Badh2

From RiceWiki
Revision as of 11:38, 8 June 2014 by He.xia.rainbowfly (talk | contribs) (Created page with " Badh2(truncated betaine aldehyde dehydrogenase ) Contents(hide) Gene,''Badh2''(truncated betaine aldehyde dehydrogenase ),is located a...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
                                 Badh2(truncated betaine aldehyde dehydrogenase )

Contents(hide)

Gene,Badh2(truncated betaine aldehyde dehydrogenase ),is located at the chromosome 8th in Oryza sativa Japonica,the protein it translates is 2-acetyl-1-pyrroline which is the major component of arome specialty rices,shuch as Suyunuo.

1.Annotated Information


1.1Function

 A few varieties of Oryza sativa produce rice of uncommon kind in terms of aroma, kernel colour and chemical composition,termed as “speciality rices”[1].It is known that the major aroma compound is 2-acetyl-1-pyrroline, but this just like “popcorn aroma”. Rice aroma is very complicated and probably numerous oils, phenolics and organic compounds are involved. That is the reason that most aromatic varieties are unique, although a very simplified system of their classification into Nonscented, Scented, and Slightly Scented has been proposed [2].It was reported[3] that Suyunuo, one of the famous scented rice in China, had a total of 58 compounds involved,among which 2-acetyl-1-pyrroline was considered as the main contributor to the characteristic aroma with the concentration of 660 ppb in the variety. Rice aroma according to most Indian and Chinese reports, is controlled by recessive gene(s) without cytoplasm effect[4,5.6].
1.2Mutation
1.3Expression
           

Primer pair 1

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity 

Forward primer GGCTTCCGTGACTTGTTTGG Plus 20 567 586 59.69 55.00 3.00 0.00 Reverse primer AACCATAGGAGCAGCTGAAATA Minus 22 754 733 57.22 40.91 6.00 2.00 Product length 188

Primer pair 2

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity 

Forward primer TTAGGTTCTGAAGCCGGTGC Plus 20 649 668 60.32 55.00 5.00 2.00 Reverse primer TTAACCATAGGAGCAGCTGAAAT Minus 23 756 734 57.88 39.13 6.00 3.00 Product length 108

Primer pair 3

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity 

Forward primer ACTGGTATATATTTCAGCTGCTCC Plus 24 724 747 58.20 41.67 8.00 1.00 Reverse primer CACACAGAGCACTGGACCAA Minus 20 1195 1176 60.18 55.00 6.00 3.00 Product length 472

Primer pair 4

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity 

Forward primer TGATGAAGCAGCATGGGACA Plus 20 312 331 59.67 50.00 4.00 1.00 Reverse primer TAACCATAGGAGCAGCTGAAATA Minus 23 755 733 57.11 39.13 6.00 2.00 Product length 444

Primer pair 5

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity 

Forward primer ATATATTTCAGCTGCTCCTATGGT Plus 24 730 753 57.37 37.50 6.00 0.00 Reverse primer AGGTAGTTGTCAATGCCCCC Minus 20 1431 1412 59.67 55.00 5.00 1.00 Product length 702


1.4Evolution


1.5Knowledge Extension


2.Labs working on this gene


3.References

[1]R. C.Chaudhary.Speciality rices of the world: Effect of WTO and IPR on its production trend and marketing.Participatory Rural Development Foundation, Shivpur – Shahbazganj, Gorakhpur (U. P.) 273014, India. e-mail:rchaudhary@vsnl.com


[2] INGER 1996. Standard Evaluation System for Rice, IRRI, Philippines, pp52.

[3]Chaudhary, R.C. and Tran, D.V. (Eds.) 2001. Speciality Rices of theWorld: Breeding Production and Marketing. FAO, Rome, Italy 358 pp.;

[4]Kumar, S., Shobha Rani, N., and Krishnaiah, K. 1996. In: Report of the INGER Monitoring Visit on Finegrain Aromatic Rice in India, Iran,

[5]Pakistan, and Thailand. IRRI. Philippines, 21- 44 pp. IRRI, Philippines.

[6]Yu, B.Y., Wang, J., and Gu, M.H. 1990. In: Advances in Genetic Research of Quality Characters in Cereals”. Jiangsu Sci., & Tech. Press Nanjing, China, 100-105 pp.)

[7]Chen,S., Yang,Y., Shi,W., Ji,Q., He,F., Zhang,Z., Cheng,Z., Liu,X.and Xu,M.Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. Plant Cell 20 (7), 1850-1861 (2008)

[8]Chen,S., Yang,Y., Shi,W. and Xu,M.Direct Submission.Submitted (29-MAY-2008) National Maize Improvement Center of China,China Agricultural University, 2 West Yuanmingyuan Road, Beijing100193, P.R. China


4.Structured Information


Nucleotide:

Truncated betaine aldehyde dehydrogenase [Oryza sativa Japonica Group].GenBank: ACF06150.[7],translates 251 amino acids It can be expressed in the following organisms: Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP clade; Ehrhartoideae; Oryzeae; Oryza.{7]

In Suyunuo cultivar rice,badh2 located at chromosome 8,the allel gene is the E7, its CDS permits accumulation of 2AP resulting in scented.

Protein : gi:192822639,gb:ACF06150.1, truncated betaine aldehyde dehydrogenase [Oryza sativa Japonica Group]

      1 mataipqrql fvagewrapa lgrrlpvvnp atespigeip agtaedvdaa vaaarealkr
      61 nrgrdwarap gavrakylra iaakiierks elarletldc gkpldeaawd mddvagcfey
     121 fadlaesldk rqnapvslpm enfkcylrke pigvvglitp wnypllmatw kvapalaagc
     181 tavlkpsela svtcleladv ckevglpsgv lnivtglgse agaplsshpg vdkvaftgsy
     241 etgiyfscsy g

//[1]