Gene Expression
Nebulas
Gene Expression NebulasSummary: Neurological complications are common in patients with COVID-19. While SARS-CoV-2, the causal pathogen of COVID-19, has been detected in some patient brains, its ability to infect brain cells and impact their function are not well understood, and experimental models using human brain cells are urgently needed. Here we investigated the susceptibility of human induced pluripotent stem cell (hiPSC)-derived monolayer brain cells and region-specific brain organoids to SARS-CoV-2 infection. We found modest numbers of infected neurons and astrocytes, but greater infection of choroid plexus epithelial cells. We optimized a protocol to generate choroid plexus organoids from hiPSCs, which revealed productive SARS-CoV-2 infection that leads to increased cell death and transcriptional dysregulation indicative of an inflammatory response and cellular function deficits. Together, our results provide evidence for SARS-CoV-2 neurotropism and support use of hiPSC-derived brain organoids as a platform to investigate the cellular susceptibility, disease mechanisms, and treatment strategies for SARS-CoV-2 infection.
Overall Design: Bulk RNA-seq of choroid plexus organoids (CPOs) was performed on mock 72 hours post-infection (hpi), SARS-CoV-2 24 hpi, and SARS-CoV-2 72 hpi samples. All conditions were profiled in triplicate.
| Strategy: |
|
| Species: |
|
| Tissue: |
|
| Healthy Condition: |
|
| Cell Type: |
|
| Growth Protocol: | - |
| Treatment Protocol: | - |
| Extract Protocol: | To minimize variability due to sampling and processing, each biological replicate consisted of 3 organoids and the replicates for all experimental conditions were processed in parallel for RNA-extraction, library preparation and sequencing. At the desired experimental endpoints, organoids were homogenized in TRIzol (Thermo Fisher Scientific) using a disposable pestle and handheld mortar and stored at -80 鈦癈 until processing. RNA clean-up was performed using the RNA Clean & Concentrator kit (Zymo Research) after TRIzol phase separation according to the manufacturer鈥檚 protocol. RNA concentration and quality were assessed using a Nanodrop 2000 (Thermo Fisher Scientific). |
| Library Construction Protocol: | Library preparation was performed as previously described with some minor modifications (Weng et al., 2017). About 300 ng of RNA in 3.2 L was combined with 0.25 L RNase inhibitor (NEB) and 1 L CDS primer (5 AAGCAGTGGTATCAACGCAGAGTACT30VN-3 in an 8-well PCR tube strip, heated to 70 C for 2 min, and immediately placed on ice. 5.55 L RT mix, containing 2 L of 5X SMARTScribe RT buffer (Takara), 0.5 L of 100 mM DTT (Millipore Sigma), 0.3 L of 200 mM MgCl2 (Thermo Fisher Scientific), 1 L of 10 mM dNTPs (Takara), 1 L of 10 M TSO primer (5 AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3 , 0.25 L of RNase inhibitor (NEB), and 0.5 L SMARTScribe reverse transcriptase (Takara) was added to the reaction. RT was performed under the following conditions: 42 C for 90 minutes, 10 cycles of 50 C for 2 minutes and 42 C for 2 minutes, 70 C for 15 minutes, and 4 C indefinitely. For cDNA amplification, 2 L of the RT reaction was combined with 2.5 L of 10X Advantage 2 buffer (Takara), 2.5 L of 2.5 mM dNTPs (Takara), 0.25 L of 10 M IS PCR primer (5 AAGCAGTGGTATCAACGCAGAGT-3 , 17.25 L nuclease free water (ThermoFisher), and 0.5 L Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows: 94 C for 3 minutes, 8 cycles of 94 C for 15 s, 65 C for 30 s, and 68 C for 6 minutes, 72 C for 10 minutes, and 4 C indefinitely. Amplified cDNA was purified using 0.8X AMPure XP beads (Beckman Coulter), eluted in 15 L nuclease-free water, and quantified using Qubit dsDNA HS assay kit (Thermo Fisher Scientific). cDNA was fragmented by combining 100 pg cDNA in 1 L nuclease free water, 2X TD buffer (20 mM Tris, pH 8.0; Thermo Fisher Scientific), 10 mM MgCl2, and 16% PEG 8000 (MilliporeSigma), and 0.5 L Tn5 (Lucigen). The mixture was heated to 55 C for 12 minutes, and the reaction was terminated upon the addition of 1.25 L of 0.2% SDS (Fisher) and incubated at room temperature for 10 minutes. Fragments were amplified by adding 16.75 L nuclease free water (Thermo Fisher Scientific), 1 L of 10 mM Nextera i7 primer, 1 L of 10 mM Nextera i5 primer, and 25 L KAPA HiFi hotstart readymix (EMSCO/FISHER). Thermocycling conditions were as follows: 72 C for 5 minutes, 95 C for 1 minute, 14 cycles of 95 C for 30 s, 55 C for 30 s, and 72 C for 30 s, 72 C for 1 minute, and 4 C indefinitely. DNA was purified twice with 0.8X AMPure XP beads (Beckman Coulter) and eluted in 10 L of 10 mM Tris, pH 8 (Thermo Fisher Scientific). Samples were quantified by qPCR (KAPA) and pooled at equal molar amounts. Final sequencing library fragment sizes were quantified by bioanalyzer (Agilent) with an average size of ~420 bp, and concentrations were determined by qPCR (KAPA). Samples were loaded at concentrations of 2.7 pM and sequenced on a NextSeq 550 (Illumina) using 1x72 bp reads to an average depth of 40 million reads per sample. |
| Molecule Type: | poly(A)+ RNA |
| Library Source: | |
| Library Layout: | SINGLE |
| Library Strand: | - |
| Platform: | ILLUMINA |
| Instrument Model: | Illumina NextSeq 550 |
| Strand-Specific: | Unspecific |
| Data Resource | GEN Sample ID | GEN Dataset ID | Project ID | BioProject ID | Sample ID | Sample Name | BioSample ID | Sample Accession | Experiment Accession | Release Date | Submission Date | Update Date | Species | Race | Ethnicity | Age | Age Unit | Gender | Source Name | Tissue | Cell Type | Cell Subtype | Cell Line | Disease | Disease State | Development Stage | Mutation | Phenotype | Case Detail | Control Detail | Growth Protocol | Treatment Protocol | Extract Protocol | Library Construction Protocol | Molecule Type | Library Layout | Strand-Specific | Library Strand | Spike-In | Strategy | Platform | Instrument Model | Cell Number | Reads Number | Gbases | AvgSpotLen1 | AvgSpotLen2 | Uniq Mapping Rate | Multiple Mapping Rate | Coverage Rate |
|---|