Difference between revisions of "Os11g0582500"
(→Evolution) |
(→Structured Information) |
||
| Line 20: | Line 20: | ||
==Structured Information== | ==Structured Information== | ||
{{JaponicaGene| | {{JaponicaGene| | ||
| − | GeneName = | + | GeneName = OsC6| |
Description = Similar to Anther specific protein| | Description = Similar to Anther specific protein| | ||
Version = NM_001074690.1 GI:115486028 GeneID:4350790| | Version = NM_001074690.1 GI:115486028 GeneID:4350790| | ||
Revision as of 12:28, 1 June 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.
Expression
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).
Evolution
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
OsC6 |
|---|---|
| Description |
Similar to Anther specific protein |
| Version |
NM_001074690.1 GI:115486028 GeneID:4350790 |
| Length |
1584 bp |
| Definition |
Oryza sativa Japonica Group Os11g0582500, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 11:23859388..23860971 |
| Sequence Coding Region |
23859461..23859815,23860411..23860454 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq> |
| Protein Sequence |
<aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq> |
| Gene Sequence |
<dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica> |
| External Link(s) |