ICG00204 Francisella noatunensis - Internal Control Genes Database (ICG)

Home Species

Francisella noatunensis

Accession: ICG00204

Latin Name: Francisella noatunensis

Common Name: -

Taxonomy ID: 657445

Description: Francisella noatunensis, bacteria from the genus Francisella are characterised as strictly aerobic, facultatively intracellular, non-motile, Gram-negative cocco bacilli. Systemic infection caused by the Gram-negative bacterium remains a serious threat to Atlantic cod Gadhus morhua L. farming in Norway. Similar diseases associated with different strains of F. noatunensis have been reported in both fresh- and seawater farmed fish in Taiwan and Japan Chile, America, and Great Britain.

ICG00204-1

Culture Conditions

Growth Phases

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
fopA	Membrane Protein	Exponential Growth Phase Stationary Growth Phase Iron-Restricted Growth Condition	12952182	F: TACTGGTGCATGGGATGTTG R: TACTGGTGCATGGGATGTTG	100	60	SYBR
ftsZ	Cell Division Protein	Exponential Growth Phase Stationary Growth Phase Iron-Restricted Growth Condition	12952792	F: TACCATACTCAGCGGCTTTC R: GCGCCTGTAGTTGCTGAAGT	112	60	SYBR
polA	DNA Polymerase	Exponential Growth Phase Stationary Growth Phase Iron-Restricted Growth Condition	12951484	F: AGCTGGAACTGGTCGTAATCA R: ATCAGCATCTTCAGCAGCATA	82	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

Contact

Name: Samuel Duodu

Email: samuel.duodu@vetinst.no

Institution: Section for Microbiology, Immunology and Parasitology, Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, PO Box 8146 Dep, Oslo 0033, Norway

Basic Information

Gene Summary