Search Result - Internal Control Genes Database (ICG)

Show entries

Search:

Species	Gene Name	Gene Model	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Tm (℃)	Detection	Application Scenario	Study
Acanthamoeba castellanii	HPRT	Hypoxanthine Phosphoribosyltransferase	XM_004337011	Forward: GGAGCGGATCGTTCTCTG Reverse: ATCTTGGCGTCGACGTGC	201	58.4	SYBR	Strain 1Bu Strain Spa08 Strain Str16 Strain Neff Oxidative Stress High Temperature Condition Low Temperature Condition	ICG10258-1
Acanthamoeba keratitis	HPRT	Hypoxanthine Phosphoribosyltransferase	XM_004337011	Forward: GGAGCGGATCGTTCTCTG Reverse: ATCTTGGCGTCGACGTGC	201	58.4	SYBR	Strain 1Bu Strain Spa08 Strain Str16 Strain Neff Oxidative Stress High Temperature Condition Low Temperature Condition	ICG10259-1
Equus caballus	HPRT	Hypoxanthine Phosphoribosyltransferase	AY372182	Forward: AATTATGGACAGGACTGAACGG Reverse: ATAATCCAGCAGGTCAGCAAAG	121	64	SYBR	Bal Cells Inflammatory Airway	ICG00145-1
Equus caballus	HPRT	Hypoxanthine Phosphoribosyltransferase	AY372182	Forward: AATTATGGACAGGACTGAACGG Reverse: ATAATCCAGCAGGTCAGCAAAG	121	58	SYBR	Peripheral Blood Mononuclear Cells (Pbmcs)	ICG00145-4
Felis catus	HPRT	Hypoxanthine Phosphoribosyltransferase	EF453697	Forward: ACTGTAATGACCAGTCAACAGGGG Reverse: TGTATCCAACACTTCGAGGAGTCC	210	60	SYBR	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	ICG00146-1

Showing 1 to 5 of 11 entries

Previous

Show entries

Search:

PMID	Year	Journal	Title
17904230	2007	Veterinary immunology and immunopathology	A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues.
18489742	2008	BMC molecular biology	Exercise induced stress in horses: selection of the most stable reference genes for quantitative RT-...
18505597	2008	BMC molecular biology	Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model.
19531214	2009	BMC molecular biology	Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of ce...
19650912	2009	BMC molecular biology	Reference gene selection for head and neck squamous cell carcinoma gene expression studies.

Showing 1 to 5 of 26 entries

Previous

1 2 3 4 5 6 Next