Search Result - Internal Control Genes Database (ICG)

Show entries

Search:

Species	Gene Name	Gene Model	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Tm (℃)	Detection	Application Scenario	Study
Bos grunniens	YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	XM_005887010.2	Forward: AATGTTGTAGGAGCCCGTAG Reverse: CTGCTTGTGAAGCGTTGG	190	-	SYBR	Mammary Gland	ICG10131-1
Canis lupus familiaris	YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	XM_532287	Forward: GTTACTTGGCCGAAGTTGCT Reverse: TGCTTGTTGTGACTGATCCAC	65	60	SYBR	Infrapatella Fat Pad Canine K6 Cell Line Canine Dh82 Cell Line	ICG00131-3
Felis catus	YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	EF458621	Forward: GAAGAGTCCTACAAAGACAGCACGC Reverse: AATTTTCCCCTCCTTCTCCTGC	115	65	SYBR	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	ICG00146-1
Gallus gallus	YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	NM 001031343.1	Forward: AGGAGCCGAGCTGTCCAATG Reverse: CTCCAAGATGACCTACGGGCTC	84	63	SYBR	Heart Lung Ph Disease	ICG00148-4
Gallus gallus	YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	-	Forward: TTGCTGCTGGAGATGACAAG Reverse: CTTCTTGATACGCCTGTTG	61	60	SYBR	Thigh Liver Breast	ICG00148-5

Showing 1 to 5 of 16 entries

Previous

Show entries

Search:

PMID	Year	Journal	Title
16984641	2006	BMC molecular biology	Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoal...
17484782	2007	BMC veterinary research	Expression stability of commonly used reference genes in canine articular connective tissues.
17904230	2007	Veterinary immunology and immunopathology	A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues.
18472253	2008	European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V	Validation of reference genes for qPCR studies on Caco-2 cell differentiation.
18505597	2008	BMC molecular biology	Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model.

Showing 1 to 5 of 57 entries

Previous

…