Basic information
GenBank ID	HP625676
Organism	Wheat (Triticum aestivum)
Taxonomic identifier	[NCBI]
Function category	Others
Effect for Senescence	Unclear
Gene Description	Significantly higher transcript level (> 1.5 fold) is found in the WT relative to the GPC-RNAi samples (up-regulated during senescence).
Evidence	Genomic evidence:microarray data [Ref 1]
References	1: Cantu D, Pearce SP, Distelfeld A, Christiansen MW, Uauy C, Akhunov E, Fahima T, Dubcovsky J Effect of the down-regulation of the high Grain Protein Content (GPC) genes on the wheat transcriptome during monocarpic senescence. BMC Genomics 2011;12:492
Sequence	HP625676.1 | mRNA
miRNA Interaction
Details	target: HP625676.1  miRNA: tae-miR1135 miRNA: tae-miR1135 mfe: -47.0 kcal/mol  p-value: 0.000000  position: 114  target 5' C                        A  3'             UCCGUUCGGAAUUACUUGUCGUAG                 AGGCAAGCCUUAAUGAACAGCGUC      miRNA  3'                             5'