Orf25
Please input one-sentence summary here.
Contents
Annotated Information
Function
ATP synthase in the plant mitochondrial endomembrane consists of F O and F1 parts and plays an important role in energy formation. As the intramembrane compartment of the enzyme, FO consisting of four subunits, orf25, orfB, atp6 and atp9, and functions as a transporter of H+ through the membrane. Changes in DNA sequence within the atp6 and atp9 genes, as well as in their upstream or downstream regions, were known to be closely related to male sterility in plants.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
| Gene Name |
orf25 |
|---|---|
| Description |
hypothetical protein |
| Version |
GeneID:6450126 |
| Length |
594 bp |
| Definition |
Oryza sativa Japonica Group orf25, Mitochondrion gene. |
| Source |
Oryza sativa Japonica Group ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
| Chromosome | |
| Location |
Mitochondrion:18402..18995 |
| Sequence Coding Region |
18402..18995 |
| Genome Context |
<gbrowseImage1> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1> |
| Gene Structure (RNA Editing) |
<gbrowseImage2> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2> |
| Protein Sequence |
<aaseq>MGLSSTDKKDRRNMLFAAILFICALSSKKILIYNEEMIVACCFIGFLIFSRKSLGKTFKETLDGRIESIQEELQQFFNPNEVILGESNEQQRLLRISLRICSAVVESLPTARCAPKCEKTVQALLCRNLNVKLATLLNAISSRRIRLQDDIVTGFHFSVSERFVSGSTFKASTVEQIREAFVPIDLIREGLIVLRKV</aaseq> |
| Gene Sequence |
<dnaseqindica>1..594#atgggattgagttcaacggataagaaggatagaagaaatatgctatttgctgctattccatctatttgtgcatcaagtccgaagaagatctcaatctataatgaagaaatgatagtagctcgttgttttataggctttctcatattcagtcggaagagtttaggtaagactttcaaagaaactctcgacgggagaatcgagtctattcaggaagaattgcagcaattcttcaatcctaacgaagtaattccgggggaatccaatgaacaacaacgattacttaggatcagcttgcgaatttgcagcgccgtagtagaatcattaccaacggcacgctgtgcgcctaagtgcgaaaagacagtgcaagctttgttatgccgaaacctaaatgtaaagtcagcaacacttctaaatgccacttcttcccgtcgcatccgtcttcaggacgatatagttacaggttttcacttttcagtgagtgaaagatttgtatccgggtctacgttcaaagcttctactgtagaacaaattcgagaggccttcgtacccatagacctaattcgggaaggcttgatagtcctaagaaaggtgtag</dnaseqindica> |
| External Link(s) |