ICG00202 Burkholderia pyrrocinia - Internal Control Genes Database (ICG)

Home Species

Burkholderia pyrrocinia

Accession: ICG00202

Latin Name: Burkholderia pyrrocinia

Common Name: -

Taxonomy ID: 60550

Description: Burkholderia pyrrocinia is the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia strain JK-SH007 isolated from poplar stems plays a highly significant role in the growth promotion and the biocontrol of poplar canker during colonization in poplar.

ICG00202-1

Abiotic Stresses

Temperature Conditions

Ph Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
pyrG	Pyruvate Kinase	Stem Low Ph Condition High Ph Condition High Temperature Condition Low Temperature Condition Salinity Stress Different Concentrations Of Saline	-	F: AGTCACCCTCCTCAAACTCG R: TCGTGAAGTTGTTGGCCTTG	1170	52	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Jian-Ren Ye

Email: jrye@njfu.edu.cn

Institution: College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China

Basic Information

Gene Summary