ICG00117 Anastrepha obliqua - Internal Control Genes Database (ICG)

Home Species

Anastrepha obliqua

Accession: ICG00117

Latin Name: Anastrepha obliqua

Common Name: West Indian fruit fly

Taxonomy ID: 95512

Description: Anastrepha obliqua, a kind of tephritid fruit flies, which is also an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. The genus Anastrepha has over 235 species, most of them are endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including Anastrepha obliqua. Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies.

ICG00117-1

Developmental Stages

Genders

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
rpL18	Ribosomal Protein L18	2Nd Larval Instar 3Rd Larval Instar Early Pupal Stage Later Pupal Stage Sexually Mature Virgin(Mvf) Post-Mating Male Female	NM_139834	F: GTGCCTAAGATGACCATTTGC R: GACCTCCAGCCTTAATGATACG	-	58	EvaGreen
rps17	Ribosomal Protein S17	2Nd Larval Instar 3Rd Larval Instar Early Pupal Stage Later Pupal Stage Sexually Mature Virgin(Mvf) Post-Mating Male Female	NM_079278.2	F: GCCGCAAAGGTCATAATTGAG R: GCTACTTCTTCACAAATACGCT	-	58	EvaGreen
ef1a	Elongation Factor	2Nd Larval Instar 3Rd Larval Instar Early Pupal Stage Later Pupal Stage Sexually Mature Virgin(Mvf) Post-Mating Male Female	GU339154.1	F: TTGCCTTCGTACCAATCTCTG R: AACCTTCCATCCCTTGAACC	-	59	EvaGreen

Molecular Types:

mRNA

Evaluation Methods

NormFinder

BestKeeper

Contact

Name: Reinaldo Alves de Brito

Email: brito@ufscar.br

Institution: Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil

Basic Information

Gene Summary