Orf25

From RiceWiki
Revision as of 15:06, 5 June 2014 by M.Chen (talk | contribs) (Labs working on this gene)
Jump to: navigation, search

Please input one-sentence summary here.

Annotated Information

Function

ATP synthase in the plant mitochondrial endomembrane consists of F O and F1 parts and plays an important role in energy formation. As the intramembrane compartment of the enzyme, FO consisting of four subunits, orf25, orfB, atp6 and atp9, and functions as a transporter of H+ through the membrane. Changes in DNA sequence within the atp6 and atp9 genes, as well as in their upstream or downstream regions, were known to be closely related to male sterility in plants.


Expression

Southern hybridization analysis using homologous maize probes indicated that orf25 and coxIII are closely linked in the mitochondrial genome of rice (Oryza sativa) cultivar IR36. The two coding regions were found on the same 5.1 kb BamHI fragment, and this fragment was cloned, mapped and partially sequenced. Using probes for each gene derived from the rice clone, a 2.4 kb dicistronic mRNA transcript was found containing both orf25 and coxIII coding regions. Multiple 5' ends were identified by primer extension analysis and a double stem/loop structure was mapped to the 3' end. The orf25 coding region shares > 85% identity with orf25 sequences from maize, tobacco and wheat, suggesting that orf25 may code for a conserved protein product.

Evolution

The nucleotide sequence of orf25 gene is very conservative in plants.The rice orf25 nucleotide sequence shows a 97.0%, 93.5% and 85.2% identity to wheat (Bonen et al. 1990), maize (Stamper et al. 1987), and tobacco (Stamper et al. 1987), respectively.

Labs working on this gene

Plant Molecular Biology Group, School of Biomedical and Chemical Sciences, The University of Western Australia;
Andrew W.Liu, Department of Biological Sciences, Stanford University.

References

1.Andrew W.Liu,Co-transcription of orf25 and coxllI in rice mitochondria, Curr Genet(1992)21:507-513; 2.J.L. Heazlewood,The products of the mitochondrial orf25 and orfB genes are FO components in the plant F1FO ATP synthase, Volume 540, Issues 1–3, 10 April 2003, Pages 201–205;

Gene Name

orf25

Description

hypothetical protein

Version

GeneID:6450126

Length

594 bp

Definition

Oryza sativa Japonica Group orf25, Mitochondrion gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Mitochondrion

Location

Mitochondrion:18402..18995

Sequence Coding Region

18402..18995

Genome Context

<gbrowseImage1> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1>

Gene Structure
(RNA Editing)

<gbrowseImage2> name=NC_011033:18402..18995 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2>

Protein Sequence

<aaseq>MGLSSTDKKDRRNMLFAAILFICALSSKKILIYNEEMIVACCFIGFLIFSRKSLGKTFKETLDGRIESIQEELQQFFNPNEVILGESNEQQRLLRISLRICSAVVESLPTARCAPKCEKTVQALLCRNLNVKLATLLNAISSRRIRLQDDIVTGFHFSVSERFVSGSTFKASTVEQIREAFVPIDLIREGLIVLRKV</aaseq>

Gene Sequence

<dnaseqindica>1..594#atgggattgagttcaacggataagaaggatagaagaaatatgctatttgctgctattccatctatttgtgcatcaagtccgaagaagatctcaatctataatgaagaaatgatagtagctcgttgttttataggctttctcatattcagtcggaagagtttaggtaagactttcaaagaaactctcgacgggagaatcgagtctattcaggaagaattgcagcaattcttcaatcctaacgaagtaattccgggggaatccaatgaacaacaacgattacttaggatcagcttgcgaatttgcagcgccgtagtagaatcattaccaacggcacgctgtgcgcctaagtgcgaaaagacagtgcaagctttgttatgccgaaacctaaatgtaaagtcagcaacacttctaaatgccacttcttcccgtcgcatccgtcttcaggacgatatagttacaggttttcacttttcagtgagtgaaagatttgtatccgggtctacgttcaaagcttctactgtagaacaaattcgagaggccttcgtacccatagacctaattcgggaaggcttgatagtcctaagaaaggtgtag</dnaseqindica>

External Link(s)

NCBI Gene:orf25