Difference between revisions of "Os12g0101600"

From RiceWiki
Jump to: navigation, search
(Structured Information)
Line 16: Line 16:
 
===Mutation===
 
===Mutation===
 
narrow leaf2 narrow leaf3(nal2 nal3; hereafternal2/3) double mutant, which produces narrow-curly leaves, more tillers, fewer lateral roots, opened spikelets and narrow-thin grains.Thenal2 nal3(nal2/3) double recessive mutant ofOryza sativaL.japonica rice was previously obtained from Kyushu University,Japan, and has been maintained by the Rural Development Administration, Korea. Thenal2/3mutant was backcrossed twice with a Japanesejaponicarice cv ‘Kinmaze’ and progressed for several generations. Kinmaze was used as the parental wild-type plant in this study. The growth chamber conditions were 12-h light (500lmol m2 s1)at30°C and 12-h dark at 20°C.
 
narrow leaf2 narrow leaf3(nal2 nal3; hereafternal2/3) double mutant, which produces narrow-curly leaves, more tillers, fewer lateral roots, opened spikelets and narrow-thin grains.Thenal2 nal3(nal2/3) double recessive mutant ofOryza sativaL.japonica rice was previously obtained from Kyushu University,Japan, and has been maintained by the Rural Development Administration, Korea. Thenal2/3mutant was backcrossed twice with a Japanesejaponicarice cv ‘Kinmaze’ and progressed for several generations. Kinmaze was used as the parental wild-type plant in this study. The growth chamber conditions were 12-h light (500lmol m2 s1)at30°C and 12-h dark at 20°C.
 
==Structured Information==
 
{{JaponicaGene|
 
GeneName = Os12g0101600|
 
Description = |
 
Version =  |
 
Length = 612 bp |
 
Source = Oryza sativa Japonica Group (Japanese rice) |
 
  ORGANISM = Oryza sativa Japonica Group
 
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
 
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
 
            clade; Ehrhartoideae; Oryzeae; Oryza. |
 
 
Chromosome = [[:category:Japonica Chromosome 12|Chromosome 12]]|
 
 
CDNA =
 
<cdnaseq>1..612#
 
ATGCCTCAGACCCCTTCGACGCGGTGGTGCCCGACGCCGGAGCAGCTGATGATCCTGGAG
 
GAGATGTACAGGAGCGGCGTGCGAACGCCCAACGCGGCAGAGATCCAGCAAATCACGGCG
 
CACCTCGCCTACTACGGCCGCATCGAGGGCAAGAACGTCTTCTACTGGTTCCAGAACCAC
 
AAGGCCCGCGAGCGCCAGCGCCTCCGCCGCCGCCTCTGCGCGCGGCACCAGCAGCAACCC
 
TCACCGCCCTCCTCCACGGTGCCTCCGGCTCCCACTGCTGCTGCTGCCGGTGCCGTCGTG
 
CAGGTGCACCCCGCGGTGATGCAGCTACACCACCACCACCACCACCATCACCCATACGCT
 
GCGGCCGCCGCTGCCCAAAGTCATCACCTGCAGCAGCAGCAGCAGCAGCAAGCTGAGTGG
 
CCGGCGGCGGTGGACTACTGCAGCACTGCATCGGCGTCAGCGTCGGCAACTGCTGCTGAC
 
ATGGCGATCCCGCCGTGCTGCCGGCCGCTGAAAACGTTGGAGCTGTTCCCGACCAAGAGC
 
ACCAGCGGCGGCCTCAAGGAAGATTGCTGCAGCAGCTCCAAGTCCTCCTCTTGCTCCACC
 
TCCACCAATTAA</cdnaseq> |
 
 
AA = <aaseq>MPQTPSTRWCPTPEQLMILEEMYRSGVRTPNAAEIQQITAHLAYYGRIEGKNVFYWFQNH
 
KARERQRLRRRLCARHQQQPSPPSSTVPPAPTAAAAGAVVQVHPAVMQLHHHHHHHHPYA
 
AAAAAQSHHLQQQQQQQAEWPAAVDYCSTASASASATAADMAIPPCCRPLKTLELFPTKS
 
TSGGLKEDCCSSSKSSSCSTSTN</aaseq>|
 
Link = |
 
}}
 

Revision as of 09:41, 30 May 2014

Annotated Information

Function

Map-based cloning revealed thatNAL2andNAL3are paralogs that encode an identical OsWOX3A (OsNS) transcriptional activator, homologous to NARROW SHEATH1 (NS1) and NS2 in maize and PRESSED FLOWER in Arabidopsis.OsWOX3Ais expressed in the vascular tissues of various organs, wherenal2/3mutant phenotypes were displayed. Expression levels of several leaf development-associated genes were altered innal2/3, and auxin transportrelated genes were significantly changed, leading topinmutant-like phenotypes such as more tillers and fewer lateral roots.OsWOX3Ais involved in organ development in rice, lateral-axis outgrowth and vascular patterning in leaves, lemma and palea morphogenesis in spikelets, and development of tillers and lateral roots. Please input function information here.

Expression

The ricenarrow leaf2andnarrow leaf3loci encode WUSCHELrelated homeobox 3A (OsWOX3A) and function in leaf, spikelet,tiller and lateral root development.nal2/3 mutation negatively affects both vegetative and reproductive organ development with a severe loss of grain yield. Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) athere

Mutation

narrow leaf2 narrow leaf3(nal2 nal3; hereafternal2/3) double mutant, which produces narrow-curly leaves, more tillers, fewer lateral roots, opened spikelets and narrow-thin grains.Thenal2 nal3(nal2/3) double recessive mutant ofOryza sativaL.japonica rice was previously obtained from Kyushu University,Japan, and has been maintained by the Rural Development Administration, Korea. Thenal2/3mutant was backcrossed twice with a Japanesejaponicarice cv ‘Kinmaze’ and progressed for several generations. Kinmaze was used as the parental wild-type plant in this study. The growth chamber conditions were 12-h light (500lmol m2 s1)at30°C and 12-h dark at 20°C.