightly decreased in the Ossgo1-1 mutant (Figure S3). Additionally, by performing RT-PCR, it is found that the Ossgo1-1 cDNA sequence is altered downstream of the Tos17-insertion position by the addition of 71 nucleotides, and the whole cDNA lacks a stop codon (Figure S5). Additionally, an allelic mutant of Ossgo1-1 with a deletion of 15 bp (nucleotides 1773–1787 in the gene) from the mutants induced by 60 Co~γ-ray radiation is identified and is named as Ossgo1-2 (Figure S1), which results in five amino acids missing in OsSGO1. The homozygous Ossgo1-2 mutant is also normal in the vegetative stage but completely sterile (Figure S4). Neither of the mutants set seeds when pollinated with pollen from the wild-type plants. Additionally, through immunoblotting, it is found that the expression level of OsSGO1 protein is indeed down-regulated in Ossgo1-1 and OsSGO1RNAi plants (Figure S5) [2].
| Primer | Forward primer | Reverse primer |
|---|---|---|
| Gene amplication | 5'-CGAAACCTCATCGGATTCCT-3' | 5'-GCCAATGGTGTTTGTGCTCT-3' (used to amplify the predicted coding regions of OsSGO1 [2]) |
| 5'-ATTGTTAGGTTGCAAGTTAGTTAAGA' | 5'-GCCTCGAACAAAGAGGACTG-3' (used to amplify the Tos17 inserted regions of ossgo1 [2]) | |
| 5'-GTGAATTCCCATTGAGGATCCAGAGCCACCA-3' | 5'-AGTCTCGAGTACCTATCACCTGCTCGTCAGA-3' (used to amplify the fragment of OsSGO1 cDNA [2]) | |
| RT-PCR | 5'-TCAATCAGCTGTGCCATCTT-3' | 5'-CATCTTGCCACCACA AATCA-3' [2] |
Evolution
SGO1 gene is the first meiosis specificity expressed gene in yeast cDNA library screening conducted in Watanabe Lab, as well as to the lack of corresponding mutant phenotype analysis, identified as the homologous gene of Drosophila melanogaster Mei - S332 [4][5]. Many researches of SGO function have been investigated in animals and yeast [6], while relatively few has been reported in plants. In plants, SGO1 gene is first found in maize, and the mutant of premature-dissociation centromeric cohesion which locates in the centromere at the stage of anaphase Ⅰ. And the phenotype is due to the deletion of ZmSGO1 protein. ZmSGO1 is found to be located in the centromere from the eptotene stage Previous studies indicates that ZmSGO1 plays an important role in protecting of centromeric cohesion during meiosis I. The OsSGO1 protein sequence,which comprises 486 amino acid residues, shows a high similarity toZmSGO1(209/537 residues identical and 278/537 residues positive(Figure S2) [7].
Knowledge Extension
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
- ↑ 1.0 1.1 ChiZhengchang. (2010) Functional Analysis of the Meiotic Gene OsSGO1 in Oryza sativa. Yangzhou university
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 Mo Wang, Ding Tang, Kejian Wang, et.al. (2011) OsSGO1 maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis. The Plant Journal. 67 : 583-594
- ↑ Che, L., Tang, D., Wang, K., et.al. (2011) OsAM1 is required for leptotene-zygotene transition in rice. Cell Res.21 :654–665.
- ↑ Tomoya S. Kitajima1, Shigehiro A. Kawashima1,Yoshinori Watanabe1.(2004) The conserved kinetochore protein shugoshin protects centromeric cohesion during meiosis. Nature. 427 :510–517.
- ↑ Kiburz, B.M., Reynolds, D.B., Megee, P.C., et.al. (2005) The core centromere and Sgo1 establish a 50-kb cohesin-protected domain around centromeres during meiosis I. EMBO J. 22 :3017-3030.
- ↑ Vahan B. Indjeian, Bodo M. Stern, Andrew W. Murray. (2005) OsAM1 is required for leptotene-zygotene transition in rice. Science. 307 :130–133.
- ↑ Olivier Hamant, Inna Golubovskaya, Robert Meeley, et.al. (2005) A REC8-Dependent Plant Shugoshin Is Required for Maintenance of Centromeric Cohesion during Meiosis and Has No Mitotic Functions. Current Biology. 15 : 948–954.
Structured Information
| Gene Name |
Os02g0799100 |
|---|---|
| Description |
Hypothetical protein |
| Version |
NM_001186253.1 GI:297721638 GeneID:9266998 |
| Length |
3610 bp |
| Definition |
Oryza sativa Japonica Group Os02g0799100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 2:34917690..34921299 |
| Sequence Coding Region |
34920472..34920601,34920706..34920743,34920892..34921040,34921133..34921148 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>atggcggccgctgcaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggagaacgccaagttgcgtcatctgcttgctgagcgaaacaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattag</cdnaseq> |
| Protein Sequence |
<aaseq>MAAAAGAAARGGGVIPAGKGGSLRSPGKPVVLADITNTGRPNPT GSVHAIADVLKENAKLRHLLAERNKVIEVSRVELQKIRLALQAMQQKNLQLVQANSQM FAVCLLIH</aaseq> |
| Gene Sequence |
<dnaseqindica>699..828#557..594#260..408#152..167#tctccgaaacctcatcggattcctctccgcgcggctaccggagcgccgcctctctctccccgcgcgcgcgctgcggctccgagggtcctcgccggcttcacctccggcggtggcgtgcgcaaccacaggccccgcggccgctgggccagccatggcggccgctgcaggtaaaaatcgtatcccctagatttcgagctacccgtggcattccatggtggggttctctcgggctcagcttccgcacctcctcctaaaccaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggtgatttcagttctagctctattttttttttcttcgggggatttcggttctaactcaaacaagcagacaaccctagcagcgccaagttgaatgctagtaattccgatttccatccgattaaaccatttaattcctcccttgctttcaggagaacgccaagttgcgtcatctgcttgctgagcgaaagtatgcattgcctctaccatccattttgttgtcggaggataaaacctgcggtttctcaagtagcacagttttttttaaattattttttgctttcttatttgcagcaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattagctccctacctcaccattcttgtgtcaatgtttgtttatacttgtgcaatgctggttcaccaggcctgtaggttgagcacatagtttgagttatagctatgcataatggcaaatgagaagtgtttgtcttacttcattgctgattgttttgtggtagttacagactgtttgatatgtctatgttttcttcttccttgcaggaaataaatcaaggaaaagatagagtaagctgcctctggttctttgttgtttgaattttcaaatgcagtatgatttctgatttggggattaatctgtggatatgacatgcagatcaagttattgcaacatgaacttgcatgcacaatagccgtgctcaaagtaaagggttctgaactcgaggtaattctaaagcttgactgtatgaacctctgtttgttacatataacatgcttttctcatcgtctactattgcagaagatgagtaagacttctaacaatcaacaaaatagagcaaagatattggtatgcagtcaaattcttaagcaaatgattcaccatgtttagctgcattatttctagttctgaattctgaaatcgttctgttcgtgcaacataatcaggagaaaaaaaccaggtcttccaaatgcgcaccaactaaggctcatcaaatggctgcaggttctattagagaacatttggttgaaattcaatgtaatgctcactcttctcactatttctttcttgaactagatactatacctggcaatcgtttcatctatcctactttatggttataatttaccccctttatatgaagcaattgaagttttatgttttttcctctgccataagttaggacactagtaaaattctaatcttcatttgttgccaatttcttctcagcagctgtgccatcttatactagctgtcatgagcctccacaggataaaacaaacaagaggtattttcatctctttactgatgtttgagtgggtgactggttgaccgggttatagtagcctatttcatgcatcactacttattcagcatgtttgcaaacaggtgcacaaataggcggaagtcagaatcatgtgaagttacaatggataccaacacagtgcaacatagctgcagacctcatgtggaatataatgggtcatcgcatgatgatgatccaaggtaatcaatgcttaatgcttataacagaatgcgttcattgttgcatcattatctgatttaagcttgttcaaaactcttgggcacatgtggtcagaaaaactcgacggagaaggtctgccagattgaaccctggatcttttgaggtcgcagagatctgtgataaattgcatgaggatgctactgttccttcggctcctagttctaatgttccaaagctgcaggaaccaaatgctggaaaagatatggtagggttttactatttctttctgtttttctgtttcaaaaaaaatttcacaatgtggttatgattttgtgctagatttgtggtggcaagatgaagtcattgcaaaaagaacttccatgtgatgcaatagcgcaagtagtagaggctccagaactcaaggtaattgagcagagtggttcgcatcaaatttttgctagtcttacatatattaatttattttttagtaaaatctggatcctgattgtatgtactagaaaaaacgaagtatgcacacacaaaaggaagtgtatctggaggtgggcaggacagttcttatgtaaataatcctcacatttatccatgaagaagtcttaattcttattatgttcctacttctttcgtccaatgaaattaggagatacaagaagcaggttccagcgttgctggaggtgaggcgcataaatttgatattgaggatccagagccaccaaggtatggcacatcattttagcagggtttaagatgcatggtacatcacacaattcacctaaacaatatgctctgtccaatcagaaaatcaatgcgtattgatgcaaacaaacggaagctggaatcatttgagagtcgattggcctcgaacaaagaggactgcatcaatgccatatgcgactcaacttcaagcgtgccaattcagcatgaacaaaagaggtaactctctcctatattccaacgatgcactttcctctgcatggaacatgtcaatcatggctgcccttaatactgcagaaaattgtcaaggagaaaatcctcaagactggaccctggaccttgggaggtcacaaatggcacttttgaaattgtccaggaagatacagttgccccgtctgctccttccagttcaaatgctttgatcgagcagaccaaaaatgatatgcaaaacgaccgcagttgctcgactaaaccttctgacgagcaggtgataggtagaagatcttcagttgggaggccctcaagacgggcagcagaaaagatagtctcctacaaggaggtgcccttgaatattaagatgcgacgaccatgatccccacttgcatgcaaagagcacaaacaccattggcatttattttatggtgtagaatcaagtttgttgtgtatctatctgttttggtcgctgtcaataggtaggttagctcctctatctaccccaacatggatactcaccctgcatcccagtttcaaactgaccatggaatttatctgatttagcctcagtctggactgatgatgccgataacaaccagcaaaccattgttcctgttctgatgaagtagagaccagacaacaataatgtggttagtactgttttattttcttgatggttctcatatgttgagagatc</dnaseqindica> |
| External Link(s) |