Os11g0582500

From RiceWiki
Revision as of 12:30, 1 June 2014 by Zhaocf (talk | contribs) (References)
Jump to: navigation, search

Please input one-sentence summary here.

Annotated Information

Function

The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

Expression

OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

Evolution

Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.

Labs working on this gene

School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.) and Bio-X Research Center, Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.), Shanghai Jiao Tong University, Shanghai 200240, China

References

Dasheng Zhang;Wanqi Liang;Changsong Yin;Jie Zong;Fangwei Gu;Dabing Zhang OsC6, Encoding a Lipid Transfer Protein, Is Required for Postmeiotic Anther Development In Rice Plant Physiology, 2010, 154(1): 149-162

Structured Information

Gene Name

OsC6

Description

Similar to Anther specific protein

Version

NM_001074690.1 GI:115486028 GeneID:4350790

Length

1584 bp

Definition

Oryza sativa Japonica Group Os11g0582500, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 11

Location

Chromosome 11:23859388..23860971

Sequence Coding Region

23859461..23859815,23860411..23860454

Expression

GEO Profiles:OsC6

Genome Context

<gbrowseImage1> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008404:23859388..23860971 source=RiceChromosome11 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>

Protein Sequence

<aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>

Gene Sequence

<dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>

External Link(s)

NCBI Gene:OsC6, RefSeq:Os11g0582500