ICG00003 Ammopiptanthus mongolicus - Internal Control Genes Database (ICG)

Home Species

Ammopiptanthus mongolicus

Accession: ICG00003

Latin Name: Ammopiptanthus mongolicus

Common Name: Leguminosae

Taxonomy ID: 126911

Description: Ammopiptanthus mongolicus, the only evergreen broadleaf shrub endemic to the northwest desert of China, is the only genus of evergreen broadleaf shrub in the northwest desert of China and is dominant in the local vegetation. It plays important roles in fixing moving sands and delaying further desertification. It is a valuable species for plant abiotic stress research and has been proposed as a valuable species for research on plant abiotic stress tolerance.

ICG00003-1

Abiotic Stresses

Temperature Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
eIF1	Eukaryotic Initiation Factor	Drought Stress Salinity Stress Low Temperature Condition High Temperature Condition	JN885965	F: CTGACATGCGCCGTAGGAACG R: CCCTGCTTATGCCAGTCTTTT	153	60	SYBR
eIF3	Eukaryotic Initiation Factor	Drought Stress Salinity Stress Low Temperature Condition High Temperature Condition	JN885967	F: TTACATCGTCATCAAGGGTCG R: ACAATTATGGGAAGACGGCAC	153	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Jing Shi

Email: yinwl@bjfu.edu.cn

Institution: National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, College of Biological Sciences and Biotechnology, Beijing Forestry University Beijing 100083, China

Basic Information

Gene Summary