ICG00146 Felis catus - Internal Control Genes Database (ICG)

Home Species

Felis catus

Accession: ICG00146

Latin Name: Felis catus

Common Name: Domestic cat, Cat

Taxonomy ID: 9685

Description: Felis catus is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.

ICG00146-1

Tissues

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
RPL17	Ribosomal Protein L17	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	AY738264	F: CTCTGGTCATTGAGCACATCC R: TCAATGTGGCAGGGAGAGC	108	58	SYBR
RPL30	Ribosomal Protein L30	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	AY700577	F: CCTCGGCAGATAAATTGGACTGTC R: TGATGGCCCTCTGGAATTTGAC	111	64	SYBR
RPS7	Ribosomal Protein S7	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	AY800278	F: GTCCCAGAAGCCGCACTTTGAC R: CTCTTGCCCACAATCTCGCTCG	81	69	SYBR
YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	EF458621	F: GAAGAGTCCTACAAAGACAGCACGC R: AATTTTCCCCTCCTTCTCCTGC	115	65	SYBR
HPRT	Hypoxanthine Phosphoribosyltransferase	Dental Root Dental Crown Heart (Left Ventricle) Renal Liver Lung Mammary Gland Kidney Different Breed Male Female Different Ages	EF453697	F: ACTGTAATGACCAGTCAACAGGGG R: TGTATCCAACACTTCGAGGAGTCC	210	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

Contact

Name: Louis C. Penning

Email: L.C.Penning@uu.nl

Institution: Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands

Basic Information

Gene Summary

mRNA

Studies (1)

ICG00146-1

Internal Control Genes

Molecular Types:

Evaluation Methods

Contact

Reference

Research & Resources

Featured

Alliance & Collaboration

Conference & Outreach

About