Difference between revisions of "LUNAR1"

From LncRNAWiki
Jump to: navigation, search
(Annotated Information)
(Annotated Information)
Line 2: Line 2:
  
 
==Annotated Information==
 
==Annotated Information==
 +
===Transcriptomic Nomeclature===
 +
N15QT0788001-APGP-LHXXX01 [[Help:Contents#Database content|'''''Help''''']]
 +
 
===Name===
 
===Name===
 
LUNAR1: leukemia-induced noncoding activator RNA <ref name="ref1" />
 
LUNAR1: leukemia-induced noncoding activator RNA <ref name="ref1" />

Revision as of 07:31, 7 August 2014

LUNAR1, a Notch-regulated lncRNA, functions to enhance IGF1R (insulin-like growth factor receptor 1) mRNA expression and is essential for human T cell acute lymphoblastic leukemia (T-ALL) maintenance.

Annotated Information

Transcriptomic Nomeclature

N15QT0788001-APGP-LHXXX01 Help

Name

LUNAR1: leukemia-induced noncoding activator RNA [1]

Characteristics

LUNAR1 is a 491-nucleotide transcript, containing 4 exons and a poly(A) tail [1].

Cellular Localization

LUNAR1 is localized in the nucleus, to a degree similar to that of U1 [1].

Function

A model for cis-regulation of IGF1R expression by LUNAR1 [1].

LUNAR1 functions as an enhancer in human T cell acute lymphoblastic leukemia (T-ALL). It is required for efficient T-ALL growth in vitro and in vivo due to its ability to enhance IGF1R mRNA expression and sustain IGF1 signaling [1]. The specific enrichment of LUNAR1 at the IGF1R enhancer and LUNAR1 promoter has been observed. LUNAR1 RNA co-occupies this enhancer and recruits RNAP2 and Mediator to sustain full activation of IGF1R promoter [1].

Regulation

LUNAR1 is directly controlled by the Notch1/Rpbjk activator complex. There is a highly active enhancer in the last intron of neighboring gene IGF1R. This intronic enhancer, which is occupied by NOTCH1, Mediator subunit MED1, histone acetyltransferase P300, RNAPolII and the histone reader BRD4, activates the transcription of LUNAR1 [1].

Diseases

  • human T cell acute lymphoblastic leukemia (T-ALL)[1]

Expression

LUNAR1 is overexpressed in primary T-ALL and expressed significantly higher in T-ALL samples that harbored a Notch mutation compared to those without mutations [1]. Although the LUNAR1 locus shows signs of promoter activity in diverse tissues, its expression is highly restricted [1].

Primer Forward primer Reverse primer
RT-PCR 5'-GGAGGCTGAGGCCGCCTGTT-3' 5'-AGGCTGCAGGGGAACAGGTCTT-3'[1]

Sequence

>LUNAR1 hg19 chr15:99,557,680-99,585,143 AGGAATGGGAGAGGGAGGAGGACGCCAGGGGCACAGGGACAGCCTCCGGGGCGGGGCGCGGCGCCAGCCTAGCCCGAGGATGGAGGCTGAGGCCGCCTGTTGAGTCACAGT TTCCCTGTGATGCTCATTTTAACCAGATGGCACTTGCTTAGCAGTTTGGAGGAGAAGACCTGTTCCCCTGCAGCCTTCCATGATTAGACCTCAACTCATGAGAACTCTTGCCTTGCTC ACAAGTGGGAGTAAATGCTCATAGCTCTAGAAATCTCCCAGGAACCAGACATCACGGAAACTAGAAAGGCTAAGGGAGTCCAATCTTCCTCTAAATTGGCCAACAGTAGAGTGGTGG AAAGAGAACAAGCTGCAAACCAGACAGACCCAAGCTTGAATCTCACCTCTGCCAAGCTACCAGAGCTCAACAAACTACAGACCACGGGCCAAATCTGACCCACCGCTGCTTTTGTAA ATAAAACTTTATTGGAAAAAAAAAAAAA

Labs working on this lncRNA

  • Howard Hughes Medical Institute, Laura and Isaac Perlmutter Cancer Center, and Helen L. and Martin S. Kimmel Center for Stem Cell Biology

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Trimarchi, T., Bilal, E., Ntziachristos, P., Fabbri, G., Dalla-Favera, R., Tsirigos, A. and Aifantis, I. (2014) Genome-wide Mapping and Characterization of Notch-Regulated Long Noncoding RNAs in Acute Leukemia. Cell, 158, 593-606.