ICG00153 Homo sapiens - Internal Control Genes Database (ICG)

Home Species Homo sapiens

Mesenchymal Stromal Cell Model

Species: Human

Category: Human Biological Model

Description: Mesenchymal stromal cells (also sometimes referred to as mesenchymal stem cells; MSCs) are multipotent cells that are being used to treat a variety of medical conditions. Over the past decade, there has been considerable excitement about using MSCs to treat various diseases, including some disease which are typically fatal and without other robust therapies. As MSCs have entered clinical trials for devastating neurodegenerative diseases, the excitement and interest in MSCs has become at times fevered.

ICG00153-4

Mesenchymal Stromal Model

Human Biological Model

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
TBP	TATA-binding Protein	Mesenchymal Stromal Cell Bone Marrow Adipose-Derived Stromal Cell	NM_003194	F: TGCACAGGAGCCAAGAGTGAA R: CACATCACAGCTCCCCACCA	-	60	SYBR
YWHAZ	Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta Polypeptide	Mesenchymal Stromal Cell Bone Marrow Adipose-Derived Stromal Cell	NM_001135702	F: ACTTTTGGTACATTGTGGCTTCAA R: CCGCCAGGACAAACCAGTAT	-	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Mandana Haack

Email: Mandana.Haack-Soerensen@regionh.dk

Institution: Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Basic Information

Gene Summary