Difference between revisions of "Lnc-SCYL1-1:5"
Chunlei Yu (talk | contribs) |
|||
(3 intermediate revisions by 3 users not shown) | |||
Line 2: | Line 2: | ||
==Annotated Information== | ==Annotated Information== | ||
− | === | + | ===Name=== |
− | + | mascRNA: MALAT1-associated small cytoplasmic RNA | |
+ | |||
+ | ===Characteristics=== | ||
+ | mascRNA is a conserved, 61 nucleotide, tRNA-like sequence at the 3' end of Malat1 that is cleaved off the full length transcript and processed to generate a short tRNA-like ncRNA. | ||
+ | |||
+ | Mature mascRNA undergoes a post-transcriptional CCA addition and folds into a tRNA like structure but could not be amino acylated. | ||
===Function=== | ===Function=== | ||
Please input function information here. | Please input function information here. | ||
+ | |||
+ | ===Expression=== | ||
+ | mascRNA was cleaved off Malat1 in a wide variety of human tissues. | ||
+ | |||
+ | mascRNA is cleaved off Malat1 by RNaseP in the nucleus before further processing by RNaseZ and then exported to the cytoplasm. | ||
+ | |||
+ | ===Conservation=== | ||
+ | Conserved in mammals and back to reptiles and amphibians. More highly conserved than most of Malat1. | ||
+ | |||
+ | ===Misc=== | ||
+ | Please input misc information here. | ||
+ | |||
+ | ===Transcriptomic Nomeclature=== | ||
+ | Please input transcriptomic nomeclature information here. | ||
===Regulation=== | ===Regulation=== | ||
Please input regulation information here. | Please input regulation information here. | ||
− | |||
− | |||
− | |||
===Allelic Information and Variation=== | ===Allelic Information and Variation=== | ||
Line 26: | Line 42: | ||
==References== | ==References== | ||
− | + | [http://www.lncrnadb.org/mascRNA/ Annotation originally sourced from lncRNAdb.] | |
{{basic| | {{basic| | ||
Line 42: | Line 58: | ||
sequence = <dnaseq>GATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGTCTCCA</dnaseq>| | sequence = <dnaseq>GATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGTCTCCA</dnaseq>| | ||
}} | }} | ||
− | [[Category:Intergenic]] | + | [[Category:Intergenic]][[Category:lnc-SCYL1-1]][[Category:Transcripts]] |
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− |
Latest revision as of 03:23, 26 August 2015
Please input one-sentence summary here.
Contents
Annotated Information
Name
mascRNA: MALAT1-associated small cytoplasmic RNA
Characteristics
mascRNA is a conserved, 61 nucleotide, tRNA-like sequence at the 3' end of Malat1 that is cleaved off the full length transcript and processed to generate a short tRNA-like ncRNA.
Mature mascRNA undergoes a post-transcriptional CCA addition and folds into a tRNA like structure but could not be amino acylated.
Function
Please input function information here.
Expression
mascRNA was cleaved off Malat1 in a wide variety of human tissues.
mascRNA is cleaved off Malat1 by RNaseP in the nucleus before further processing by RNaseZ and then exported to the cytoplasm.
Conservation
Conserved in mammals and back to reptiles and amphibians. More highly conserved than most of Malat1.
Misc
Please input misc information here.
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Regulation
Please input regulation information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Annotation originally sourced from lncRNAdb.
Basic Information
Transcript ID |
lnc-SCYL1-1:5 |
Source |
LNCipedia2.1 |
Same with |
, |
Classification |
intergenic |
Length |
61 nt |
Genomic location |
chr11+:65273587..65273645 |
Exon number |
1 |
Exons |
65273587..65273645 |
Genome context |
|
Sequence |
000001 GATGCTGGTG GTTGGCACTC CTGGTTTCCA GGACGGGGTT CAAATCCCTG CGGCGTCTCC A
|