ICG00118 Anguilla anguilla - Internal Control Genes Database (ICG)

Home Species

Anguilla anguilla

Accession: ICG00118

Latin Name: Anguilla anguilla

Common Name: European eel

Taxonomy ID: 7936

Description: Anguilla anguilla is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady.

ICG00118-1

Abiotic Stresses

Seasons

Developmental Stages

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
L13	Ribosomal Protein L13	Silver Eels Spring Summer Autumn Winter Hepatocytes	eeel2_c1081	F: AAAGGAAGCGTATGGTGGTG R: CGGTCTTCTTCTTGCCGTAG	180	60	SYBR
ARP	Actin	Silver Eels Spring Summer Autumn Winter Hepatocytes	AY763793	F: GTGCCAGCTCAGAACACTG R: ACATCGCTCAAGACTTCAATGG	107	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Elena Fabbri

Email: silvia.franzellitti@unibo.it

Institution: University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy

Basic Information

Gene Summary