ICG00167 Ovis aries - Internal Control Genes Database (ICG)

Home Species

Ovis aries

Accession: ICG00167

Latin Name: Ovis aries

Common Name: Sheep

Taxonomy ID: 9940

Description: Ovis aries is a member of the order Artiodactyla, the even-toed ungulates. It is a quadrupedal, ruminant mammal typically kept as livestock. Although the name "sheep" applies to many species in the genus Ovis, in everyday usage it almost always refers to Ovis aries. Domestic sheep are also the most numerous species of sheep. An adult female sheep is referred to as a ewe, an intact male as a ram or occasionally a tup, a castrated male as a wether, and a younger sheep as a lamb.

ICG00167-1

Tissues

Lung Research Model

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Lung Injury Preterm Lamb Model	NM_001190390	F: GGCCTCCAAGGAGTAAGGTC R: TCTCTTCCTCTCGTGCTCCT	60	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Prue M. Pereira-Fantini

Email: prue.pereira@mcri.edu.au

Institution: Neonatal Research Group, Murdoch Childrens Research Institute, Parkville, Australia.

Basic Information

Gene Summary