Difference between revisions of "LUNAR1"
| Line 9: | Line 9: | ||
===Characteristics=== | ===Characteristics=== | ||
| − | LUNAR1 is a 491-nucleotide transcript, containing 4 exons and a poly(A) tail. | + | LUNAR1 is a 491-nucleotide transcript, containing 4 exons and a poly(A) tail <ref name="ref1" />. |
| − | LUNAR1 is localized in the nucleus, to a degree similar to that of U1 <ref name="ref1" />. | + | |
| + | ===Cellular Localization=== | ||
| + | LUNAR1 is localized in the nucleus, to a degree similar to that of U1 <ref name="ref1" />. | ||
===Function=== | ===Function=== | ||
| Line 18: | Line 20: | ||
===Regulation=== | ===Regulation=== | ||
LUNAR1 is directly controlled by the Notch1/Rpbjk activator complex. There is a highly active enhancer in the last intron of neighboring gene ''IGF1R''. This intronic enhancer, which is occupied by NOTCH1, Mediator subunit MED1, histone acetyltransferase P300, RNAPolII and the histone reader BRD4, activates the transcription of LUNAR1 <ref name="ref1" />. | LUNAR1 is directly controlled by the Notch1/Rpbjk activator complex. There is a highly active enhancer in the last intron of neighboring gene ''IGF1R''. This intronic enhancer, which is occupied by NOTCH1, Mediator subunit MED1, histone acetyltransferase P300, RNAPolII and the histone reader BRD4, activates the transcription of LUNAR1 <ref name="ref1" />. | ||
| + | |||
| + | ===Diseases=== | ||
| + | *human T cell acute lymphoblastic leukemia (T-ALL)<ref name="ref1" /> | ||
===Expression=== | ===Expression=== | ||
Revision as of 03:56, 7 August 2014
LUNAR1, a Notch-regulated lncRNA, functions to enhance IGF1R (insulin-like growth factor receptor 1) mRNA expression and is essential for human T cell acute lymphoblastic leukemia (T-ALL) maintenance.
Contents
Annotated Information
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Name
LUNAR1: leukemia-induced noncoding activator RNA [1]
Characteristics
LUNAR1 is a 491-nucleotide transcript, containing 4 exons and a poly(A) tail [1].
Cellular Localization
LUNAR1 is localized in the nucleus, to a degree similar to that of U1 [1].
Function
LUNAR1 functions as an enhancer in human T cell acute lymphoblastic leukemia (T-ALL). It is required for efficient T-ALL growth in vitro and in vivo due to its ability to enhance IGF1R mRNA expression and sustain IGF1 signaling [1]. The specific enrichment of LUNAR1 at the IGF1R enhancer and LUNAR1 promoter has been observed. LUNAR1 RNA co-occupies this enhancer and recruits RNAP2 and Mediator to sustain full activation of IGF1R promoter [1].
Regulation
LUNAR1 is directly controlled by the Notch1/Rpbjk activator complex. There is a highly active enhancer in the last intron of neighboring gene IGF1R. This intronic enhancer, which is occupied by NOTCH1, Mediator subunit MED1, histone acetyltransferase P300, RNAPolII and the histone reader BRD4, activates the transcription of LUNAR1 [1].
Diseases
- human T cell acute lymphoblastic leukemia (T-ALL)[1]
Expression
LUNAR1 is overexpressed in primary T-ALL and expressed significantly higher in T-ALL samples that harbored a Notch mutation compared to those without mutations [1]. Although the LUNAR1 locus shows signs of promoter activity in diverse tissues, its expression is highly restricted [1].
| Primer | Forward primer | Reverse primer |
|---|---|---|
| RT-PCR | 5'-GGAGGCTGAGGCCGCCTGTT-3' | 5'-AGGCTGCAGGGGAACAGGTCTT-3'[1] |
Sequence
>LUNAR1 hg19 chr15:99,557,680-99,585,143 AGGAATGGGAGAGGGAGGAGGACGCCAGGGGCACAGGGACAGCCTCCGGGGCGGGGCGCGGCGCCAGCCTAGCCCGAGGATGGAGGCTGAGGCCGCCTGTTGAGTCACAGT TTCCCTGTGATGCTCATTTTAACCAGATGGCACTTGCTTAGCAGTTTGGAGGAGAAGACCTGTTCCCCTGCAGCCTTCCATGATTAGACCTCAACTCATGAGAACTCTTGCCTTGCTC ACAAGTGGGAGTAAATGCTCATAGCTCTAGAAATCTCCCAGGAACCAGACATCACGGAAACTAGAAAGGCTAAGGGAGTCCAATCTTCCTCTAAATTGGCCAACAGTAGAGTGGTGG AAAGAGAACAAGCTGCAAACCAGACAGACCCAAGCTTGAATCTCACCTCTGCCAAGCTACCAGAGCTCAACAAACTACAGACCACGGGCCAAATCTGACCCACCGCTGCTTTTGTAA ATAAAACTTTATTGGAAAAAAAAAAAAA
Labs working on this lncRNA
- Howard Hughes Medical Institute, Laura and Isaac Perlmutter Cancer Center, and Helen L. and Martin S. Kimmel Center for Stem Cell Biology
