Os02g0799100

From RiceWiki
Revision as of 02:19, 31 May 2014 by Zhangziliang (talk | contribs) (Expression(Mutant VS Wild type))
Jump to: navigation, search

Please input one-sentence summary here.

Annotated Information

Function

Os02g0799100 is the rice(Oryza sativa) homologue of the maize Sgo1 gene. It encodes an homolog of shugoshin protein ZmSGO1 in maize (Zea mays), named OsSGO1. The gene OsSGO1 is essential for rice meiosis and plays an important role in protecting centromeric cohesion during meiosis. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophaseⅠand anaphase II, respectively, which finally leads to sterile pollen formation.And the OsSGO1 localizes to centromere from the result of immunostaining experiments [1]. In addition to the meiosisspecific maintenance of centromeric cohesion, OsSGO1 is required for the timely assembly and maintenance of SCs during early prophase I. Furthermore, the centromeric localization of OsSGO1 depends on OsAM1 [2]. OsAM1 is the homolog of Arabidopsis SWI1 and maize AM1 in rice and is required for the leptotene–zygotene transition [3]. OsSGO1 is specifically required to protect centromeric cohesion during meiosis.OsSGO1 transfers from nucleoli onto centromeres at the onset of prophase in both meiosis and mitosis.The relocalization of OsSGO1 onto centromeres is OsAM1-dependent.The maintenance of SCs in prophase I is affected in Ossgo1 [2].

Mutation

File:Figure S1.tiff An OsSGO1-RNAi vector is transformed into rice calli by Agrobacterium-mediated DNA transfer. OsSGO1-RNAi lines isobtained by screening the plants regenerated from the transformed calli by PCR. One single Tos17-insertion mutant line of the OsSGO1 gene, Ossgo1-1, was identified by screening the public insertion line collections. Sequence analysis of its PCR products confirmed that Tos17 was inserted into exon 15, only 5 bp upstream from the stop codon. [2] .

Expression(Mutant VS Wild type)

File:Figure S3.jpg
Expression analysis of OsSGO1 (from reference [2]).

OsSGO1 is expressed most highly in the roots, secondly in the panicles, and at a relatively low level in leaves (Figure S3) [2]. The knockdown of OsSGO1 may cause precocious disassociation and random segregation of sister chromatids at telophase Ⅰand anaphase II, respectively, which finally leads to sterile pollen formation[1]. The homozygous Ossgo1-1 mutant grew normally in the vegetative stage but was sterile during the flowering phase, and its pollen was completely non-viable when evaluated by 1% I2-KI solution staining (Figure S4). The transcription level of OsSGO1 was slightly decreased in the Ossgo1-1 mutant (Figure S3). Additionally, by performing RT-PCR, we found that the Ossgo1-1 cDNA sequence is altered downstream of the Tos17-insertion position by the addition of 71 nucleotides, and the whole cDNA lacks a stop codon (Figure S5). Additionally, we identified an allelic mutant of Ossgo1-1 with a deletion of 15 bp (nucleotides 1773–1787 in the gene) from the mutants induced by 60Co~γ-ray radiation and named as Ossgo1-2 (Figure S1), which results in five amino acids missing in OsSGO1. The homozygous Ossgo1-2 mutant was also normal in the vegetative stage but completely sterile (Figure S4). Neither of the mutants set seeds when pollinated with pollen from the wild-type plants [2].

Primer Forward primer Reverse primer
Gene amplication 5'-CGAAACCTCATCGGATTCCT-3' 5'-GCCAATGGTGTTTGTGCTCT-3' (used to amplify the predicted coding regions of OsSGO1 [2])
5'-ATTGTTAGGTTGCAAGTTAGTTAAGA' 5'-GCCTCGAACAAAGAGGACTG-3' (used to amplify the Tos17 inserted regions of ossgo1 [2])
5'-GTGAATTCCCATTGAGGATCCAGAGCCACCA-3' 5'-AGTCTCGAGTACCTATCACCTGCTCGTCAGA-3' (used to amplify the fragment of OsSGO1 cDNA [2])
RT-PCR 5'-TCAATCAGCTGTGCCATCTT-3' 5'-CATCTTGCCACCACA AATCA-3' [2]

Evolution

Please input evolution information here.

Knowledge Extension

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

  1. ChiZhengchang. (2010) Functional Analysis of the Meiotic Gene OsSGO1 in Oryza sativa. Yangzhou university.
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 Mo Wang, Ding Tang, Kejian Wang, et al. (2011) OsSGO1 maintains synaptonemal complex stabilization in addition to protecting centromeric cohesion during rice meiosis. The Plant Journal: 583-594.
  3. Che, L., Tang, D., Wang, K., et.al. (2011) OsAM1 is required for leptotene-zygotene transition in rice. Cell Res.:654–665.

Structured Information

Gene Name

Os02g0799100

Description

Hypothetical protein

Version

NM_001186253.1 GI:297721638 GeneID:9266998

Length

3610 bp

Definition

Oryza sativa Japonica Group Os02g0799100, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 2

Location

Chromosome 2:34917690..34921299

Sequence Coding Region

34920472..34920601,34920706..34920743,34920892..34921040,34921133..34921148

Expression

GEO Profiles:Os02g0799100

Genome Context

<gbrowseImage1> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008395:34917690..34921299 source=RiceChromosome02 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>atggcggccgctgcaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggagaacgccaagttgcgtcatctgcttgctgagcgaaacaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattag</cdnaseq>

Protein Sequence

<aaseq>MAAAAGAAARGGGVIPAGKGGSLRSPGKPVVLADITNTGRPNPT GSVHAIADVLKENAKLRHLLAERNKVIEVSRVELQKIRLALQAMQQKNLQLVQANSQM FAVCLLIH</aaseq>

Gene Sequence

<dnaseqindica>699..828#557..594#260..408#152..167#tctccgaaacctcatcggattcctctccgcgcggctaccggagcgccgcctctctctccccgcgcgcgcgctgcggctccgagggtcctcgccggcttcacctccggcggtggcgtgcgcaaccacaggccccgcggccgctgggccagccatggcggccgctgcaggtaaaaatcgtatcccctagatttcgagctacccgtggcattccatggtggggttctctcgggctcagcttccgcacctcctcctaaaccaggggcagcggcgcgcggtggcggtgtgatcccggccggtaagggtggcagccttcggtcgccggggaaacccgtcgtgctcgccgacatcaccaacaccgggaggcccaaccctactggatccgtccacgccatcgctgacgtcctcaaggtgatttcagttctagctctattttttttttcttcgggggatttcggttctaactcaaacaagcagacaaccctagcagcgccaagttgaatgctagtaattccgatttccatccgattaaaccatttaattcctcccttgctttcaggagaacgccaagttgcgtcatctgcttgctgagcgaaagtatgcattgcctctaccatccattttgttgtcggaggataaaacctgcggtttctcaagtagcacagttttttttaaattattttttgctttcttatttgcagcaaagtcattgaagtcagcagagtagagttgcagaaaatccgcctcgcactgcaagccatgcagcagaagaacttgcaactcgtgcaggctaattcgcagatgtttgcggtttgtctacttatccattagctccctacctcaccattcttgtgtcaatgtttgtttatacttgtgcaatgctggttcaccaggcctgtaggttgagcacatagtttgagttatagctatgcataatggcaaatgagaagtgtttgtcttacttcattgctgattgttttgtggtagttacagactgtttgatatgtctatgttttcttcttccttgcaggaaataaatcaaggaaaagatagagtaagctgcctctggttctttgttgtttgaattttcaaatgcagtatgatttctgatttggggattaatctgtggatatgacatgcagatcaagttattgcaacatgaacttgcatgcacaatagccgtgctcaaagtaaagggttctgaactcgaggtaattctaaagcttgactgtatgaacctctgtttgttacatataacatgcttttctcatcgtctactattgcagaagatgagtaagacttctaacaatcaacaaaatagagcaaagatattggtatgcagtcaaattcttaagcaaatgattcaccatgtttagctgcattatttctagttctgaattctgaaatcgttctgttcgtgcaacataatcaggagaaaaaaaccaggtcttccaaatgcgcaccaactaaggctcatcaaatggctgcaggttctattagagaacatttggttgaaattcaatgtaatgctcactcttctcactatttctttcttgaactagatactatacctggcaatcgtttcatctatcctactttatggttataatttaccccctttatatgaagcaattgaagttttatgttttttcctctgccataagttaggacactagtaaaattctaatcttcatttgttgccaatttcttctcagcagctgtgccatcttatactagctgtcatgagcctccacaggataaaacaaacaagaggtattttcatctctttactgatgtttgagtgggtgactggttgaccgggttatagtagcctatttcatgcatcactacttattcagcatgtttgcaaacaggtgcacaaataggcggaagtcagaatcatgtgaagttacaatggataccaacacagtgcaacatagctgcagacctcatgtggaatataatgggtcatcgcatgatgatgatccaaggtaatcaatgcttaatgcttataacagaatgcgttcattgttgcatcattatctgatttaagcttgttcaaaactcttgggcacatgtggtcagaaaaactcgacggagaaggtctgccagattgaaccctggatcttttgaggtcgcagagatctgtgataaattgcatgaggatgctactgttccttcggctcctagttctaatgttccaaagctgcaggaaccaaatgctggaaaagatatggtagggttttactatttctttctgtttttctgtttcaaaaaaaatttcacaatgtggttatgattttgtgctagatttgtggtggcaagatgaagtcattgcaaaaagaacttccatgtgatgcaatagcgcaagtagtagaggctccagaactcaaggtaattgagcagagtggttcgcatcaaatttttgctagtcttacatatattaatttattttttagtaaaatctggatcctgattgtatgtactagaaaaaacgaagtatgcacacacaaaaggaagtgtatctggaggtgggcaggacagttcttatgtaaataatcctcacatttatccatgaagaagtcttaattcttattatgttcctacttctttcgtccaatgaaattaggagatacaagaagcaggttccagcgttgctggaggtgaggcgcataaatttgatattgaggatccagagccaccaaggtatggcacatcattttagcagggtttaagatgcatggtacatcacacaattcacctaaacaatatgctctgtccaatcagaaaatcaatgcgtattgatgcaaacaaacggaagctggaatcatttgagagtcgattggcctcgaacaaagaggactgcatcaatgccatatgcgactcaacttcaagcgtgccaattcagcatgaacaaaagaggtaactctctcctatattccaacgatgcactttcctctgcatggaacatgtcaatcatggctgcccttaatactgcagaaaattgtcaaggagaaaatcctcaagactggaccctggaccttgggaggtcacaaatggcacttttgaaattgtccaggaagatacagttgccccgtctgctccttccagttcaaatgctttgatcgagcagaccaaaaatgatatgcaaaacgaccgcagttgctcgactaaaccttctgacgagcaggtgataggtagaagatcttcagttgggaggccctcaagacgggcagcagaaaagatagtctcctacaaggaggtgcccttgaatattaagatgcgacgaccatgatccccacttgcatgcaaagagcacaaacaccattggcatttattttatggtgtagaatcaagtttgttgtgtatctatctgttttggtcgctgtcaataggtaggttagctcctctatctaccccaacatggatactcaccctgcatcccagtttcaaactgaccatggaatttatctgatttagcctcagtctggactgatgatgccgataacaaccagcaaaccattgttcctgttctgatgaagtagagaccagacaacaataatgtggttagtactgttttattttcttgatggttctcatatgttgagagatc</dnaseqindica>

External Link(s)

NCBI Gene:Os02g0799100, RefSeq:Os02g0799100