Os01g0839100

From RiceWiki
Revision as of 04:00, 2 January 2015 by Zhangye (talk | contribs) (References)
Jump to: navigation, search

As a salt-responsive zinc finger protein gene, ZFP179 was identified and subsequently cloned from rice seedlings[1][2].

Annotated Information

Function

The ZFP179 gene containing a complete ORF of 516 bp was cloned by RT-PCR from total RNA prepared from rice seedlings. The predicted protein product of ZFP179 comprises 171 amino acids with the calculated molecular mass of 17.95 kDa[1]. When plants suffer from salt stress, ZFP179(ZINC FINGER PROTEIN179) might either enhance the expression of stress-defence genes, such as OsP5CS, OsProT, and OsLEA3, and the subsequent accumulation of free proline, soluble sugars, and Group 3 late embryogenesis abundant proteins through an ABA-dependent manner, or activate the expression of OsDREB2A through an ABA-independent pathway. Both types of response may increase the salt tolerance of plants. In addition, ZFP179 may enhance ROS-scavenging activity to remove the toxic ROS in plants induced by salt stress. Also, ZFP179 functions as a transcriptional activator in yeast. SERF1 Is a Direct Regulator of MAP3K6, MAPK5,DREB2A, ZFP179, and SERF1[1][2].

Mutation

Figure 1.Effect of ZFP179 overexpression on salt tolerance in transgenic rice plants.(from reference [1]).

To study the physiological function of ZFP179, transgenic rice plants that overexpressed ZFP179 (ZFP179-ox plants) were generated. The effect of salt on the seedling development of the ZFP179 overexpression (ZFP179-ox) lines was investigated. Homozygous transgenic lines, S1, S2, S5, and S6 of the T3 generation were used to measure their performance under salt stress(figure 1)[1].

Expression

the expression pattern of ZFP179[1]:

  • The real-time RT-PCR analysis showed that ZFP179 was highly expressed in immature spikes, and markedly induced in the seedlings by NaCl, PEG 6000, and ABA treatments.
  • Overexpression of ZFP179 in rice increased salt tolerance and the transgenic seedlings showed hypersensitivity to exogenous ABA:
    • With OsRAC1 as the reference gene, the T2 generation of the transgenic lines showed higher expression levels of ZFP179 than the WT control (Fig. 1B).The wild-type and ZFP179-ox transgenic rice seeds were germinated and grown on media containing 0, 150, and 250 mM NaCl for 2 weeks. It was observed that transgenic rice plants grew better than wild-type plants(Fig. 1C), as reflected by comparisons of shoot length(Fig. 1D) and fresh weight (Fig. 1E). After recovering for 7 d, more transgenic seedlings survived than WT plants which appeared to be mostly withered (Fig. 1F). The survival rates of transgenic lines were significant higher than those of WT plants (Fig. 1G).ZFP179 plays a crucial role in the plant response to salt stress, and is useful in developing transgenic crops with enhanced tolerance to salt stress.
  • The increased levels of free proline and soluble sugars were observed in transgenic plants compared to wild-type plants under salt stress.
  • The ZFP179 transgenic rice exhibited significantly increased tolerance to oxidative stress, the reactive oxygen species (ROS)-scavenging ability, and expression levels of a number of stress-related genes, including OsDREB2A, OsP5CS, OsProT, and OsLea3 under salt stress.
  • ZFP179 gene was amplified from total RNA prepared from rice seedlings by RT-PCR using the primers as follows: 5'-AGAGAAGAAGCGGAGAGCAA-3' and 5'-TACAGACGCCAATTCAATTC-3'.
  • The ZFP179 transcripts were detected in all organs tested, and the highest level was found in immature spikes and the lowest in leaves.
  • real-time RT-PCR was performed to examine the expression pattern of ZFP179 in rice seedlings under different stress conditions:
    • Under salt stress, the transcripts of ZFP179 began to increase 3 h after NaCl treatment and gradually accumulated up to 24 h.
    • For PEG 6000 stress, it was observed that ZFP179 was up-regulated 1 h after treatment and was maintained constant up to 24 h.
    • The expression of ZFP179 was also induced by an exogenous 0.1 mM ABA treatment.
  • Overexpression of ZFP179 increases proline and soluble sugar contents under salt stress, making seedlings hypersensitive to ABA. Also, ZFP179 enhances the ROS scavenging ability and the tolerance to oxidative stress, and decreases H2O2 production and enhances POD activity and oxidative stress tolerance.

Evolution

Figure 2.Phylogenetic tree analysis of amino acid sequences of ZFP179 with the other stress-responsive C2H2-type zinc finger proteins.(from reference [1])
Figure 3.Comparison of the deduced amino acid sequence of DgZFP2 and other plant Cys2/His2-type zinc finger proteins.(from reference [3])

A homology search against the GenBank database showed that ZFP179 was homologous to many plant C2H2-type zinc finger proteins, especially in finger domains. Like most reported C2H2-type zinc finger proteins, ZFP179 contains a DLN-box/EARmotif with a consensus of DLN at the C-terminus, but it lacks a B-box functioning as a putative nuclear localization signal (NLS). A phylogenetic tree was constructed using Neighbor–Joining method with the full-length amino acid sequences to investigate the evolutionary relationship among plant C2H2-type zinc finger proteins involved in stress responses(Figure 2). The result revealed that ZFP179 was clustered with ZFP182, ZFP150, and ZAT12, whereas other stress responsive zinc finger proteins were categorized into another big branch[1].

Phylogenetic analysis revealed that DgZFP2 was clustered with ZFP179 and ZAT12, and more closely related to the ZAT12.The expression patterns of DgZFP2 were similar to ZFP179 and ZAT12 during several different stresses(figure 3)[3].

Knowledge Extension

Figure 4.Proposed Role of SERF1 during the Initial Response to Salt Stress.(from reference [2])

Transcription factors (TFs) play critical roles in plant responses to salt stress via transcriptional regulation of the downstream genes responsible for plant tolerance to salt challenges. The Cys2/His2-type zinc finger proteins constitute one of the largest transcription factor families in eukaryotes[4]. A number of stressresponsive C2H2-type zinc finger proteins have been identified in various plant species[1][4]. However, the roles of the C2H2-type zinc finger proteins in plant stress responses are still not well known. Several genes of zinc finger protein have previously been identified in rice[5][6]. ZFP245, the first C2H2-type zinc finger protein identified in rice was induced by cold and drought stresses[5]. A salt inducible zinc finger gene ZFP182 could improve salt tolerance in transgenic tobacco and rice plants[7]. Overexpression of ZFP252, a salt- and drought-inducible zinc finger protein gene conferred salt and drought tolerance[6]. To date, by screening databases such as NCBI, Gramene, and PlantTFDB, at least 878 zinc finger genes have been identified in rice. They are distributed among 12 chromosomes: 121 are encoded on chromosome 1, and 45 are encoded on chromosome 11. Stress conditions induce the expression of some zinc finger transcription factors, and stressregulated zinc finger transcription factors have been shown to play important roles in the stress response[8]. Romy Schmidt et al. discovered an H2O2-mediated molecular signaling cascade important for the initial response to salinity in rice (Figure 8). We have shown that SERF1 is a phosphorylation target of a salt-responsive MAPK, thereby promoting the expression of MAPK cascade genes (MAPK5 and MAP3K6), salt tolerance–mediating TF genes (ZFP179 and DREB2A), and itself through direct interaction with the corresponding promoters in planta. In essence, salt stress results in a wave of H2O2 production [9]that activates SERF1 through the MAPK pathway[2].

Labs working on this gene

  • National Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Agriculture, Nanjing Agricultural University, Nanjing

210095, China

  • Institute of Biochemistry and Biology, University of Potsdam, 14476 Potsdam, Germany
  • Max Planck Institute of Molecular Plant Physiology, 14476 Potsdam, Germany
  • Centre de Coopération Internationale en Recherche Agronomique pour le Développement, Unité Mixte de Recherche, Genetic

Improvement and Adaptation of Mediterranean and Tropical Plants, 34398 Montpellier, cedex 5, France

  • Department of Molecular Genetics, Centre for Research in Agricultural Genomics, Consejo Superior de Investigaciones Científicos,Institute of Agro-food Research and Technology, Autonomus University of Barcelona, University of Barcelona, Bellaterra (Cerdanyoladel Vallés), 08193 Barcelona, Spain

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Sun S J, Guo S Q, Yang X, et al. Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice[J]. Journal of experimental botany, 2010: erq120.
  2. 2.0 2.1 2.2 2.3 Schmidt R, Mieulet D, Hubberten H M, et al. SALT-RESPONSIVE ERF1 regulates reactive oxygen species–dependent signaling during the initial response to salt stress in rice[J]. The Plant Cell Online, 2013, 25(6): 2115-2131.
  3. 3.0 3.1 Liu Q L, Dong F L, Xiao F, et al. Isolation and molecular characterization of DgZFP2: A gene encoding a Cys2/His2-type zinc finger protein in chrysanthemum[J]. African Journal of Agricultural Research, 2012, 7(32): 4499-4504.
  4. 4.0 4.1 Kubo K, Sakamoto A, Kobayashi A, et al. Cys2/His2 zinc-finger protein family of petunia: evolution and general mechanism of target-sequence recognition[J]. Nucleic acids research, 1998, 26(2): 608-615.
  5. 5.0 5.1 Huang J, Wang J F, Wang Q H, et al. Identification of a rice zinc finger protein whose expression is transiently induced by drought, cold but not by salinity and abscisic acid[J]. Mitochondrial DNA, 2005, 16(2): 130-136.
  6. 6.0 6.1 Xu D Q, Huang J, Guo S Q, et al. Overexpression of a TFIIIA-type zinc finger protein gene< i> ZFP252</i> enhances drought and salt tolerance in rice (< i> Oryza sativa</i> L.)[J]. FEBS letters, 2008, 582(7): 1037-1043.
  7. Huang J, Yang X, Wang M M, et al. A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a role in salt tolerance[J]. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression, 2007, 1769(4): 220-227.
  8. Guan Q, Wang L, Bu Q, et al. The rice gene< i> OsZFP6</i> functions in multiple stress tolerance responses in yeast and< i> Arabidopsis</i>[J]. Plant Physiology and Biochemistry, 2014, 82: 1-8.
  9. Mittler R, Vanderauwera S, Suzuki N, et al. ROS signaling: the new wave?[J]. Trends in plant science, 2011, 16(6): 300-309.

Structured Information

Gene Name

Os01g0839100

Description

Conserved hypothetical protein

Version

NM_001185713.1 GI:297720560 GeneID:9272517

Length

860 bp

Definition

Oryza sativa Japonica Group Os01g0839100, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 1

Location

Chromosome 1:37757089..37757948

Sequence Coding Region

37757379..37757597

Expression

GEO Profiles:Os01g0839100

Genome Context

<gbrowseImage1> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008394:37757089..37757948 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>gcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctga</cdnaseq>

Protein Sequence

<aaseq>ATPPRRRRRRPRGTGHASTSAPCAGSSSPWGRRSAATCAGTGAR RARRPSCSRTPTTRAAPPCRSRRSPCRT</aaseq>

Gene Sequence

<dnaseqindica>291..509#tttttagctcgtcattaagagcgaaagaaagttacttggaattctttggtttgttgtaatgacaatcacgagagaagaagcggagagcaaggagatggagagcctacgggtgcacgccagcgcgctgctctcgctgtcgtcgcctgcagcgtcggcgtcgcagccgacgtcgtcgtcgtcgacgacggagggggtgttcgagtgcaagacgtgcagcaagcggttcccgtcgttccaggcgctgggcgggcaccggacgagccacacgcggctgcaggcgaagctgctgagcgaccccgccgcggcggcggcggcggcggccgagagggacagggcacgcgtccacgagtgcgccgtgtgcggggtcgagttctccatggggcaggcgctcggcggccacatgcgccggcacaggggcgagacgggcacgacgaccgtcgtgctcgcggacgccgacgactcgggcggcgccaccgtgccgcagccgccggagcccatgccggacctgaactacccgccgctggaggacgccggcgacggctcggagcctgagttacttaaccttcttgtataagttgcatcgatagatatacatgtgaattgaattggcgtctgtacatagatatggtggatggattctttaccaaatttgatcgaaaaaaagaactaaattttggagcgtgatgatcatagcatgtaagttgtaacaaatgattgttaactgtaagataggaattctattcatttgttctcttctgtacaaaattacaaataggttgattaattagttggtcggttgtggttgattctttgtaaaataccaatttactagtataaatatactgacagcttattgtttc</dnaseqindica>

External Link(s)

NCBI Gene:Os01g0839100, RefSeq:Os01g0839100