Difference between revisions of "Os10g0542100"
Zhangyulong (talk | contribs) (→Labs working on this gene) |
Zhangyulong (talk | contribs) (→References) |
||
| Line 12: | Line 12: | ||
==References== | ==References== | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
==Structured Information== | ==Structured Information== | ||
Revision as of 14:49, 27 August 2014
Please input one-sentence summary here.
Contents
Annotated Information
Function
Plant MTs have been suggested to play important roles in maintaining the homoeostasis of essential transition metals, detoxification of toxic metals, and protecting against intercellular oxidative stress.
Expression
Evolution
Labs working on this gene
References
Structured Information
| Gene Name |
Os10g0542100 |
|---|---|
| Description |
Plant EC metallothionein-like protein, family 15 protein |
| Version |
NM_001071727.1 GI:115483197 GeneID:4349263 |
| Length |
737 bp |
| Definition |
Oryza sativa Japonica Group Os10g0542100, complete gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 10:21623772..21624508 |
| Sequence Coding Region |
21623825..21623883,21623970..21624174 |
| Expression | |
| Genome Context |
<gbrowseImage1> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=NC_008403:21623772..21624508 source=RiceChromosome10 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>atggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctga</cdnaseq> |
| Protein Sequence |
<aaseq>MGCDDKCGCAVPCPGGTGCRCASSARSGGGDHTTCSCGDHCGCN PCRCGRESQPTGRENRRAGCSCGDSCTCASCGSTTTTAPAATT</aaseq> |
| Gene Sequence |
<dnaseqindica>54..112#199..403#actgtacagggtagtagatctttcgtacgttggagccggccggatcgacgaccatggggtgcgacgacaagtgcgggtgcgccgtcccgtgccccggcggcacgggctgcaggtacggcgatctggtcgcccttggcatcttggcgaccgtgaaaccaactgaacaattcaagtgtatgtccacgcgtgtgggtgcaggtgcgcgtcttcggcgaggagcggcggcggcgaccacacgacgtgctcgtgcggcgaccactgcgggtgcaacccgtgcaggtgcggccgcgagtcgcagccgacggggagggagaaccggagggccggctgctcctgcggcgactcctgcacctgcgcctcctgcggctccaccaccaccaccgctcccgcggccaccacctgatccatccatccatgcgcccaaaaatgcccaacgagacgtgtttatacgtgtggttaagcgtgtgtacgtgcgccatgcttagtactcatagctgcttagctaaacagcacagctgataaataaaaagggcttgctgcttgagtcgagtcgtatcccgttgtctagttctggctagactcgcgcatcacgcatgcaacggacatggtgatacgcgagggatggagagttcggagttgggagacactgtgtactgcagtaccaggttgataagtgtgtctgtacttgtgtaaatatgttttacatgaataaaaaggttggtaactttgtcatgttt</dnaseqindica> |
| External Link(s) |