Difference between revisions of "BGIOSGA034718"
| Line 20: | Line 20: | ||
==Structured Information== | ==Structured Information== | ||
| − | + | [[Category:Genes]][[Category:Oryza Sativa Indica Group]][[Category:Indica Chromosome 11]] | |
==Annotated Information== | ==Annotated Information== | ||
Latest revision as of 03:16, 12 May 2015
Please input one-sentence summary here.
Contents
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
| Gene Name |
BGIOSGA034718 |
|---|---|
| Description |
Putative uncharacterized protein |
| Definition |
Oryza sativa Indica Group BGIOSGA034718, complete gene. |
| LocusTag |
OS11G0128300 |
| Ensembl Transcript ID |
BGIOSGA034718-TA |
| Ensembl Protein ID |
BGIOSGA034718-PA |
| Length |
318 |
| Source |
Oryza sativa Indica Group ORGANISM Oryza sativa Indica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Chromosome 11:1035210..1035527 |
| Sequence Coding Region |
1035210..1035527 |
| Genome Context |
<gbrowseImage1> name=IndicaChromosome11:1035210..1035527 source=RiceIndica11 preset=GeneLocation </gbrowseImage1> |
| Gene Structure |
<gbrowseImage2> name=IndicaChromosome11:1035210..1035527 source=RiceIndica11 preset=GeneLocation </gbrowseImage2> |
| Coding Sequence |
<cdnaseq>ATGGGGCCTCAGCAAGACCGGTCGGCGGCCAAGCCGTACGCGAACGGCAGCACGGCGGCGGCGGCGGCGGCGGGGAGGAAGGAGAACAACAAGGTGGTGCGGTACAGGGAGTGCCAGCGCAACCACGCCGCCAGCATCGGCGGCCACGCCGTCGACGGCTGCCGCGAGTTCATGGCGTCGGGCGCCGAGGGCACCGCCGCCGCGCTCCTCTGCGCCGCCTGCGGCTGCCACCGGAGCTTCCACAGGCGAGAGGTGGAGGCCGCCGCCGCCGAATGCGACTGCTCCTCCGACACCTCCTCCGGCACCGGCCGCCGGTGA</cdnaseq> |
| Protein Sequence |
<aaseq>MGPQQDRSAAKPYANGSTAAAAAAGRKENNKVVRYRECQRNHAASIGGHAVDGCREFMASGAEGTAAALLCAACGCHRSFHRREVEAAAAECDCSSDTSSGTGRR</aaseq> |
| Gene Sequence |
<dnaseqindica>1..318#ATGGGGCCTCAGCAAGACCGGTCGGCGGCCAAGCCGTACGCGAACGGCAGCACGGCGGCGGCGGCGGCGGCGGGGAGGAAGGAGAACAACAAGGTGGTGCGGTACAGGGAGTGCCAGCGCAACCACGCCGCCAGCATCGGCGGCCACGCCGTCGACGGCTGCCGCGAGTTCATGGCGTCGGGCGCCGAGGGCACCGCCGCCGCGCTCCTCTGCGCCGCCTGCGGCTGCCACCGGAGCTTCCACAGGCGAGAGGTGGAGGCCGCCGCCGCCGAATGCGACTGCTCCTCCGACACCTCCTCCGGCACCGGCCGCCGGTGA</dnaseqindica> |
| External Link(s) |
