Targets of Sen-AtlncRNAs
| LncRNA | Locus name | Chromosome | Target RNA | Biotype | Target chromosome | Senescence association | Energe | LncRNA binding site start | LncRNA binding site end | Target binding_site start | Target binding site end | Annotation |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT1G72070.1 | protein_coding | 1:27118621-27119918 | unclear | -230.426 | 114 | 397 | 294 | 11 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); Chaperone DnaJ-domain superfamily protein (TAIR:AT1G80920.1); Has 16707 Blast hits to 16707 proteins in 3064 species: Archae - 133; Bacteria - 8112; Metazoa - 2533; Fungi - 1008; Plants - 1312; Viruses - 5; Other Eukaryotes - 3604 (source: NCBI BLink). |
| XLOC_007880 | AT1G09553.1 | Ch1:28314311-28314700 | AT1G75450.1 | protein_coding | 1:28314458-28318375 | Unclear | -178.536 | 147 | 389 | 2710 | 2468 | cytokinin oxidase 5This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. cytokinin oxidase 5 (CKX5);CONTAINS InterPro DOMAIN/s: Cytokinin dehydrogenase 1, FAD/cytokinin binding domain (InterPro:IPR015345), FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094); cytokinin oxidase/dehydrogenase 1 (TAIR:AT2G41510.1); Has 6615 Blast hits to 6610 proteins in 1194 species: Archae - 154; Bacteria - 4290; Metazoa - 145; Fungi - 1218; Plants - 369; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G22400.1 | protein_coding | 1:7903660-7906969 | unclear | -93.7588 | 240 | 389 | 1438 | 1289 | UDP-Glycosyltransferase superfamily protein UGT85A1;FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyl transferase 85A3 (TAIR:AT1G22380.1); Has 7940 Blast hits to 7832 proteins in 421 species: Archae - 0; Bacteria - 227; Metazoa - 2330; Fungi - 36; Plants - 5216; Viruses - 60; Other Eukaryotes - 71 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G64750.3 | protein_coding | 1:24052362-24053923 | unclear | -79.4426 | 382 | 477 | 878 | 783 | deletion of SUV3 suppressor 1(I) deletion of SUV3 suppressor 1(I) (DSS1(I));FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); DSS1 homolog on chromosome V (TAIR:AT5G45010.1). |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT1G55270.1 | protein_coding | 1:20617954-20620146 | unclear | -78.4918 | 0 | 91 | 1698 | 1607 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT1G67480.2); Has 9614 Blast hits to 5501 proteins in 487 species: Archae - 10; Bacteria - 408; Metazoa - 7370; Fungi - 10; Plants - 1320; Viruses - 170; Other Eukaryotes - 326 (source: NCBI BLink). |
| XLOC_014043 | AT3G03105.1 | Ch3:5181021-5181298 | AT3G15353.1 | protein_coding | 3:5180642-5181586 | unclear | -42.2322 | 0 | 46 | 171 | 125 | metallothionein 3 metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage metallothionein 3 (MT3); Has 268 Blast hits to 268 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G15920.2 | protein_coding | 1:5469255-5471149 | unclear | -37.8427 | 589 | 665 | 236 | 166 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein Polynucleotidyl transferase, ribonuclease H-like superfamily protein;FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, ribonuclease H fold (InterPro:IPR012337); Polynucleotidyl transferase, ribonuclease H-like superfamily protein (TAIR:AT2G32070.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G56350.1 | protein_coding | 5:22819936-22822904 | unclear | -33.3169 | 3649 | 3725 | 203 | 126 | Pyruvate kinase family proteinPyruvate kinase family protein;FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); Pyruvate kinase family protein (TAIR:AT4G26390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G21000.1 | protein_coding | 1:7337605-7339452 | unclear | -32.4271 | 633 | 681 | 90 | 44 | PLATZ transcription factor family proteinPLATZ transcription factor family protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF597 (InterPro:IPR006734); PLATZ transcription factor family protein (TAIR:AT1G76590.1); Has 403 Blast hits to 403 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 403; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G26740.1 | protein_coding | 3:9827682-9828917 | Unclear | -32.2294 | 589 | 677 | 178 | 97 | CCR-like transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. CCR-like (CCL);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Light regulated Lir1 (InterPro:IPR009856); Has 69 Blast hits to 69 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G54250.1 | protein_coding | 5:22025035-22030099 | Unclear | -31.645 | 53 | 99 | 246 | 185 | cyclic nucleotide-gated cation channel 4 member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent.cyclic nucleotide-gated cation channel 4 (CNGC4);CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), RmlC-like jelly roll fold (InterPro:IPR014710); Cyclic nucleotide-regulated ion channel family protein (TAIR:AT5G15410.2); Has 13099 Blast hits to 4876 proteins in 392 species: Archae - 0; Bacteria - 175; Metazoa - 8070; Fungi - 607; Plants - 1352; Viruses - 290; Other Eukaryotes - 2605 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G65730.1 | protein_coding | 1:24442388-24446291 | unclear | -31.2081 | 3358 | 3414 | 115 | 59 | YELLOW STRIPE like 7 Arabidopsis thaliana metal-nicotianamine transporter YSL4 YELLOW STRIPE like 7 (YSL7);FUNCTIONS IN: oligopeptide transporter activity; INVOLVED IN: oligopeptide transport, transmembrane transport; LOCATED IN: plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Oligopeptide transporter OPT superfamily (InterPro:IPR004813); YELLOW STRIPE like 5 (TAIR:AT3G17650.1); Has 1836 Blast hits to 1794 proteins in 556 species: Archae - 19; Bacteria - 893; Metazoa - 0; Fungi - 266; Plants - 510; Viruses - 1; Other Eukaryotes - 147 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G30810.1 | protein_coding | 1:10936765-10942292 | unclear | -30.6943 | 682 | 770 | 3918 | 3852 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family proteinJMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), Transcription factor jumonji (InterPro:IPR013129), FY-rich, C-terminal subgroup (InterPro:IPR018516), FY-rich, N-terminal subgroup (InterPro:IPR018518); Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein (TAIR:AT2G34880.1); Has 2138 Blast hits to 1613 proteins in 188 species: Archae - 0; Bacteria - 2; Metazoa - 1141; Fungi - 449; Plants - 371; Viruses - 0; Other Eukaryotes - 175 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT2G02090.1 | protein_coding | 2:523223-527068 | unclear | -28.7219 | 788 | 859 | 662 | 568 | SNF2 domain-containing protein / helicase domain-containing protein ETL1;FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); chromatin remodeling 5 (TAIR:AT2G13370.1); Has 19948 Blast hits to 16374 proteins in 2059 species: Archae - 127; Bacteria - 6550; Metazoa - 3755; Fungi - 4012; Plants - 1782; Viruses - 219; Other Eukaryotes - 3503 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G49525.1 | protein_coding | 5:20096932-20097551 | unclear | -28.2121 | 220 | 259 | 105 | 64 | unknown protein; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G02230.1 | protein_coding | 5:448092-450737 | unclear | -28.1201 | 3628 | 3709 | 90 | 19 | Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinHaloacid dehalogenase-like hydrolase (HAD) superfamily protein;FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Pyrimidine 5-nucleotidase (InterPro:IPR010237), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT5G59480.1); Has 2249 Blast hits to 2246 proteins in 493 species: Archae - 16; Bacteria - 743; Metazoa - 0; Fungi - 143; Plants - 201; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G51880.2 | protein_coding | 3:19246936-19249200 | unclear | -27.5088 | 236 | 290 | 704 | 652 | high mobility group B1 Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.high mobility group B1 (HMGB1);FUNCTIONS IN: chromatin binding, structural constituent of chromatin, DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: chromatin assembly or disassembly; LOCATED IN: cytosol, chromatin, nuclear chromatin, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); high mobility group B3 (TAIR:AT1G20696.3); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G52105.1 | protein_coding | 3:19323158-19323827 | unclear | -27.3224 | 615 | 676 | 300 | 233 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G03470.1 | protein_coding | 3:824552-826585 | unclear | -27.2839 | 238 | 282 | 1167 | 1115 | cytochrome P450, family 87, subfamily A, polypeptide 9 member of CYP89A "cytochrome P450, family 87, subfamily A, polypeptide 9" (CYP89A9);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 87, subfamily A, polypeptide 6 (TAIR:AT1G64940.1); Has 30488 Blast hits to 30273 proteins in 1588 species: Archae - 47; Bacteria - 2858; Metazoa - 11557; Fungi - 5907; Plants - 9145; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G15040.1 | protein_coding | 3:5064704-5066745 | unclear | -27.2552 | 593 | 681 | 544 | 473 | Protein ofunknown function, DUF584 Protein ofunknown function, DUF584;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF584 (InterPro:IPR007608); Protein ofunknown function, DUF584 (TAIR:AT4G21970.1); Has 2569 Blast hits to 543 proteins in 84 species: Archae - 0; Bacteria - 28; Metazoa - 187; Fungi - 69; Plants - 343; Viruses - 0; Other Eukaryotes - 1942 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G03110.1 | protein_coding | 5:730127-731462 | unclear | -27.0448 | 1862 | 1901 | 42 | 0 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; protamine P1 family protein (TAIR:AT2G37100.1); Has 81 Blast hits to 73 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005049 | AT1G15175.2 | Ch1:5222729-5224055 | AT2G26300.1 | protein_coding | 2:11196996-11201102 | unclear | -26.0059 | 30 | 80 | 151 | 94 | G protein alpha subunit 1 Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. G protein alpha subunit 1 (GP ALPHA 1);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: in 16 processes; LOCATED IN: plasma membrane, endoplasmic reticulum membrane, heterotrimeric G-protein complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Plant G-protein, alpha subunit (InterPro:IPR002976), Guanine nucleotide binding protein (G-protein), alpha subunit (InterPro:IPR001019), G protein alpha subunit, helical insertion (InterPro:IPR011025); extra-large GTP-binding protein 3 (TAIR:AT1G31930.3); Has 3745 Blast hits to 3647 proteins in 408 species: Archae - 0; Bacteria - 0; Metazoa - 2360; Fungi - 766; Plants - 268; Viruses - 0; Other Eukaryotes - 351 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G32130.1 | protein_coding | 1:11558755-11561920 | unclear | -25.9611 | 47 | 92 | 479 | 422 | Transcription elongation factor (TFIIS) family protein The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. IWS1;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: brassinosteroid mediated signaling pathway, regulation of RNA elongation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor IIS, N-terminal (InterPro:IPR017923); Transcription elongation factor (TFIIS) family protein (TAIR:AT4G19000.1); Has 1384 Blast hits to 1350 proteins in 337 species: Archae - 10; Bacteria - 21; Metazoa - 458; Fungi - 242; Plants - 332; Viruses - 8; Other Eukaryotes - 313 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.2 | Ch1:9726607-9730185 | AT1G01490.1 | protein_coding | 1:180017-182749 | unclear | -25.5941 | 2591 | 2659 | 217 | 136 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT1G63950.1); Has 7083 Blast hits to 3987 proteins in 399 species: Archae - 47; Bacteria - 875; Metazoa - 1731; Fungi - 337; Plants - 1157; Viruses - 96; Other Eukaryotes - 2840 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G47750.1 | protein_coding | 1:17569256-17570249 | unclear | -24.9986 | 236 | 284 | 619 | 572 | peroxin 11Amember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. peroxin 11A (PEX11A);CONTAINS InterPro DOMAIN/s: Peroxisomal biogenesis factor 11 (InterPro:IPR008733); peroxin 11B (TAIR:AT3G47430.1); Has 271 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 15; Plants - 188; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G33980.2 | protein_coding | 4:16282281-16285229 | unclear | -24.9528 | 48 | 96 | 701 | 650 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to karrikin; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; cold regulated gene 27 (TAIR:AT5G42900.3). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G46390.1 | protein_coding | 2:19042301-19043234 | unclear | -24.607 | 233 | 266 | 42 | 8 | predicted to encode subunit 8 of mitochondrial complex II and to participate in the respiratory chain unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT3G17790.1 | protein_coding | 3:6089381-6091231 | Unclear | -24.4331 | 2298 | 2359 | 78 | 1 | purple acid phosphatase 17 Expression is upregulated in the shoot of cax1/cax3 mutant.purple acid phosphatase 17 (PAP17);CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); purple acid phosphatase 3 (TAIR:AT1G14700.1); Has 1229 Blast hits to 1218 proteins in 312 species: Archae - 4; Bacteria - 345; Metazoa - 336; Fungi - 8; Plants - 191; Viruses - 0; Other Eukaryotes - 345 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G09910.1 | protein_coding | 1:3220035-3224541 | unclear | -24.1662 | 2760 | 2805 | 65 | 23 | Rhamnogalacturonate lyase family protein Rhamnogalacturonate lyase family protein;FUNCTIONS IN: lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Rhamnogalacturonate lyase (InterPro:IPR010325), Carbohydrate-binding-like fold (InterPro:IPR013784), Galactose-binding domain-like (InterPro:IPR008979); Rhamnogalacturonate lyase family protein (TAIR:AT1G09890.1); Has 300 Blast hits to 279 proteins in 59 species: Archae - 0; Bacteria - 45; Metazoa - 0; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G22780.1 | protein_coding | 4:11968272-11971357 | unclear | -23.9935 | 1862 | 1904 | 38 | 3 | ACT domain repeat 7Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . ACT domain repeat 7 (ACR7);FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); ACT domain repeat 8 (TAIR:AT1G12420.1); Has 2549 Blast hits to 1855 proteins in 571 species: Archae - 0; Bacteria - 1517; Metazoa - 0; Fungi - 0; Plants - 619; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G24470.3 | protein_coding | 4:12645542-12647985 | unclear | -23.8973 | 3643 | 3709 | 141 | 62 | GATA-type zinc finger protein with TIFY domain ZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif. TIFY1;CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Tify (InterPro:IPR010399), CCT domain (InterPro:IPR010402), Zinc finger, GATA-type (InterPro:IPR000679); ZIM-LIKE 2 (TAIR:AT1G51600.2). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G48780.1 | protein_coding | 3:18089020-18093252 | unclear | -23.8926 | 1965 | 2007 | 280 | 230 | serine palmitoyltransferase 1Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. serine palmitoyltransferase 1 (SPT1);FUNCTIONS IN: serine C-palmitoyltransferase activity; INVOLVED IN: photomorphogenesis, sphingolipid biosynthetic process, pollen development; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Aminotransferase, class-II, pyridoxal-phosphate binding site (InterPro:IPR001917), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); long chain base2 (TAIR:AT5G23670.2); Has 10415 Blast hits to 10387 proteins in 2165 species: Archae - 77; Bacteria - 7001; Metazoa - 736; Fungi - 585; Plants - 234; Viruses - 9; Other Eukaryotes - 1773 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G77490.1 | protein_coding | 1:29117500-29121093 | unclear | -23.5265 | 262 | 310 | 274 | 201 | thylakoidal ascorbate peroxidaseEncodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. thylakoidal ascorbate peroxidase (TAPX);FUNCTIONS IN: L-ascorbate peroxidase activity; INVOLVED IN: oxidation reduction, response to oxidative stress; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant ascorbate peroxidase (InterPro:IPR002207), Peroxidases heam-ligand binding site (InterPro:IPR019793), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); stromal ascorbate peroxidase (TAIR:AT4G08390.2); Has 7809 Blast hits to 7730 proteins in 1256 species: Archae - 55; Bacteria - 2313; Metazoa - 5; Fungi - 620; Plants - 3345; Viruses - 0; Other Eukaryotes - 1471 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G38360.2 | protein_coding | 4:17967050-17969958 | unclear | -23.4319 | 2046 | 2089 | 236 | 193 | Protein ofunknown function (DUF300) Protein ofunknown function (DUF300); INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF300 (InterPro:IPR005178); Protein ofunknown function (DUF300) (TAIR:AT1G77220.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_020972 | AT4G07665.1 | Ch4:13413395-13413697 | AT5G14390.1 | protein_coding | 5:4637287-4639835 | unclear | -22.9152 | 6 | 41 | 196 | 159 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); alpha/beta-Hydrolases superfamily protein (TAIR:AT3G01690.1); Has 3850 Blast hits to 3837 proteins in 836 species: Archae - 3; Bacteria - 1334; Metazoa - 667; Fungi - 199; Plants - 290; Viruses - 6; Other Eukaryotes - 1351 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G02420.1 | protein_coding | 5:523257-524076 | unclear | -22.8651 | 2680 | 2745 | 110 | 49 | unknown protein; Has 90 Blast hits to 90 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G61960.1 | protein_coding | 5:24878507-24884852 | unclear | -22.706 | 3640 | 3685 | 204 | 175 | MEI2-like protein 1A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. MEI2-like protein 1 (ML1);CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), RNA recognition motif 2 (InterPro:IPR007201), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); MEI2-like 4 (TAIR:AT5G07290.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G32690.1 | protein_coding | 4:15765112-15767106 | unclear | -22.293 | 1862 | 1885 | 84 | 61 | hemoglobin 3 Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. hemoglobin 3 (GLB3);CONTAINS InterPro DOMAIN/s: Globin, truncated bacterial-like (InterPro:IPR001486), Globin-like (InterPro:IPR009050), Globin (InterPro:IPR012292); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G26300.1 | protein_coding | 2:11196996-11201102 | unclear | -22.2881 | 972 | 995 | 413 | 390 | G protein alpha subunit 1 Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. G protein alpha subunit 1 (GP ALPHA 1);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: in 16 processes; LOCATED IN: plasma membrane, endoplasmic reticulum membrane, heterotrimeric G-protein complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Plant G-protein, alpha subunit (InterPro:IPR002976), Guanine nucleotide binding protein (G-protein), alpha subunit (InterPro:IPR001019), G protein alpha subunit, helical insertion (InterPro:IPR011025); extra-large GTP-binding protein 3 (TAIR:AT1G31930.3); Has 3745 Blast hits to 3647 proteins in 408 species: Archae - 0; Bacteria - 0; Metazoa - 2360; Fungi - 766; Plants - 268; Viruses - 0; Other Eukaryotes - 351 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G10720.1 | protein_coding | 1:3562841-3564850 | unclear | -22.2472 | 670 | 720 | 519 | 461 | BSD domain-containing protein BSD domain-containing protein;CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BSD domain-containing protein (TAIR:AT3G49800.1); Has 1569 Blast hits to 1461 proteins in 180 species: Archae - 0; Bacteria - 14; Metazoa - 740; Fungi - 179; Plants - 264; Viruses - 21; Other Eukaryotes - 351 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G26280.1 | protein_coding | 3:9630128-9632145 | unclear | -22.2427 | 597 | 661 | 103 | 47 | cytochrome P450, family 71, subfamily B, polypeptide 4 cytochrome P450 monooxygenase "cytochrome P450, family 71, subfamily B, polypeptide 4" (CYP71B4);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 71, subfamily B, polypeptide 25 (TAIR:AT3G26270.1); Has 33116 Blast hits to 32807 proteins in 1665 species: Archae - 46; Bacteria - 3062; Metazoa - 12210; Fungi - 6959; Plants - 9691; Viruses - 3; Other Eukaryotes - 1145 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G08330.1 | protein_coding | 4:5255120-5256778 | unclear | -22.226 | 971 | 993 | 273 | 251 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G17705.1); Has 98 Blast hits to 98 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G08500.1 | protein_coding | 5:2748133-2751888 | unclear | -22.1576 | 780 | 821 | 681 | 640 | Transmembrane CLPTM1 family protein Transmembrane CLPTM1 family protein;CONTAINS InterPro DOMAIN/s: Cleft lip and palate transmembrane 1 (InterPro:IPR008429); Transmembrane CLPTM1 family protein (TAIR:AT5G23575.1); Has 489 Blast hits to 489 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 58; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT1G48000.1 | protein_coding | 1:17704132-17706460 | unclear | -22.1572 | 1349 | 1399 | 214 | 135 | myb domain protein 112 Encodes a putative transcription factor (MYB112). myb domain protein 112 (MYB112);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 78 (TAIR:AT5G49620.1); Has 8716 Blast hits to 8036 proteins in 469 species: Archae - 0; Bacteria - 0; Metazoa - 760; Fungi - 469; Plants - 5758; Viruses - 6; Other Eukaryotes - 1723 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT5G12240.1 | protein_coding | 5:3958861-3961020 | unclear | -22.1485 | 232 | 261 | 75 | 39 | unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G21540.1 | protein_coding | 2:9220505-9224496 | unclear | -22.018 | 247 | 284 | 567 | 528 | SEC14-like 3 SEC14-like 3 (SFH3);FUNCTIONS IN: phosphatidylinositol transporter activity; INVOLVED IN: flower development, transport; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); Sec14p-like phosphatidylinositol transfer family protein (TAIR:AT4G39180.2); Has 2999 Blast hits to 2982 proteins in 239 species: Archae - 0; Bacteria - 1; Metazoa - 974; Fungi - 679; Plants - 897; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT1G20450.1 | protein_coding | 1:7087903-7089606 | unclear | -22.0074 | 500 | 548 | 875 | 833 | Dehydrin family protein Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, whichCONTAINS highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. EARLY RESPONSIVE TO DEHYDRATION 10 (ERD10);CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); cold-regulated 47 (TAIR:AT1G20440.1); Has 8140 Blast hits to 5021 proteins in 461 species: Archae - 16; Bacteria - 327; Metazoa - 2363; Fungi - 375; Plants - 2004; Viruses - 65; Other Eukaryotes - 2990 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT4G12610.2 | protein_coding | 4:7454722-7458422 | unclear | -21.9442 | 1362 | 1402 | 1117 | 1075 | transcription activators;DNA binding;RNA polymerase II transcription factors;catalytics;transcription initiation factors RAP74;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity, DNA binding, transcription activator activity, catalytic activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: shoot, root, guard cell;CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIF, alpha subunit (InterPro:IPR008851), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039); Has 34394 Blast hits to 22751 proteins in 1168 species: Archae - 120; Bacteria - 4390; Metazoa - 12539; Fungi - 6082; Plants - 2082; Viruses - 445; Other Eukaryotes - 8736 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G71190.1 | protein_coding | 1:26833406-26835060 | unclear | -21.7138 | 235 | 273 | 62 | 28 | senescence associated gene 18 Senescence associated gene (SAG). Expression induced by ozone. Encodes a plant-specific protein ofunknown function. Based on a personal communication from David Meinke (08/21/2007), this gene is not allelic to TTN4, even though this has been stated previously in a publication. senescence associated gene 18 (SAG18);FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides; INVOLVED IN: ceramide metabolic process; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ceramidase (InterPro:IPR008901); Alkaline phytoceramidase (aPHC) (TAIR:AT5G11870.2); Has 182 Blast hits to 182 proteins in 61 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT5G67620.1 | protein_coding | 5:26964551-26966010 | unclear | -21.7093 | 1206 | 1264 | 786 | 729 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: microtubule; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G62900.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_001325 | AT1G05837.1 | Ch1:8423069-8424073 | AT1G03530.1 | protein_coding | 1:880384-883599 | unclear | -21.694 | 814 | 886 | 54 | 2 | nuclear assembly factor 1nuclear assembly factor 1 (NAF1);FUNCTIONS IN: snoRNA binding, pseudouridine synthase activity; INVOLVED IN: biological_processunknown; LOCATED IN: box H/ACA snoRNP complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 (InterPro:IPR007504); Has 55446 Blast hits to 31211 proteins in 1683 species: Archae - 434; Bacteria - 10062; Metazoa - 16821; Fungi - 8873; Plants - 3938; Viruses - 821; Other Eukaryotes - 14497 (source: NCBI BLink). |
| XLOC_021568 | AT4G09335.1 | Ch4:17225058-17225421 | AT1G20880.1 | protein_coding | 1:7262009-7265555 | unclear | -21.5464 | 215 | 243 | 350 | 322 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G76460.1); Has 7701 Blast hits to 7638 proteins in 709 species: Archae - 59; Bacteria - 219; Metazoa - 3282; Fungi - 4; Plants - 1889; Viruses - 133; Other Eukaryotes - 2115 (source: NCBI BLink). |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT4G32270.1 | protein_coding | 4:15574869-15576540 | unclear | -21.4287 | 8 | 46 | 126 | 78 | Ubiquitin-like superfamily protein Ubiquitin-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Ubiquitin-like superfamily protein (TAIR:AT5G25340.1); Has 132 Blast hits to 130 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 63; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT1G74890.1 | protein_coding | 1:28131447-28133025 | Unclear | -21.4258 | 1485 | 1527 | 554 | 510 | response regulator 15Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. response regulator 15 (ARR15);CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Signal transduction response regulator, receiver domain (InterPro:IPR001789); response regulator 7 (TAIR:AT1G19050.1); Has 46084 Blast hits to 45371 proteins in 2654 species: Archae - 273; Bacteria - 40324; Metazoa - 30; Fungi - 580; Plants - 1499; Viruses - 4; Other Eukaryotes - 3374 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G31330.1 | protein_coding | 4:15202288-15203562 | unclear | -21.3765 | 2681 | 2754 | 483 | 430 | Protein ofunknown function, DUF599 Protein ofunknown function, DUF599;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF599 (InterPro:IPR006747); Protein ofunknown function, DUF599 (TAIR:AT5G10580.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT5G64310.1 | protein_coding | 5:25721733-25722678 | unclear | -21.3041 | 3514 | 3572 | 317 | 250 | arabinogalactan protein 1 Encodes arabinogalactan-protein (AGP1). arabinogalactan protein 1 (AGP1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT3G12740.1 | protein_coding | 3:4049309-4051775 | unclear | -21.1541 | 182 | 234 | 244 | 186 | ALA-interacting subunit 1 Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. ALA-interacting subunit 1 (ALIS1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein (TAIR:AT1G54320.1); Has 864 Blast hits to 864 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 252; Fungi - 234; Plants - 160; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT1G30810.1 | protein_coding | 1:10936765-10942292 | unclear | -21.1053 | 1084 | 1114 | 83 | 52 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family proteinJMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), Transcription factor jumonji (InterPro:IPR013129), FY-rich, C-terminal subgroup (InterPro:IPR018516), FY-rich, N-terminal subgroup (InterPro:IPR018518); Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein (TAIR:AT2G34880.1); Has 2138 Blast hits to 1613 proteins in 188 species: Archae - 0; Bacteria - 2; Metazoa - 1141; Fungi - 449; Plants - 371; Viruses - 0; Other Eukaryotes - 175 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G50550.1 | protein_coding | 3:18759348-18760711 | unclear | -21.0916 | 84 | 124 | 259 | 219 | unknown protein; Has 75703 Blast hits to 19796 proteins in 1115 species: Archae - 327; Bacteria - 34383; Metazoa - 14453; Fungi - 7466; Plants - 2586; Viruses - 958; Other Eukaryotes - 15530 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT5G54500.2 | protein_coding | 5:22124390-22126618 | unclear | -21.0459 | 1399 | 1431 | 111 | 83 | flavodoxin-like quinone reductase 1Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. flavodoxin-like quinone reductase 1 (FQR1);CONTAINS InterPro DOMAIN/s: NADPH-dependent FMN reductase (InterPro:IPR005025), Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); Quinone reductase family protein (TAIR:AT4G27270.1). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G30600.1 | protein_coding | 4:14937840-14941208 | unclear | -21.0311 | 3587 | 3631 | 2057 | 2015 | signal recognition particle receptor alpha subunit family proteinsignal recognition particle receptor alpha subunit family protein;FUNCTIONS IN: nucleoside-triphosphatase activity, signal recognition particle binding, GTP binding, GTPase activity, nucleotide binding; INVOLVED IN: intracellular protein transport, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: endoplasmic reticulum, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle receptor, alpha subunit, N-terminal (InterPro:IPR007222), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); signal recognition particle 54 kDa subunit (TAIR:AT1G15310.1); Has 16825 Blast hits to 16740 proteins in 2884 species: Archae - 472; Bacteria - 10592; Metazoa - 551; Fungi - 433; Plants - 279; Viruses - 3; Other Eukaryotes - 4495 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G23010.3 | protein_coding | 4:12060131-12062858 | unclear | -21.0249 | 131 | 171 | 106 | 67 | UDP-galactose transporter 2 UDP-galactose transporter 2 (UTR2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: transmembrane transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); UDP-N-acetylglucosamine (UAA) transporter family (TAIR:AT1G12600.1). |
| XLOC_000417 | AT1G04647.1 | Ch1:2620439-2621546 | AT4G28940.1 | protein_coding | 4:14274341-14277252 | unclear | -21.0123 | 790 | 841 | 987 | 912 | Phosphorylase superfamily proteinPhosphorylase superfamily protein;FUNCTIONS IN: catalytic activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root, flower; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); Phosphorylase superfamily protein (TAIR:AT4G24340.1); Has 4063 Blast hits to 3116 proteins in 1287 species: Archae - 0; Bacteria - 3887; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT2G17787.1 | protein_coding | 2:7731075-7733137 | unclear | -20.9969 | 2196 | 2224 | 1323 | 1295 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G35940.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G06530.1 | protein_coding | 2:2588523-2590531 | unclear | -20.9822 | 230 | 262 | 655 | 623 | SNF7 family protein VPS2.1;CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); vacuolar protein sorting-associated protein 2.3 (TAIR:AT1G03950.1); Has 2524 Blast hits to 2516 proteins in 271 species: Archae - 17; Bacteria - 20; Metazoa - 1106; Fungi - 512; Plants - 555; Viruses - 5; Other Eukaryotes - 309 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G33480.1 | protein_coding | 2:14180978-14182439 | unclear | -20.888 | 53 | 105 | 674 | 599 | NAC domain containing protein 41 NAC domain containing protein 41 (NAC041);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 83 (TAIR:AT5G13180.1); Has 3047 Blast hits to 3036 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 3023; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT1G22280.3 | protein_coding | 1:7873867-7876018 | unclear | -20.8576 | 38 | 94 | 1447 | 1381 | phytochrome-associated protein phosphatase type 2C Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. FUNCTIONS as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. phytochrome-associated protein phosphatase type 2C (PAPP2C);CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT1G34750.1). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G57390.1 | protein_coding | 3:21233472-21235978 | unclear | -20.8341 | 2778 | 2806 | 144 | 115 | AGAMOUS-like 18 encodes a MADS-box containing protein likely to be a transcription factor that is expressed in endosperm and developing gametophytes. The protein sequence is most similar to that of AGL15, which is expressed in developing embryos. AGAMOUS-like 18 (AGL18);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100), Transcription factor, K-box (InterPro:IPR002487); AGAMOUS-like 15 (TAIR:AT5G13790.1); Has 6796 Blast hits to 6793 proteins in 870 species: Archae - 0; Bacteria - 0; Metazoa - 633; Fungi - 312; Plants - 5770; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G79430.2 | protein_coding | 1:29877228-29879279 | unclear | -20.7806 | 2201 | 2241 | 70 | 35 | Homeodomain-like superfamily protein Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. ALTERED PHLOEM DEVELOPMENT (APL);CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930); Homeodomain-like superfamily protein (TAIR:AT3G12730.1); Has 1662 Blast hits to 1649 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1644; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G28840.1 | protein_coding | 2:12378272-12380809 | unclear | -20.7739 | 635 | 661 | 43 | 20 | XB3 ortholog 1 in Arabidopsis thalianaXB3 ortholog 1 in Arabidopsis thaliana (XBAT31);FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); XB3 ortholog 3 in Arabidopsis thaliana (TAIR:AT5G07270.1); Has 52906 Blast hits to 22710 proteins in 954 species: Archae - 64; Bacteria - 3597; Metazoa - 29466; Fungi - 4564; Plants - 3287; Viruses - 345; Other Eukaryotes - 11583 (source: NCBI BLink). |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G05320.1 | protein_coding | 5:1574862-1576731 | unclear | -20.7095 | 10 | 82 | 1115 | 1036 | FAD/NAD(P)-binding oxidoreductase family protein FAD/NAD(P)-binding oxidoreductase family protein;FUNCTIONS IN: monooxygenase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Monooxygenase, FAD-binding (InterPro:IPR002938); FAD/NAD(P)-binding oxidoreductase family protein (TAIR:AT4G38540.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT5G16520.1 | protein_coding | 5:5394544-5397466 | unclear | -20.7028 | 3121 | 3148 | 44 | 16 | unknown protein; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G05710.2 | protein_coding | 1:1714818-1717290 | unclear | -20.557 | 3638 | 3689 | 438 | 383 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to ethylene stimulus, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G31730.1); Has 853 Blast hits to 853 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 853; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT2G17390.1 | protein_coding | 2:7555586-7558064 | unclear | -20.5221 | 776 | 804 | 779 | 753 | ankyrin repeat-containing 2B Highly homologous to AKR2A. Involved in chloroplast biogenesis. Double mutants of AKR2A and AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. ankyrin repeat-containing 2B (AKR2B);FUNCTIONS IN: transcription regulator activity; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); ankyrin repeat-containing protein 2 (TAIR:AT4G35450.1); Has 80350 Blast hits to 27630 proteins in 1286 species: Archae - 139; Bacteria - 6360; Metazoa - 42384; Fungi - 5488; Plants - 3518; Viruses - 784; Other Eukaryotes - 21677 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G66360.2 | protein_coding | 5:26510146-26511844 | unclear | -20.5068 | 794 | 843 | 268 | 229 | Ribosomal RNA adenine dimethylase family proteinEncodes a mitochondrial rRNA dimethylase. Ribosomal RNA adenine dimethylase family protein;FUNCTIONS IN: rRNA methyltransferase activity, rRNA (adenine-N6,N6-)-dimethyltransferase activity, rRNA (adenine) methyltransferase activity; INVOLVED IN: rRNA modification, rRNA processing; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal RNA adenine methylase transferase, N-terminal (InterPro:IPR020598), Ribosomal RNA adenine dimethylase (InterPro:IPR011530), Ribosomal RNA adenine methylase transferase, conserved site (InterPro:IPR020596), Ribosomal RNA adenine methylase transferase (InterPro:IPR001737); Ribosomal RNA adenine dimethylase family protein (TAIR:AT2G47420.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G49525.1 | protein_coding | 5:20096932-20097551 | unclear | -20.4673 | 48 | 85 | 102 | 71 | unknown protein; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_002495 | AT1G52347.2 | Ch1:19496461-19497686 | AT1G54160.1 | protein_coding | 1:20217336-20219452 | unclear | -20.4197 | 23 | 47 | 113 | 91 | nuclear factor Y, subunit A5 Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. "nuclear factor Y, subunit A5" (NF-YA5);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: response to water deprivation, negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); nuclear factor Y, subunit A6 (TAIR:AT3G14020.1); Has 683 Blast hits to 683 proteins in 160 species: Archae - 0; Bacteria - 0; Metazoa - 143; Fungi - 133; Plants - 381; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G47000.1 | protein_coding | 2:19309643-19315343 | unclear | -20.4093 | 30 | 71 | 266 | 229 | ATP binding cassette subfamily B4 Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters.FUNCTIONS in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. ATP binding cassette subfamily B4 (ABCB4);FUNCTIONS IN: xenobiotic-transporting ATPase activity, ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: in 8 processes; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); P-glycoprotein 21 (TAIR:AT3G62150.1); Has 844144 Blast hits to 390751 proteins in 4168 species: Archae - 14748; Bacteria - 659498; Metazoa - 17847; Fungi - 13026; Plants - 10001; Viruses - 45; Other Eukaryotes - 128979 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G74890.1 | protein_coding | 1:28131447-28133025 | Unclear | -20.3906 | 970 | 997 | 44 | 17 | response regulator 15Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. response regulator 15 (ARR15);CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Signal transduction response regulator, receiver domain (InterPro:IPR001789); response regulator 7 (TAIR:AT1G19050.1); Has 46084 Blast hits to 45371 proteins in 2654 species: Archae - 273; Bacteria - 40324; Metazoa - 30; Fungi - 580; Plants - 1499; Viruses - 4; Other Eukaryotes - 3374 (source: NCBI BLink). |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT5G35200.1 | protein_coding | 5:13462155-13466150 | unclear | -20.3713 | 1185 | 1225 | 1579 | 1541 | ENTH/ANTH/VHS superfamily proteinENTH/ANTH/VHS superfamily protein;FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); ENTH/ANTH/VHS superfamily protein (TAIR:AT2G01600.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_000642 | AT1G04933.1 | Ch1:4123641-4124165 | AT1G67360.2 | protein_coding | 1:25236781-25238216 | unclear | -20.3331 | 136 | 224 | 899 | 831 | Rubber elongation factor protein (REF)Rubber elongation factor protein (REF); INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); Rubber elongation factor protein (REF) (TAIR:AT2G47780.1); Has 125 Blast hits to 125 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G07600.1 | protein_coding | 3:2424117-2425022 | Unclear | -20.3179 | 52 | 96 | 378 | 320 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT5G48290.1); Has 932 Blast hits to 701 proteins in 113 species: Archae - 0; Bacteria - 150; Metazoa - 39; Fungi - 24; Plants - 521; Viruses - 17; Other Eukaryotes - 181 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G11330.1 | protein_coding | 3:3551759-3554843 | unclear | -20.3114 | 48 | 96 | 1454 | 1409 | plant intracellular ras group-related LRR 9Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. plant intracellular ras group-related LRR 9 (PIRL9); INVOLVED IN: pollen development, microgametogenesis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); plant intracellular ras group-related LRR 1 (TAIR:AT5G05850.1); Has 80076 Blast hits to 32245 proteins in 1215 species: Archae - 20; Bacteria - 6549; Metazoa - 31794; Fungi - 2648; Plants - 34170; Viruses - 12; Other Eukaryotes - 4883 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT2G37970.1 | protein_coding | 2:15890869-15891704 | unclear | -20.239 | 1965 | 2008 | 613 | 567 | SOUL heme-binding family protein SOUL-1;FUNCTIONS IN: binding; INVOLVED IN: N-terminal protein myristoylation, red or far-red light signaling pathway; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SOUL haem-binding protein (InterPro:IPR006917); SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1375 Blast hits to 1375 proteins in 156 species: Archae - 18; Bacteria - 186; Metazoa - 71; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 927 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G63640.1 | protein_coding | 5:25477541-25481715 | unclear | -20.231 | 143 | 171 | 156 | 119 | ENTH/VHS/GAT family protein ENTH/VHS/GAT family protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), ENTH/VHS (InterPro:IPR008942); ENTH/VHS/GAT family protein (TAIR:AT4G32760.1); Has 1276 Blast hits to 1268 proteins in 185 species: Archae - 0; Bacteria - 4; Metazoa - 656; Fungi - 270; Plants - 272; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G45910.1 | protein_coding | 2:18894030-18898528 | unclear | -20.2227 | 1449 | 1473 | 215 | 191 | U-box domain-containing protein kinase family protein U-box domain-containing protein kinase family protein;FUNCTIONS IN: ubiquitin-protein ligase activity, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, response to stress, protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), U box domain (InterPro:IPR003613), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); U-box domain-containing protein kinase family protein (TAIR:AT3G49060.1); Has 126911 Blast hits to 124541 proteins in 4743 species: Archae - 223; Bacteria - 14733; Metazoa - 47002; Fungi - 10910; Plants - 34737; Viruses - 429; Other Eukaryotes - 18877 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G16857.2 | protein_coding | 3:5755714-5759443 | Unclear | -20.1623 | 2716 | 2754 | 125 | 88 | response regulator 1 Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. response regulator 1 (RR1);CONTAINS InterPro DOMAIN/s: Response regulator, plant B-type (InterPro:IPR017053), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), CheY-like (InterPro:IPR011006), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Signal transduction response regulator, receiver domain (InterPro:IPR001789), Homeodomain-related (InterPro:IPR012287), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930); response regulator 2 (TAIR:AT4G16110.1); Has 98862 Blast hits to 97820 proteins in 3027 species: Archae - 653; Bacteria - 87858; Metazoa - 53; Fungi - 404; Plants - 2787; Viruses - 5; Other Eukaryotes - 7102 (source: NCBI BLink). |
| XLOC_004253 | AT1G04117.1 | Ch1:494008-495548 | AT1G31130.1 | protein_coding | 1:11114693-11116195 | unclear | -20.1503 | 863 | 928 | 587 | 525 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G19950.1); Has 246 Blast hits to 244 proteins in 29 species: Archae - 2; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 222; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G28580.1 | protein_coding | 3:10715597-10717393 | Unclear | -20.1285 | 238 | 293 | 1625 | 1572 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); AAA-ATPase 1 (TAIR:AT5G40010.1); Has 26015 Blast hits to 22183 proteins in 2894 species: Archae - 1297; Bacteria - 7409; Metazoa - 4737; Fungi - 2999; Plants - 2564; Viruses - 69; Other Eukaryotes - 6940 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT1G06070.1 | protein_coding | 1:1834829-1837758 | unclear | -20.0981 | 1226 | 1254 | 99 | 73 | Basic-leucine zipper (bZIP) transcription factor family protein Basic-leucine zipper (bZIP) transcription factor family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G31370.5); Has 39307 Blast hits to 17494 proteins in 873 species: Archae - 8; Bacteria - 1528; Metazoa - 14762; Fungi - 4294; Plants - 2852; Viruses - 384; Other Eukaryotes - 15479 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G76390.1 | protein_coding | 1:28655208-28658711 | unclear | -20.0855 | 21 | 78 | 804 | 755 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); senescence-associated E3 ubiquitin ligase 1 (TAIR:AT1G20780.1); Has 2889 Blast hits to 2662 proteins in 212 species: Archae - 0; Bacteria - 26; Metazoa - 333; Fungi - 292; Plants - 2003; Viruses - 3; Other Eukaryotes - 232 (source: NCBI BLink). |
| XLOC_005049 | AT1G15175.1 | Ch1:5222729-5224055 | AT3G17020.1 | protein_coding | 3:5802493-5804282 | unclear | -20.0297 | 158 | 217 | 673 | 622 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to cold, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT3G03270.2); Has 3326 Blast hits to 3271 proteins in 769 species: Archae - 372; Bacteria - 2020; Metazoa - 115; Fungi - 79; Plants - 685; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT5G61430.1 | protein_coding | 5:24701062-24702787 | unclear | -19.9874 | 103 | 154 | 61 | 2 | NAC domain containing protein 100NAC domain containing protein 100 (NAC100);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 80 (TAIR:AT5G07680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT2G17420.1 | protein_coding | 2:7564240-7566601 | unclear | -19.9792 | 269 | 303 | 146 | 114 | NADPH-dependent thioredoxin reductase A NADPH-dependent thioredoxin reductase, major cytosolic isoform NADPH-dependent thioredoxin reductase A (NTRA);FUNCTIONS IN: thioredoxin-disulfide reductase activity; INVOLVED IN: in 6 processes; LOCATED IN: cytosol, mitochondrial matrix; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube, leaf; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth, seed development stages;CONTAINS InterPro DOMAIN/s: Pyridine nucleotide-disulphide oxidoreductase, class-II, active site (InterPro:IPR008255), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, class-II (InterPro:IPR000103), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), Thioredoxin reductase (InterPro:IPR005982); NADPH-dependent thioredoxin reductase B (TAIR:AT4G35460.1); Has 20135 Blast hits to 20133 proteins in 2901 species: Archae - 588; Bacteria - 13597; Metazoa - 140; Fungi - 273; Plants - 163; Viruses - 0; Other Eukaryotes - 5374 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G16810.1 | protein_coding | 1:5755588-5756895 | unclear | -19.9634 | 29 | 96 | 339 | 275 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 395 Blast hits to 394 proteins in 162 species: Archae - 0; Bacteria - 0; Metazoa - 181; Fungi - 91; Plants - 65; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G34680.1 | protein_coding | 4:16553145-16554872 | unclear | -19.9296 | 5 | 70 | 847 | 787 | GATA transcription factor 3Encodes a member of the GATA factor family of zinc finger transcription factors. GATA transcription factor 3 (GATA3);CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Transcription factor, GATA, plant (InterPro:IPR016679), Zinc finger, GATA-type (InterPro:IPR000679); GATA transcription factor 7 (TAIR:AT4G36240.1); Has 1460 Blast hits to 1422 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 551; Plants - 835; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G23790.1 | protein_coding | 3:8575051-8581331 | unclear | -19.89 | 3628 | 3688 | 58 | 0 | AMP-dependent synthetase and ligase family protein acyl activating enzyme 16 (AAE16);FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding (InterPro:IPR020459), AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); acyl-activating enzyme 15 (TAIR:AT4G14070.1); Has 72182 Blast hits to 54949 proteins in 3465 species: Archae - 1133; Bacteria - 50819; Metazoa - 2739; Fungi - 2717; Plants - 2582; Viruses - 1; Other Eukaryotes - 12191 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT1G21390.1 | protein_coding | 1:7489046-7490803 | unclear | -19.8639 | 1351 | 1381 | 684 | 654 | embryo defective 2170 embryo defective 2170 (emb2170); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G76980.2); Has 51 Blast hits to 51 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G26210.1 | protein_coding | 5:9158318-9160493 | unclear | -19.8264 | 517 | 546 | 132 | 98 | alfin-like 4 Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). alfin-like 4 (AL4);CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Protein ofunknown function DUF3594 (InterPro:IPR021998), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); alfin-like 3 (TAIR:AT3G42790.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G48760.1 | protein_coding | 3:18075705-18078363 | unclear | -19.7916 | 779 | 804 | 1367 | 1342 | DHHC-type zinc finger family protein DHHC-type zinc finger family protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); DHHC-type zinc finger family protein (TAIR:AT3G26935.1); Has 5108 Blast hits to 5099 proteins in 252 species: Archae - 0; Bacteria - 0; Metazoa - 2197; Fungi - 756; Plants - 845; Viruses - 0; Other Eukaryotes - 1310 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G54290.1 | protein_coding | 3:20104352-20106215 | unclear | -19.7763 | 153 | 195 | 148 | 108 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Haemerythrin/HHE cation-binding motif (InterPro:IPR012312); Has 59 Blast hits to 59 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| XLOC_005049 | AT1G15175.2 | Ch1:5222729-5224055 | AT2G47460.1 | protein_coding | 2:19476326-19479597 | Unclear | -19.7738 | 38 | 80 | 62 | 19 | myb domain protein 12 "MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. " The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. myb domain protein 12 (MYB12);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 11 (TAIR:AT3G62610.1); Has 8833 Blast hits to 8133 proteins in 470 species: Archae - 0; Bacteria - 0; Metazoa - 786; Fungi - 423; Plants - 5965; Viruses - 6; Other Eukaryotes - 1653 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G04410.1 | protein_coding | 5:1243684-1246684 | unclear | -19.773 | 2692 | 2754 | 161 | 76 | NAC domain containing protein 2 NAC family member,FUNCTIONS as a transcriptional activator, regulates flavonoid biosynthesis under high light. NAC domain containing protein 2 (NAC2);CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 53 (TAIR:AT3G10500.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G58710.1 | protein_coding | 3:21714911-21716916 | unclear | -19.7727 | 232 | 269 | 670 | 635 | WRKY DNA-binding protein 69member of WRKY Transcription Factor; Group II-e WRKY DNA-binding protein 69 (WRKY69);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent, regulation of transcription; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657); WRKY DNA-binding protein 65 (TAIR:AT1G29280.1); Has 3301 Blast hits to 2851 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3287; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT5G58720.1 | protein_coding | 5:23719695-23723175 | unclear | -19.747 | 2209 | 2240 | 302 | 272 | smr (Small MutS Related) domain-containing protein smr (Small MutS Related) domain-containing protein;CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Domain ofunknown function DUF1771 (InterPro:IPR013899); silencing defective 5 (TAIR:AT3G15390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT2G29420.1 | protein_coding | 2:12617936-12618899 | unclear | -19.7391 | 664 | 732 | 588 | 526 | glutathione S-transferase tau 7 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Induced by Salicylic acid. Independent of NPR1 for their induction by salicylic acid. glutathione S-transferase tau 7 (GSTU7);CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); glutathione S-transferase tau 4 (TAIR:AT2G29460.1); Has 8702 Blast hits to 8684 proteins in 1229 species: Archae - 0; Bacteria - 4688; Metazoa - 929; Fungi - 158; Plants - 2134; Viruses - 0; Other Eukaryotes - 793 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G63490.1 | protein_coding | 5:25418594-25422466 | unclear | -19.7318 | 230 | 257 | 1549 | 1521 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing proteinCBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Cystathionine beta-synthase, core (InterPro:IPR000644); CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein (TAIR:AT5G50530.1); Has 8040 Blast hits to 6478 proteins in 1504 species: Archae - 1004; Bacteria - 5599; Metazoa - 7; Fungi - 119; Plants - 199; Viruses - 0; Other Eukaryotes - 1112 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT4G14710.5 | protein_coding | 4:8424667-8426575 | unclear | -19.7191 | 1350 | 1373 | 101 | 78 | RmlC-like cupins superfamily protein ATARD2;FUNCTIONS IN: acireductone dioxygenase [iron(II)-requiring] activity, metal ion binding; INVOLVED IN: oxidation reduction, L-methionine salvage from methylthioadenosine; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Acireductone dioxygenase, ARD (InterPro:IPR004313), RmlC-like jelly roll fold (InterPro:IPR014710); acireductone dioxygenase 1 (TAIR:AT4G14716.1). |
| XLOC_025053 | AT5G18255.3 | Ch5:6035619-6037641 | AT4G34710.1 | protein_coding | 4:16560030-16563044 | unclear | -19.7093 | 0 | 37 | 44 | 4 | arginine decarboxylase 2Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. arginine decarboxylase 2 (ADC2);CONTAINS InterPro DOMAIN/s: Orn/DAP/Arg decarboxylase 2, C-terminal (InterPro:IPR022643), Orn/DAP/Arg decarboxylase 2, conserved site (InterPro:IPR022657), Orn/DAP/Arg decarboxylase 2, pyridoxal-phosphate binding site (InterPro:IPR022653), Ornithine/DAP/Arg decarboxylase (InterPro:IPR000183), Arginine decarboxylase (InterPro:IPR002985), Orn/DAP/Arg decarboxylase 2, N-terminal (InterPro:IPR022644); arginine decarboxylase 1 (TAIR:AT2G16500.1); Has 7853 Blast hits to 7777 proteins in 2122 species: Archae - 112; Bacteria - 5255; Metazoa - 102; Fungi - 32; Plants - 645; Viruses - 2; Other Eukaryotes - 1705 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G21690.1 | protein_coding | 3:7638584-7642389 | unclear | -19.6735 | 709 | 745 | 1480 | 1445 | MATE efflux family protein MATE efflux family protein;FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); MATE efflux family protein (TAIR:AT1G61890.1); Has 11325 Blast hits to 11232 proteins in 2038 species: Archae - 269; Bacteria - 8227; Metazoa - 142; Fungi - 332; Plants - 1357; Viruses - 0; Other Eukaryotes - 998 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G25760.1 | protein_coding | 5:8967655-8969369 | unclear | -19.6519 | 2776 | 2805 | 53 | 22 | peroxin4 mutant displays sucrose-dependent seedling development and reduced lateral root production. PEX4 interacts with PEX22 in a yeast two-hybrid. Necessary for peroxisome biogenesis. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. peroxin4 (PEX4);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquitin-conjugating enzyme 29 (TAIR:AT2G16740.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G39050.1 | protein_coding | 5:15634444-15636480 | Unclear | -19.6329 | 1560 | 1600 | 265 | 225 | HXXXD-type acyl-transferase family protein Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. HXXXD-type acyl-transferase family protein;FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); HXXXD-type acyl-transferase family protein (TAIR:AT5G39080.1); Has 1994 Blast hits to 1978 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 30; Plants - 1963; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G54870.1 | protein_coding | 5:22289104-22291859 | unclear | -19.6283 | 2694 | 2750 | 66 | 20 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G27020.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G44770.1 | protein_coding | 1:16907537-16909572 | unclear | -19.5992 | 230 | 262 | 77 | 39 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G49710.3); Has 81 Blast hits to 81 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G52530.1 | protein_coding | 5:21317130-21321267 | unclear | -19.5883 | 3602 | 3626 | 703 | 675 | dentin sialophosphoprotein-related dentin sialophosphoprotein-related; Has 931 Blast hits to 739 proteins in 178 species: Archae - 6; Bacteria - 85; Metazoa - 392; Fungi - 124; Plants - 76; Viruses - 5; Other Eukaryotes - 243 (source: NCBI BLink). |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT5G58530.1 | protein_coding | 5:23660083-23661472 | unclear | -19.5839 | 102 | 150 | 188 | 140 | Glutaredoxin family protein Glutaredoxin family protein;FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); Glutaredoxin family protein (TAIR:AT5G13810.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_028934 | AT5G24735.1 | Ch5:8468331-8469262 | AT4G35750.1 | protein_coding | 4:16940462-16942060 | Unclear | -19.5731 | 45 | 64 | 1053 | 1034 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251); SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT3G10210.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT5G45880.1 | protein_coding | 5:18609628-18611166 | unclear | -19.4708 | 3521 | 3573 | 173 | 115 | Pollen Ole e 1 allergen and extensin family protein Pollen Ole e 1 allergen and extensin family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: extracellular space, endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen/extensin (InterPro:IPR006041), Allergen Ole e 1, conserved site (InterPro:IPR006040); Pollen Ole e 1 allergen and extensin family protein (TAIR:AT4G18596.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT1G28280.1 | protein_coding | 1:9885400-9887478 | unclear | -19.442 | 1401 | 1430 | 79 | 44 | VQ motif-containing protein VQ motif-containing protein;CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); VQ motif-containing protein (TAIR:AT2G33780.1); Has 240 Blast hits to 231 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 32; Plants - 147; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G34135.1 | protein_coding | 4:16345150-16347434 | unclear | -19.4028 | 1627 | 1674 | 1466 | 1401 | UDP-glucosyltransferase 73B2 The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position.UDP-glucosyltransferase 73B2 (UGT73B2);FUNCTIONS IN: flavonol 3-O-glucosyltransferase activity, UDP-glycosyltransferase activity, quercetin 7-O-glucosyltransferase activity, UDP-glucosyltransferase activity; INVOLVED IN: flavonol biosynthetic process, response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyl transferase 73B3 (TAIR:AT4G34131.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G60360.3 | protein_coding | 5:24279660-24282482 | unclear | -19.402 | 530 | 559 | 74 | 39 | aleurain-like protease Encodes a senescence-associated thiol protease. aleurain-like protease (ALP);CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); Cysteine proteinases superfamily protein (TAIR:AT3G45310.1); Has 8252 Blast hits to 8181 proteins in 792 species: Archae - 69; Bacteria - 357; Metazoa - 3329; Fungi - 10; Plants - 1862; Viruses - 142; Other Eukaryotes - 2483 (source: NCBI BLink). |
| XLOC_023962 | AT4G38545.3 | Ch4:18022932-18025298 | AT3G47160.2 | protein_coding | 3:17359758-17362240 | unclear | -19.3335 | 5 | 60 | 214 | 140 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT5G58787.1). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G14280.1 | protein_coding | 5:4608745-4610448 | unclear | -19.3132 | 971 | 991 | 922 | 902 | DNA-binding storekeeper protein-related DNA-binding storekeeper protein-related;FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_processunknown; LOCATED IN: integral to membrane;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF573 (InterPro:IPR007592), TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein (TAIR:AT3G27270.1); Has 335 Blast hits to 330 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 315; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G20440.1 | protein_coding | 1:7084409-7086873 | unclear | -19.3037 | 179 | 211 | 902 | 869 | cold-regulated 47 Belongs to the dehydrin protein family, whichCONTAINS highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. cold-regulated 47 (COR47);CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); Dehydrin family protein (TAIR:AT1G20450.1); Has 14264 Blast hits to 8754 proteins in 735 species: Archae - 48; Bacteria - 976; Metazoa - 4799; Fungi - 1094; Plants - 2502; Viruses - 117; Other Eukaryotes - 4728 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G39850.3 | protein_coding | 4:18488434-18497266 | unclear | -19.2732 | 3119 | 3148 | 108 | 71 | peroxisomal ABC transporter 1Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. peroxisomal ABC transporter 1 (PXA1);CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, N-terminal (InterPro:IPR010509), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, conserved site (InterPro:IPR017871); ABC transporter family protein (TAIR:AT1G54350.1). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G25440.1 | protein_coding | 2:10826735-10829402 | unclear | -19.2519 | 1350 | 1378 | 1877 | 1851 | receptor like protein 20 receptor like protein 20 (RLP20);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 24 (TAIR:AT2G33020.1); Has 67847 Blast hits to 21797 proteins in 926 species: Archae - 19; Bacteria - 3141; Metazoa - 10913; Fungi - 651; Plants - 48566; Viruses - 4; Other Eukaryotes - 4553 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G01770.1 | protein_coding | 1:278600-282891 | unclear | -19.2095 | 2201 | 2228 | 2220 | 2192 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1446 (InterPro:IPR010839); Has 1597 Blast hits to 1509 proteins in 306 species: Archae - 4; Bacteria - 843; Metazoa - 22; Fungi - 131; Plants - 31; Viruses - 0; Other Eukaryotes - 566 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G10800.1 | protein_coding | 3:3379168-3381621 | unclear | -19.1535 | 743 | 806 | 202 | 153 | Basic-leucine zipper (bZIP) transcription factor family protein Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. BZIP28;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G40950.1); Has 1906 Blast hits to 1391 proteins in 215 species: Archae - 0; Bacteria - 248; Metazoa - 700; Fungi - 222; Plants - 463; Viruses - 4; Other Eukaryotes - 269 (source: NCBI BLink). |
| XLOC_005592 | AT1G05927.1 | Ch1:8835419-8836850 | AT4G32130.1 | protein_coding | 4:15520025-15522695 | unclear | -19.1502 | 259 | 278 | 178 | 159 | Protein ofunknown function (DUF2012)FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: male gametophyte, callus, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Protein ofunknown function DUF2012 (InterPro:IPR019008); Protein ofunknown function (DUF2012) (TAIR:AT2G25310.1); Has 295 Blast hits to 295 proteins in 131 species: Archae - 0; Bacteria - 8; Metazoa - 141; Fungi - 68; Plants - 50; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| XLOC_023238 | AT4G26095.1 | Ch4:13224204-13227622 | AT4G27020.1 | protein_coding | 4:13568367-13571495 | Unclear | -19.1249 | 2510 | 2540 | 959 | 931 | unknown protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: vacuole; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G54870.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G51370.1 | protein_coding | 3:19069127-19072231 | unclear | -19.1054 | 1447 | 1476 | 111 | 84 | Protein phosphatase 2C family protein Protein phosphatase 2C family protein;FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); Protein phosphatase 2C family protein (TAIR:AT5G66080.1); Has 5552 Blast hits to 5549 proteins in 305 species: Archae - 0; Bacteria - 44; Metazoa - 1445; Fungi - 559; Plants - 2537; Viruses - 3; Other Eukaryotes - 964 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT2G06530.1 | protein_coding | 2:2588523-2590531 | unclear | -19.1025 | 2200 | 2221 | 270 | 249 | SNF7 family protein VPS2.1;CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); vacuolar protein sorting-associated protein 2.3 (TAIR:AT1G03950.1); Has 2524 Blast hits to 2516 proteins in 271 species: Archae - 17; Bacteria - 20; Metazoa - 1106; Fungi - 512; Plants - 555; Viruses - 5; Other Eukaryotes - 309 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G61520.1 | protein_coding | 5:24739026-24741401 | unclear | -19.1017 | 43 | 72 | 326 | 296 | Major facilitator superfamily protein Major facilitator superfamily protein;FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily (InterPro:IPR020846), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Major facilitator superfamily protein (TAIR:AT1G34580.1); Has 24946 Blast hits to 24488 proteins in 1831 species: Archae - 380; Bacteria - 10823; Metazoa - 3430; Fungi - 6555; Plants - 2609; Viruses - 0; Other Eukaryotes - 1149 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G28250.1 | protein_coding | 1:9874247-9875579 | unclear | -19.1014 | 53 | 91 | 59 | 29 | unknown protein; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT1G47890.1 | protein_coding | 1:17643976-17647107 | Unclear | -18.9585 | 1350 | 1369 | 2912 | 2893 | receptor like protein 7 receptor like protein 7 (RLP7);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: stem, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 6 (TAIR:AT1G45616.1); Has 144165 Blast hits to 35486 proteins in 1317 species: Archae - 51; Bacteria - 13451; Metazoa - 35189; Fungi - 1938; Plants - 82186; Viruses - 41; Other Eukaryotes - 11309 (source: NCBI BLink). |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G04555.1 | protein_coding | 1:1242506-1244244 | unclear | -18.9517 | 672 | 698 | 322 | 285 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G33380.1); Has 84 Blast hits to 83 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT3G52920.1 | protein_coding | 3:19624278-19626347 | unclear | -18.951 | 217 | 260 | 432 | 396 | Family ofunknown function (DUF662) Family ofunknown function (DUF662) ; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF662 (InterPro:IPR007033); Family ofunknown function (DUF662) (TAIR:AT2G36410.1); Has 2850 Blast hits to 2486 proteins in 375 species: Archae - 84; Bacteria - 284; Metazoa - 1164; Fungi - 182; Plants - 322; Viruses - 9; Other Eukaryotes - 805 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G15270.1 | protein_coding | 4:8716504-8717914 | unclear | -18.9435 | 1866 | 1928 | 849 | 788 | glucosyltransferase-related glucosyltransferase-related;FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: stem, root;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyl transferase 71B5 (TAIR:AT4G15280.1); Has 1593 Blast hits to 1031 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1593; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT4G33040.1 | protein_coding | 4:15940228-15941493 | unclear | -18.9407 | 999 | 1040 | 209 | 170 | Thioredoxin superfamily protein Thioredoxin superfamily protein;FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glutaredoxin-like, plant II (InterPro:IPR011905), Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); Thioredoxin superfamily protein (TAIR:AT5G11930.1); Has 1149 Blast hits to 1147 proteins in 175 species: Archae - 0; Bacteria - 20; Metazoa - 257; Fungi - 124; Plants - 712; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G34990.1 | protein_coding | 4:16661101-16662549 | unclear | -18.8784 | 2776 | 2805 | 33 | 0 | myb domain protein 32 Member of the R2R3 factor gene family. myb domain protein 32 (MYB32);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 7 (TAIR:AT2G16720.1); Has 9023 Blast hits to 8385 proteins in 476 species: Archae - 0; Bacteria - 0; Metazoa - 680; Fungi - 473; Plants - 6077; Viruses - 3; Other Eukaryotes - 1790 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G22740.1 | protein_coding | 4:11943849-11946139 | unclear | -18.8629 | 85 | 133 | 444 | 390 | glycine-rich protein glycine-rich protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Myelodysplasia-myeloid leukemia factor 1-interacting protein (InterPro:IPR019376); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G45380.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G19660.1 | protein_coding | 3:6825433-6826585 | unclear | -18.8495 | 531 | 557 | 359 | 334 | unknown protein; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT2G45160.1 | protein_coding | 2:18617862-18620451 | unclear | -18.8067 | 2297 | 2347 | 58 | 0 | GRAS family transcription factor Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. HAIRY MERISTEM 1 (HAM1);CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT3G60630.1); Has 2292 Blast hits to 2267 proteins in 299 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 0; Plants - 2284; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G23700.1 | protein_coding | 4:12342376-12346051 | unclear | -18.7863 | 761 | 807 | 332 | 284 | cation/H+ exchanger 17 member of Putative Na+/H+ antiporter familycation/H+ exchanger 17 (CHX17);FUNCTIONS IN: monovalent cation:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: N-terminal protein myristoylation, cation transport; LOCATED IN: integral to membrane; EXPRESSED IN: stem, sepal, root, leaf, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Cation/H+ exchanger (InterPro:IPR006153); cation/H+ exchanger 18 (TAIR:AT5G41610.1); Has 10581 Blast hits to 10541 proteins in 2184 species: Archae - 402; Bacteria - 8255; Metazoa - 59; Fungi - 207; Plants - 679; Viruses - 0; Other Eukaryotes - 979 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G09815.1 | protein_coding | 1:3189301-3190242 | unclear | -18.776 | 2183 | 2224 | 104 | 62 | polymerase delta 4 polymerase delta 4 (POLD4);FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 212 Blast hits to 212 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 52; Fungi - 86; Plants - 65; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT3G53990.1 | protein_coding | 3:19989292-19991186 | unclear | -18.7644 | 255 | 311 | 466 | 425 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to cold, response to stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT3G03270.2); Has 5009 Blast hits to 4945 proteins in 1133 species: Archae - 476; Bacteria - 3496; Metazoa - 126; Fungi - 96; Plants - 710; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G18310.2 | protein_coding | 5:6061298-6063372 | unclear | -18.741 | 235 | 266 | 596 | 564 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G54470.1 | protein_coding | 5:22114304-22115539 | unclear | -18.7261 | 75 | 106 | 526 | 495 | B-box type zinc finger family protein B-box type zinc finger family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: response to cold, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); B-box type zinc finger family protein (TAIR:AT4G27310.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G26000.1 | protein_coding | 3:9506778-9509302 | unclear | -18.6954 | 3125 | 3148 | 84 | 61 | Ribonuclease inhibitorRibonuclease inhibitor; RNI-like superfamily protein (TAIR:AT3G27290.1); Has 103 Blast hits to 103 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G37460.1 | protein_coding | 4:17608378-17615946 | unclear | -18.6713 | 2763 | 2805 | 3457 | 3417 | Tetratricopeptide repeat (TPR)-like superfamily protein Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. SUPPRESSOR OF RPS4-RLD 1 (SRFR1);FUNCTIONS IN: protein complex scaffold; INVOLVED IN: defense response to bacterium, incompatible interaction, defense response to bacterium, negative regulation of transcription, negative regulation of defense response; LOCATED IN: nucleus, perinuclear region of cytoplasm, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT3G04240.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G05987.1 | protein_coding | 5:1804697-1806850 | unclear | -18.662 | 43 | 96 | 97 | 44 | prenylated RAB acceptor 1.A2 prenylated RAB acceptor 1.A2 (PRA1.A2);CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); Cysteine/Histidine-rich C1 domain family protein (TAIR:AT3G11402.2); Has 291 Blast hits to 291 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 6; Plants - 119; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.5 | Ch1:12118990-12124001 | AT5G47060.1 | protein_coding | 5:19116719-19118744 | unclear | -18.644 | 2333 | 2372 | 471 | 423 | Protein ofunknown function (DUF581) Protein ofunknown function (DUF581);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF581 (InterPro:IPR007650); Protein ofunknown function (DUF581) (TAIR:AT4G17670.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT4G21560.1 | protein_coding | 4:11468666-11470569 | unclear | -18.63 | 2287 | 2317 | 249 | 208 | vacuolar protein sorting-associated protein 28 homolog 1 vacuolar protein sorting-associated protein 28 homolog 1 (VPS28-1);CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated, VPS28, N-terminal (InterPro:IPR017898), Vacuolar protein sorting-associated, VPS28, C-terminal (InterPro:IPR017899), Vacuolar protein sorting-associated, VPS28 (InterPro:IPR007143); Vacuolar protein sorting-associated protein VPS28 family protein (TAIR:AT4G05000.2); Has 388 Blast hits to 387 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 133; Fungi - 146; Plants - 72; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| XLOC_000642 | AT1G04933.2 | Ch1:4123641-4124165 | AT5G58070.1 | protein_coding | 5:23500061-23501416 | unclear | -18.63 | 748 | 768 | 495 | 475 | temperature-induced lipocalinEncodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. temperature-induced lipocalin (TIL);FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, response to cold, response to light stimulus, response to heat; LOCATED IN: mitochondrion, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Lipocalin, bacterial (InterPro:IPR002446), Lipocalin, ApoD type (InterPro:IPR022271), Lipocalin-like (InterPro:IPR013208), Lipocalin conserved site (InterPro:IPR022272), Calycin (InterPro:IPR012674), Calycin-like (InterPro:IPR011038); Has 2007 Blast hits to 1991 proteins in 692 species: Archae - 0; Bacteria - 1480; Metazoa - 169; Fungi - 10; Plants - 132; Viruses - 6; Other Eukaryotes - 210 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G41960.1 | protein_coding | 5:16789624-16791042 | unclear | -18.6111 | 1448 | 1467 | 138 | 119 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT3G04010.1 | protein_coding | 3:1036194-1039603 | unclear | -18.5848 | 167 | 203 | 1678 | 1645 | O-Glycosyl hydrolases family 17 protein O-Glycosyl hydrolases family 17 protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, LP.06 six leaves visible, M germinated pollen stage, LP.04 four leaves visible, 4 anthesis;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); O-Glycosyl hydrolases family 17 protein (TAIR:AT5G18220.1); Has 2719 Blast hits to 2656 proteins in 173 species: Archae - 0; Bacteria - 8; Metazoa - 5; Fungi - 96; Plants - 2598; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT1G64740.1 | protein_coding | 1:24050006-24052487 | unclear | -18.5751 | 557 | 601 | 1437 | 1397 | alpha-1 tubulin alpha-tubulin expressed primarily in stamens and mature pollen alpha-1 tubulin (TUA1);FUNCTIONS IN: structural constituent of cytoskeleton; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule cytoskeleton, cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Alpha tubulin (InterPro:IPR002452), Tubulin (InterPro:IPR000217), Tubulin/FtsZ, GTPase domain (InterPro:IPR003008), Tubulin/FtsZ, N-terminal (InterPro:IPR019746), Tubulin/FtsZ, C-terminal (InterPro:IPR008280), Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin, conserved site (InterPro:IPR017975), Tubulin/FtsZ, 2-layer sandwich domain (InterPro:IPR018316); tubulin alpha-5 (TAIR:AT5G19780.1); Has 22728 Blast hits to 22623 proteins in 4697 species: Archae - 12; Bacteria - 27; Metazoa - 4402; Fungi - 13423; Plants - 1534; Viruses - 0; Other Eukaryotes - 3330 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G01490.1 | protein_coding | 1:180017-182749 | unclear | -18.5697 | 959 | 997 | 545 | 491 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT1G63950.1); Has 7083 Blast hits to 3987 proteins in 399 species: Archae - 47; Bacteria - 875; Metazoa - 1731; Fungi - 337; Plants - 1157; Viruses - 96; Other Eukaryotes - 2840 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT5G16110.1 | protein_coding | 5:5260522-5262840 | unclear | -18.5309 | 2246 | 2300 | 319 | 274 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G02555.1); Has 133 Blast hits to 133 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 133; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G43980.1 | protein_coding | 5:17694680-17696690 | unclear | -18.5302 | 1867 | 1914 | 847 | 798 | plasmodesmata-located protein 1 Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The cytoplasmic C-terminal portion of the protein is connected to the apoplastic N-terminal portion of the protein by a single transmembrane domain (TMD). It is transported to the plasmodesmata through the secretory pathway. PDLP1 has two DUF26 domains and a signal peptide, but the proper localization of the protein appears to depend on the TMD. plasmodesmata-located protein 1 (PDLP1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF26 (InterPro:IPR002902); plasmodesmata-located protein 3 (TAIR:AT2G33330.1); Has 956 Blast hits to 914 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 956; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G05150.1 | protein_coding | 4:2660156-2662908 | unclear | -18.5286 | 33 | 62 | 86 | 58 | Octicosapeptide/Phox/Bem1p family proteinOcticosapeptide/Phox/Bem1p family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); Octicosapeptide/Phox/Bem1p family protein (TAIR:AT2G01190.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_013800 | AT3G11415.1 | Ch3:3588684-3589685 | AT4G03290.1 | protein_coding | 4:1442546-1443638 | unclear | -18.5222 | 155 | 199 | 434 | 392 | EF hand calcium-binding protein familyEF hand calcium-binding protein family;FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248); EF hand calcium-binding protein family (TAIR:AT1G05990.1); Has 24510 Blast hits to 17278 proteins in 1569 species: Archae - 2; Bacteria - 188; Metazoa - 10458; Fungi - 4683; Plants - 5334; Viruses - 0; Other Eukaryotes - 3845 (source: NCBI BLink). |
| XLOC_010840 | AT2G04285.1 | Ch2:763851-764640 | AT1G76920.1 | protein_coding | 1:28891976-28893721 | unclear | -18.4831 | 11 | 36 | 429 | 405 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Kelch repeat type 2 (InterPro:IPR011498); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT3G61590.2); Has 279 Blast hits to 279 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT2G28110.1 | protein_coding | 2:11977865-11980003 | unclear | -18.4753 | 90 | 140 | 77 | 25 | Exostosin family protein Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. FRAGILE FIBER 8 (FRA8);CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); FRA8 homolog (TAIR:AT5G22940.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G30800.1 | protein_coding | 2:13120292-13126813 | unclear | -18.4594 | 1355 | 1382 | 3153 | 3126 | helicase in vascular tissue and tapetum Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. helicase in vascular tissue and tapetum (HVT1);CONTAINS InterPro DOMAIN/s: Helicase-associated domain (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Domain ofunknown function DUF1605 (InterPro:IPR011709), Ankyrin repeat-containing domain (InterPro:IPR020683), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Single-stranded nucleic acid binding R3H (InterPro:IPR001374), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); nuclear DEIH-boxhelicase (TAIR:AT1G06670.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G32660.1 | protein_coding | 2:13853699-13856297 | unclear | -18.4592 | 45 | 93 | 2096 | 2051 | receptor like protein 22 receptor like protein 22 (RLP22);CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 27 (TAIR:AT2G33060.1); Has 72946 Blast hits to 23279 proteins in 925 species: Archae - 37; Bacteria - 3607; Metazoa - 12485; Fungi - 751; Plants - 51027; Viruses - 14; Other Eukaryotes - 5025 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G05020.2 | protein_coding | 4:2572427-2576599 | unclear | -18.4437 | 153 | 173 | 102 | 82 | NAD(P)H dehydrogenase B2 NAD(P)H dehydrogenase B2 (NDB2);FUNCTIONS IN: disulfide oxidoreductase activity, oxidoreductase activity, FAD binding, calcium ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: mitochondrion, extrinsic to mitochondrial inner membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), EF-Hand 1, calcium-binding site (InterPro:IPR018247), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048); NAD(P)H dehydrogenase B3 (TAIR:AT4G21490.1). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT2G32660.1 | protein_coding | 2:13853699-13856297 | unclear | -18.4432 | 1947 | 1992 | 2080 | 2044 | receptor like protein 22 receptor like protein 22 (RLP22);CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 27 (TAIR:AT2G33060.1); Has 72946 Blast hits to 23279 proteins in 925 species: Archae - 37; Bacteria - 3607; Metazoa - 12485; Fungi - 751; Plants - 51027; Viruses - 14; Other Eukaryotes - 5025 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G79270.1 | protein_coding | 1:29815470-29819678 | unclear | -18.3971 | 3661 | 3706 | 407 | 360 | evolutionarily conserved C-terminal region 8 evolutionarily conserved C-terminal region 8 (ECT8);CONTAINS InterPro DOMAIN/s: YTH domain (InterPro:IPR007275); evolutionarily conserved C-terminal region 6 (TAIR:AT3G17330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G61640.1 | protein_coding | 5:24774980-24776398 | unclear | -18.3957 | 2691 | 2753 | 58 | 4 | peptidemethionine sulfoxide reductase 1 ubiquitous enzyme that repairs oxidatively damaged proteinspeptidemethionine sulfoxide reductase 1 (PMSR1);FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: response to oxidative stress, protein modification process; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptide methionine sulphoxide reductase MsrA (InterPro:IPR002569); peptidemethionine sulfoxide reductase 3 (TAIR:AT5G07470.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G11360.1 | protein_coding | 4:6905848-6906856 | Unclear | -18.388 | 2776 | 2808 | 45 | 10 | RING-H2 finger A1B Encodes a putative RING-H2 finger protein RHA1b. RING-H2 finger A1B (RHA1B);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to cadmium ion, response to chitin; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING-H2 finger A1A (TAIR:AT4G11370.1); Has 7546 Blast hits to 7528 proteins in 261 species: Archae - 0; Bacteria - 0; Metazoa - 1890; Fungi - 589; Plants - 4122; Viruses - 19; Other Eukaryotes - 926 (source: NCBI BLink). |
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT1G32130.1 | protein_coding | 1:11558755-11561920 | unclear | -18.3753 | 311 | 343 | 441 | 406 | Transcription elongation factor (TFIIS) family protein The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. IWS1;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: brassinosteroid mediated signaling pathway, regulation of RNA elongation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor IIS, N-terminal (InterPro:IPR017923); Transcription elongation factor (TFIIS) family protein (TAIR:AT4G19000.1); Has 1384 Blast hits to 1350 proteins in 337 species: Archae - 10; Bacteria - 21; Metazoa - 458; Fungi - 242; Plants - 332; Viruses - 8; Other Eukaryotes - 313 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G24620.1 | protein_coding | 1:8723627-8724711 | unclear | -18.3748 | 1064 | 1102 | 637 | 599 | EF hand calcium-binding protein family Encodes a EF-hand calcium-binding protein family member. Mutants exhibit longer root hairs under phosphate-deficient conditions. EF hand calcium-binding protein family;FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248); Calcium-binding EF-hand family protein (TAIR:AT1G18210.2); Has 28159 Blast hits to 18576 proteins in 1591 species: Archae - 2; Bacteria - 225; Metazoa - 10723; Fungi - 6999; Plants - 5954; Viruses - 2; Other Eukaryotes - 4254 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT3G51540.1 | protein_coding | 3:19115184-19117461 | unclear | -18.3641 | 224 | 258 | 1151 | 1116 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G08670.1); Has 22744 Blast hits to 9965 proteins in 783 species: Archae - 64; Bacteria - 2760; Metazoa - 8515; Fungi - 3864; Plants - 499; Viruses - 702; Other Eukaryotes - 6340 (source: NCBI BLink). |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G20250.1 | protein_coding | 3:7058871-7063372 | unclear | -18.3576 | 138 | 181 | 1942 | 1901 | pumilio 5 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. pumilio 5 (PUM5);FUNCTIONS IN: RNA binding, binding; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding repeat (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); pumilio 6 (TAIR:AT4G25880.1); Has 4771 Blast hits to 2450 proteins in 259 species: Archae - 0; Bacteria - 10; Metazoa - 1074; Fungi - 1429; Plants - 1087; Viruses - 0; Other Eukaryotes - 1171 (source: NCBI BLink). |
| XLOC_025009 | AT5G02735.1 | Ch5:5755025-5755264 | AT2G36950.1 | protein_coding | 2:15514923-15517002 | unclear | -18.3427 | 219 | 238 | 973 | 953 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: copper ion binding, metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT5G03380.1); Has 2801 Blast hits to 1963 proteins in 260 species: Archae - 0; Bacteria - 269; Metazoa - 336; Fungi - 47; Plants - 1796; Viruses - 4; Other Eukaryotes - 349 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G55900.1 | protein_coding | 5:22637510-22639828 | unclear | -18.321 | 973 | 996 | 25 | 1 | Sucrase/ferredoxin-like family proteinSucrase/ferredoxin-like family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Sucraseferredoxin-like (InterPro:IPR009737), Thioredoxin-like fold (InterPro:IPR012336); Sucrase/ferredoxin-like family protein (TAIR:AT4G26620.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G17820.1 | protein_coding | 3:6097201-6099595 | Unclear | -18.3085 | 89 | 137 | 1069 | 1020 | glutamine synthetase 1.3Encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium glutamine synthetase 1.3 (GLN1.3);FUNCTIONS IN: glutamate-ammonia ligase activity, copper ion binding; INVOLVED IN: in 6 processes; LOCATED IN: cytosol, cytosolic ribosome, chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic domain (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic domain (InterPro:IPR014746); glutamine synthase clone R1 (TAIR:AT5G37600.1); Has 10255 Blast hits to 10251 proteins in 3319 species: Archae - 147; Bacteria - 5273; Metazoa - 413; Fungi - 249; Plants - 1750; Viruses - 3; Other Eukaryotes - 2420 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G01920.1 | protein_coding | 5:359107-361310 | unclear | -18.286 | 3669 | 3703 | 3255 | 3220 | Protein kinase superfamily protein Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2. STN8;FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: photosystem II stabilization; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); STN7 (Stt7 homolog STN7); kinase/ protein kinase (TAIR:AT1G68830.1); Has 33057 Blast hits to 33030 proteins in 1682 species: Archae - 26; Bacteria - 4053; Metazoa - 14243; Fungi - 4538; Plants - 3212; Viruses - 96; Other Eukaryotes - 6889 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G14320.1 | protein_coding | 5:4617218-4618981 | unclear | -18.2637 | 1448 | 1471 | 93 | 68 | Ribosomal protein S13/S18 family Ribosomal protein S13/S18 family;FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, bacterial-type (InterPro:IPR019980), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); Ribosomal protein S13/S18 family (TAIR:AT1G77750.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT5G06130.2 | protein_coding | 5:1853432-1855978 | unclear | -18.2471 | 262 | 288 | 190 | 163 | chaperone protein dnaJ-relatedchaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G61670.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT1G54160.1 | protein_coding | 1:20217336-20219452 | unclear | -18.2321 | 118 | 168 | 131 | 92 | nuclear factor Y, subunit A5 Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. "nuclear factor Y, subunit A5" (NF-YA5);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: response to water deprivation, negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); nuclear factor Y, subunit A6 (TAIR:AT3G14020.1); Has 683 Blast hits to 683 proteins in 160 species: Archae - 0; Bacteria - 0; Metazoa - 143; Fungi - 133; Plants - 381; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT1G11910.1 | protein_coding | 1:4016712-4021043 | unclear | -18.22 | 740 | 766 | 326 | 300 | aspartic proteinase A1 Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). aspartic proteinase A1 (APA1);FUNCTIONS IN: endopeptidase activity; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); Saposin-like aspartyl protease family protein (TAIR:AT1G62290.2); Has 7443 Blast hits to 5200 proteins in 420 species: Archae - 0; Bacteria - 2; Metazoa - 4134; Fungi - 1703; Plants - 675; Viruses - 0; Other Eukaryotes - 929 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT2G40810.1 | protein_coding | 2:17032412-17034600 | unclear | -18.2096 | 1089 | 1118 | 1351 | 1327 | homolog of yeast autophagy 18Chomolog of yeast autophagy 18C (ATG18C);CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); homolog of yeast autophagy 18 (ATG18) D (TAIR:AT3G56440.1); Has 1429 Blast hits to 1369 proteins in 244 species: Archae - 0; Bacteria - 43; Metazoa - 558; Fungi - 432; Plants - 215; Viruses - 2; Other Eukaryotes - 179 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G59950.5 | protein_coding | 5:24139939-24141937 | unclear | -18.2072 | 309 | 390 | 940 | 873 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT5G02530.2). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G76820.1 | nontranslating_CDS | 1:28837573-28842566 | unclear | -18.1941 | 48 | 94 | 1586 | 1548 | eukaryotic translation initiation factor 2 (eIF-2) family proteineukaryotic translation initiation factor 2 (eIF-2) family protein;FUNCTIONS IN: GTP binding, GTPase activity; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: sperm cell, male gametophyte; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation initiation factor 2 related (InterPro:IPR015760), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation/initiation factor/Ribosomal, beta-barrel (InterPro:IPR009000); eukaryotic translation initiation factor 2 (eIF-2) family protein (TAIR:AT1G76720.1); Has 81525 Blast hits to 72045 proteins in 3821 species: Archae - 1058; Bacteria - 36272; Metazoa - 16881; Fungi - 5065; Plants - 2256; Viruses - 195; Other Eukaryotes - 19798 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G23680.1 | protein_coding | 4:12336134-12337599 | unclear | -18.1699 | 1252 | 1286 | 574 | 536 | Polyketide cyclase/dehydrase and lipid transport superfamily protein Polyketide cyclase/dehydrase and lipid transport superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); Polyketide cyclase/dehydrase and lipid transport superfamily protein (TAIR:AT4G23670.1); Has 354 Blast hits to 327 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 354; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G44770.1 | protein_coding | 1:16907537-16909572 | unclear | -18.1506 | 1236 | 1272 | 187 | 165 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G49710.3); Has 81 Blast hits to 81 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G17705.1 | protein_coding | 2:7692396-7693253 | unclear | -18.1342 | 58 | 96 | 40 | 1 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G08330.1); Has 135 Blast hits to 135 proteins in 32 species: Archae - 5; Bacteria - 29; Metazoa - 0; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G17145.1 | protein_coding | 1:5860078-5862890 | unclear | -18.1005 | 23 | 73 | 640 | 593 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT1G78420.2); Has 249 Blast hits to 247 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 148; Plants - 77; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT4G34990.1 | protein_coding | 4:16661101-16662549 | unclear | -18.0602 | 1013 | 1042 | 31 | 2 | myb domain protein 32 Member of the R2R3 factor gene family. myb domain protein 32 (MYB32);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 7 (TAIR:AT2G16720.1); Has 9023 Blast hits to 8385 proteins in 476 species: Archae - 0; Bacteria - 0; Metazoa - 680; Fungi - 473; Plants - 6077; Viruses - 3; Other Eukaryotes - 1790 (source: NCBI BLink). |
| XLOC_000417 | AT1G04647.1 | Ch1:2620439-2621546 | AT4G32920.1 | protein_coding | 4:15887270-15896345 | unclear | -18.054 | 151 | 186 | 2239 | 2196 | glycine-rich protein glycine-rich protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G11700.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT4G33040.1 | protein_coding | 4:15940228-15941493 | unclear | -18.0433 | 3352 | 3411 | 208 | 161 | Thioredoxin superfamily protein Thioredoxin superfamily protein;FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glutaredoxin-like, plant II (InterPro:IPR011905), Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); Thioredoxin superfamily protein (TAIR:AT5G11930.1); Has 1149 Blast hits to 1147 proteins in 175 species: Archae - 0; Bacteria - 20; Metazoa - 257; Fungi - 124; Plants - 712; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G57010.1 | protein_coding | 5:23067828-23070431 | unclear | -18.0195 | 52 | 84 | 384 | 349 | calmodulin-binding family proteincalmodulin-binding family protein;CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); calmodulin-binding family protein (TAIR:AT4G33050.3); Has 390 Blast hits to 271 proteins in 57 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 100; Plants - 264; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT5G47880.1 | protein_coding | 5:19386045-19388587 | unclear | -17.9902 | 31 | 53 | 1197 | 1176 | eukaryotic release factor 1-1Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. eukaryotic release factor 1-1 (ERF1-1);FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF1/aRF1 (InterPro:IPR004403); eukaryotic release factor 1-3 (TAIR:AT3G26618.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_028301 | AT5G02095.1 | Ch5:4341236-4341690 | AT1G76580.1 | protein_coding | 1:28734207-28738967 | unclear | -17.985 | 69 | 103 | 74 | 34 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); squamosa promoter binding protein-like 14 (TAIR:AT1G20980.1); Has 4275 Blast hits to 1172 proteins in 134 species: Archae - 0; Bacteria - 31; Metazoa - 161; Fungi - 128; Plants - 962; Viruses - 0; Other Eukaryotes - 2993 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G62600.1 | protein_coding | 5:25122803-25132716 | unclear | -17.9817 | 1348 | 1384 | 3132 | 3095 | ARM repeat superfamily protein Encodes a nuclear importer of serine-arginine rich (SR) proteins and is involved in the regulation of splicing of R genes by regulating the import of the SR proteins into the nucleus. ARM repeat superfamily protein;FUNCTIONS IN: binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Exportin-1/Importin-beta-like (InterPro:IPR013598), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT1G12930.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT1G49850.1 | protein_coding | 1:18454844-18456619 | unclear | -17.9798 | 810 | 836 | 32 | 1 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G15580.1); Has 9155 Blast hits to 9129 proteins in 266 species: Archae - 0; Bacteria - 4; Metazoa - 2526; Fungi - 625; Plants - 4723; Viruses - 8; Other Eukaryotes - 1269 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT5G65600.1 | protein_coding | 5:26215991-26218623 | unclear | -17.9545 | 185 | 245 | 1726 | 1665 | Concanavalin A-like lectin protein kinase family protein Concanavalin A-like lectin protein kinase family protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: stem;CONTAINS InterPro DOMAIN/s: Legume lectin, beta chain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); Concanavalin A-like lectin protein kinase family protein (TAIR:AT5G10530.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT2G47000.1 | protein_coding | 2:19309643-19315343 | unclear | -17.9425 | 359 | 382 | 256 | 219 | ATP binding cassette subfamily B4 Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters.FUNCTIONS in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. ATP binding cassette subfamily B4 (ABCB4);FUNCTIONS IN: xenobiotic-transporting ATPase activity, ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: in 8 processes; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); P-glycoprotein 21 (TAIR:AT3G62150.1); Has 844144 Blast hits to 390751 proteins in 4168 species: Archae - 14748; Bacteria - 659498; Metazoa - 17847; Fungi - 13026; Plants - 10001; Viruses - 45; Other Eukaryotes - 128979 (source: NCBI BLink). |
| XLOC_025009 | AT5G02735.1 | Ch5:5755025-5755264 | AT4G20260.4 | protein_coding | 4:10940414-10943561 | unclear | -17.9316 | 218 | 236 | 719 | 701 | plasma-membrane associated cation-binding protein 1Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. plasma-membrane associated cation-binding protein 1 (PCAP1);FUNCTIONS IN: calmodulin binding, copper ion binding, phosphatidylinositol-3,4,5-trisphosphate binding, phosphatidylinositol-3,5-bisphosphate binding, calcium ion binding; INVOLVED IN: response to cold, N-terminal peptidyl-glycine N-myristoylation, defense response to bacterium; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 35 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: DREPP plasma membrane polypeptide (InterPro:IPR008469); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_025009 | AT5G02735.1 | Ch5:5755025-5755264 | AT2G44430.1 | protein_coding | 2:18333370-18336364 | unclear | -17.9215 | 221 | 239 | 34 | 16 | DNA-binding bromodomain-containing protein DNA-binding bromodomain-containing protein;FUNCTIONS IN: DNA binding; EXPRESSED IN: stem, male gametophyte, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Bromodomain (InterPro:IPR001487), MYB-like (InterPro:IPR017877); DNA-binding bromodomain-containing protein (TAIR:AT3G60110.1); Has 27183 Blast hits to 17808 proteins in 1233 species: Archae - 48; Bacteria - 2443; Metazoa - 11960; Fungi - 2852; Plants - 1222; Viruses - 306; Other Eukaryotes - 8352 (source: NCBI BLink). |
| XLOC_000417 | AT1G04647.1 | Ch1:2620439-2621546 | AT2G28400.1 | protein_coding | 2:12147883-12149072 | unclear | -17.9165 | 721 | 738 | 128 | 111 | Protein ofunknown function, DUF584 Protein ofunknown function, DUF584;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF584 (InterPro:IPR007608); Protein ofunknown function, DUF584 (TAIR:AT3G45210.1); Has 318 Blast hits to 318 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 318; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT5G58350.1 | protein_coding | 5:23584789-23587801 | unclear | -17.8956 | 130 | 151 | 2342 | 2320 | with no lysine (K) kinase 4Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. with no lysine (K) kinase 4 (WNK4);FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); with no lysine (K) kinase 5 (TAIR:AT3G51630.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G11900.1 | protein_coding | 3:3758452-3760751 | unclear | -17.8662 | 1350 | 1390 | 361 | 327 | aromatic and neutral transporter 1 encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. aromatic and neutral transporter 1 (ANT1);CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); Transmembrane amino acid transporter family protein (TAIR:AT4G38250.1); Has 4625 Blast hits to 4600 proteins in 287 species: Archae - 17; Bacteria - 63; Metazoa - 1652; Fungi - 791; Plants - 1313; Viruses - 9; Other Eukaryotes - 780 (source: NCBI BLink). |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G18310.2 | protein_coding | 5:6061298-6063372 | unclear | -17.8583 | 672 | 697 | 253 | 223 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT3G14200.1 | protein_coding | 3:4712574-4714698 | unclear | -17.8202 | 322 | 361 | 920 | 871 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Chaperone DnaJ-domain superfamily protein (TAIR:AT1G72416.2); Has 21914 Blast hits to 21906 proteins in 3169 species: Archae - 155; Bacteria - 8965; Metazoa - 3686; Fungi - 1997; Plants - 2132; Viruses - 13; Other Eukaryotes - 4966 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G30800.1 | protein_coding | 2:13120292-13126813 | unclear | -17.8073 | 24 | 57 | 3155 | 3126 | helicase in vascular tissue and tapetum Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. helicase in vascular tissue and tapetum (HVT1);CONTAINS InterPro DOMAIN/s: Helicase-associated domain (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Domain ofunknown function DUF1605 (InterPro:IPR011709), Ankyrin repeat-containing domain (InterPro:IPR020683), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Single-stranded nucleic acid binding R3H (InterPro:IPR001374), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); nuclear DEIH-boxhelicase (TAIR:AT1G06670.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT2G30140.1 | protein_coding | 2:12871984-12873866 | unclear | -17.7968 | 1970 | 2008 | 1332 | 1291 | UDP-Glycosyltransferase superfamily proteinEncodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. UDP-Glycosyltransferase superfamily protein;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT2G30150.1); Has 7945 Blast hits to 7893 proteins in 488 species: Archae - 0; Bacteria - 512; Metazoa - 2235; Fungi - 27; Plants - 5022; Viruses - 79; Other Eukaryotes - 70 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G28190.1 | protein_coding | 1:9846747-9848015 | unclear | -17.794 | 252 | 287 | 56 | 23 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G12340.1); Has 166 Blast hits to 162 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 15; Fungi - 5; Plants - 124; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G07750.1 | protein_coding | 1:2403992-2406049 | unclear | -17.743 | 971 | 996 | 55 | 19 | RmlC-like cupins superfamily protein RmlC-like cupins superfamily protein;FUNCTIONS IN: copper ion binding, zinc ion binding, nutrient reservoir activity; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S seed storage protein, plant (InterPro:IPR006044); RmlC-like cupins superfamily protein (TAIR:AT2G28680.1); Has 920 Blast hits to 832 proteins in 102 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 0; Plants - 914; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT2G46270.1 | protein_coding | 2:19000180-19003403 | unclear | -17.7388 | 54 | 89 | 1567 | 1516 | G-box binding factor 3 encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh thatCONTAINS the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3??s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. G-box binding factor 3 (GBF3);CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), G-box binding, MFMR (InterPro:IPR012900), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); G-box binding factor 2 (TAIR:AT4G01120.1); Has 2267 Blast hits to 2266 proteins in 215 species: Archae - 0; Bacteria - 77; Metazoa - 736; Fungi - 40; Plants - 1305; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink). |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT2G30550.2 | protein_coding | 2:13014530-13017329 | unclear | -17.7271 | 0 | 24 | 1401 | 1377 | alpha/beta-Hydrolases superfamily protein Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. alpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: galactolipase activity, triglyceride lipase activity, phospholipase A1 activity; INVOLVED IN: lipid metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); alpha/beta-Hydrolases superfamily protein (TAIR:AT1G06800.1); Has 1575 Blast hits to 1566 proteins in 299 species: Archae - 0; Bacteria - 279; Metazoa - 58; Fungi - 303; Plants - 685; Viruses - 3; Other Eukaryotes - 247 (source: NCBI BLink). |
| XLOC_024650 | AT5G01765.1 | Ch5:3332631-3334971 | AT2G40170.1 | protein_coding | 2:16779552-16780368 | unclear | -17.7165 | 241 | 273 | 236 | 202 | Stress induced protein Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of dessication tolerance and rate of water loss during seed maturation. LATE EMBRYOGENESIS ABUNDANT 6 (GEA6);CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 5, conserved site (InterPro:IPR022377), Stress induced protein (InterPro:IPR000389); Stress induced protein (TAIR:AT3G51810.1); Has 212 Blast hits to 184 proteins in 37 species: Archae - 0; Bacteria - 6; Metazoa - 17; Fungi - 0; Plants - 189; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_028190 | AT5G01865.1 | Ch5:3574666-3574970 | AT5G11650.1 | protein_coding | 5:3744698-3747198 | unclear | -17.678 | 13 | 75 | 225 | 173 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; alpha/beta-Hydrolases superfamily protein (TAIR:AT1G73480.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G26940.1 | protein_coding | 5:9480308-9482818 | unclear | -17.6455 | 1862 | 1887 | 117 | 92 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein Encodes a Mg2+-dependent DNA exonuclease that degrades organelle DNA during Arabidopsis pollen development.Polynucleotidyl transferase, ribonuclease H-like superfamily protein;FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T/DNA polymerase III (InterPro:IPR013520); Has 3712 Blast hits to 3712 proteins in 1305 species: Archae - 2; Bacteria - 3079; Metazoa - 40; Fungi - 0; Plants - 53; Viruses - 4; Other Eukaryotes - 534 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT4G39910.1 | protein_coding | 4:18511521-18514382 | unclear | -17.6428 | 2294 | 2338 | 1465 | 1420 | ubiquitin-specific protease 3Encodes a nuclear ubiquitin-specific protease. ubiquitin-specific protease 3 (UBP3);CONTAINS InterPro DOMAIN/s: Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (InterPro:IPR018200), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); ubiquitin-specific protease 4 (TAIR:AT2G22310.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G35480.1 | protein_coding | 4:16851972-16853035 | unclear | -17.6283 | 3585 | 3633 | 696 | 646 | RING-H2 finger A3B Encodes a putative RING-H2 finger protein RHA3b. RING-H2 finger A3B (RHA3B);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING-H2 finger A3A (TAIR:AT2G17450.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_011469 | AT2G07225.1 | Ch2:8447744-8448283 | AT3G24290.1 | protein_coding | 3:8801400-8802890 | unclear | -17.6264 | 64 | 93 | 391 | 360 | ammonium transporter 1;5 ammonium transporter 1;5 (AMT1;5);FUNCTIONS IN: ammonium transmembrane transporter activity; INVOLVED IN: ammonium transport, transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: root epidermis, root hair, root tip;CONTAINS InterPro DOMAIN/s: Ammonium transporter (InterPro:IPR001905), Ammonium transporter, conserved site (InterPro:IPR018047); ammonium transporter 1;3 (TAIR:AT3G24300.1); Has 11447 Blast hits to 11429 proteins in 2045 species: Archae - 224; Bacteria - 4622; Metazoa - 402; Fungi - 429; Plants - 468; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| XLOC_025009 | AT5G02735.1 | Ch5:5755025-5755264 | AT1G18860.1 | protein_coding | 1:6508797-6511397 | unclear | -17.5941 | 68 | 93 | 292 | 267 | WRKY DNA-binding protein 61member of WRKY Transcription Factor; Group II-b WRKY DNA-binding protein 61 (WRKY61);CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657); WRKY DNA-binding protein 72 (TAIR:AT5G15130.1); Has 5252 Blast hits to 3559 proteins in 289 species: Archae - 0; Bacteria - 31; Metazoa - 146; Fungi - 97; Plants - 3463; Viruses - 1; Other Eukaryotes - 1514 (source: NCBI BLink). |
| XLOC_025009 | AT5G02735.1 | Ch5:5755025-5755264 | AT2G35290.1 | protein_coding | 2:14861199-14862178 | unclear | -17.5852 | 191 | 212 | 168 | 145 | unknown protein; Has 39 Blast hits to 39 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G23010.3 | protein_coding | 4:12060131-12062858 | unclear | -17.5828 | 2946 | 2972 | 162 | 117 | UDP-galactose transporter 2 UDP-galactose transporter 2 (UTR2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: transmembrane transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); UDP-N-acetylglucosamine (UAA) transporter family (TAIR:AT1G12600.1). |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT3G08860.1 | protein_coding | 3:2696199-2699420 | unclear | -17.5739 | 1012 | 1031 | 34 | 15 | PYRIMIDINE 4 Encodes a protein that is predicted to have beta-alanine aminotransferase activity.PYRIMIDINE 4 (PYD4);FUNCTIONS IN: pyridoxal phosphate binding, transaminase activity, catalytic activity, alanine-glyoxylate transaminase activity; INVOLVED IN: cellular response to nitrogen levels; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis;CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); alanine:glyoxylate aminotransferase 3 (TAIR:AT2G38400.1); Has 35951 Blast hits to 35930 proteins in 2736 species: Archae - 736; Bacteria - 23081; Metazoa - 661; Fungi - 840; Plants - 399; Viruses - 17; Other Eukaryotes - 10217 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G44060.1 | protein_coding | 5:17731005-17732298 | unclear | -17.5696 | 2774 | 2805 | 64 | 41 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G04000.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G17240.1 | protein_coding | 1:5896385-5898931 | unclear | -17.4771 | 3349 | 3406 | 388 | 332 | receptor like protein 2 Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. receptor like protein 2 (RLP2);CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); Leucine-rich receptor-like protein kinase family protein (TAIR:AT1G72300.1); Has 90767 Blast hits to 27052 proteins in 1087 species: Archae - 40; Bacteria - 7835; Metazoa - 18686; Fungi - 1120; Plants - 55519; Viruses - 2; Other Eukaryotes - 7565 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G41360.1 | protein_coding | 5:16544333-16549327 | unclear | -17.472 | 1865 | 1902 | 1442 | 1404 | homolog of Xeroderma pigmentosum complementation group B 2 Encodes XPB2, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. homolog of Xeroderma pigmentosum complementation group B 2 (XPB2);FUNCTIONS IN: in 7FUNCTIONS; INVOLVED IN: response to UV-B, N-terminal protein myristoylation; EXPRESSED IN: whole plant; EXPRESSED DURING: seedling growth;CONTAINS InterPro DOMAIN/s: Restriction endonuclease, type I, R subunit/Type III, Res subunit (InterPro:IPR006935), DEAD-like helicase, N-terminal (InterPro:IPR014001), Xeroderma pigmentosum group B protein (XP-B) (InterPro:IPR001161), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); homolog of xeroderma pigmentosum complementation group B 1 (TAIR:AT5G41370.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.3 | Ch3:23422590-23425169 | AT2G33480.1 | protein_coding | 2:14180978-14182439 | unclear | -17.4579 | 747 | 770 | 651 | 628 | NAC domain containing protein 41 NAC domain containing protein 41 (NAC041);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 83 (TAIR:AT5G13180.1); Has 3047 Blast hits to 3036 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 3023; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G50960.1 | protein_coding | 5:20734136-20736138 | unclear | -17.4309 | 232 | 263 | 1174 | 1147 | nucleotide binding protein 35 Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. nucleotide binding protein 35 (NBP35);CONTAINS InterPro DOMAIN/s: Mrp, conserved site (InterPro:IPR000808), ATPase-like, ParA/MinD (InterPro:IPR019591); IND1(iron-sulfur protein required for NADH dehydrogenase)-like (TAIR:AT4G19540.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT2G42500.1 | protein_coding | 2:17697626-17701417 | unclear | -17.4244 | 27 | 62 | 78 | 38 | protein phosphatase 2A-3Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. protein phosphatase 2A-3 (PP2A-3);FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_processunknown; LOCATED IN: nucleus, plasma membrane, cytoplasm; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (InterPro:IPR006186); protein phosphatase 2A-4 (TAIR:AT3G58500.1); Has 6823 Blast hits to 6634 proteins in 485 species: Archae - 80; Bacteria - 208; Metazoa - 2397; Fungi - 1409; Plants - 992; Viruses - 2; Other Eukaryotes - 1735 (source: NCBI BLink). |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT1G70590.1 | protein_coding | 1:26618099-26620421 | unclear | -17.41 | 342 | 374 | 568 | 539 | F-box family protein F-box family protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Sel1-like (InterPro:IPR006597); HCP-like superfamily protein (TAIR:AT1G18260.1); Has 16059 Blast hits to 6577 proteins in 1289 species: Archae - 0; Bacteria - 11525; Metazoa - 502; Fungi - 723; Plants - 391; Viruses - 15; Other Eukaryotes - 2903 (source: NCBI BLink). |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT1G28190.1 | protein_coding | 1:9846747-9848015 | unclear | -17.4089 | 254 | 274 | 802 | 782 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G12340.1); Has 166 Blast hits to 162 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 15; Fungi - 5; Plants - 124; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G52400.1 | protein_coding | 3:19425632-19427230 | unclear | -17.4029 | 258 | 290 | 549 | 514 | syntaxin of plants 122 syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway syntaxin of plants 122 (SYP122);FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: in 9 processes; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil domain (InterPro:IPR000727), t-SNARE (InterPro:IPR010989), Syntaxin/epimorphin, conserved site (InterPro:IPR006012), Syntaxin, N-terminal (InterPro:IPR006011); syntaxin of plants 121 (TAIR:AT3G11820.2); Has 2448 Blast hits to 2448 proteins in 275 species: Archae - 5; Bacteria - 34; Metazoa - 1056; Fungi - 527; Plants - 461; Viruses - 0; Other Eukaryotes - 365 (source: NCBI BLink). |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT1G50640.1 | protein_coding | 1:18756972-18758708 | unclear | -17.3644 | 474 | 524 | 101 | 54 | ethylene responsive element binding factor 3 Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-3). The proteinCONTAINS one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. ethylene responsive element binding factor 3 (ERF3);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); ethylene response factor 7 (TAIR:AT3G20310.1); Has 5989 Blast hits to 5713 proteins in 252 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 5972; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| XLOC_025053 | AT5G18255.1 | Ch5:6035619-6037641 | AT5G61370.1 | protein_coding | 5:24671770-24673657 | unclear | -17.3461 | 315 | 358 | 1614 | 1574 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G60960.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G25220.1 | protein_coding | 5:8735944-8738601 | unclear | -17.3419 | 92 | 136 | 1557 | 1515 | KNOTTED1-like homeobox gene 3 A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia KNOTTED1-like homeobox gene 3 (KNAT3);FUNCTIONS IN: transcription activator activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to light stimulus, detection of cytokinin stimulus, cellular response to cytokine stimulus; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 35 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ELK (InterPro:IPR005539), Homeobox (InterPro:IPR001356), KNOX1 (InterPro:IPR005540), Homeodomain-like (InterPro:IPR009057), KNOX2 (InterPro:IPR005541), Homeodomain-related (InterPro:IPR012287); KNOTTED1-like homeobox gene 4 (TAIR:AT5G11060.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G54380.1 | protein_coding | 3:20133893-20137007 | unclear | -17.3061 | 153 | 174 | 89 | 68 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family SAC3/GANP/Nin1/mts3/eIF-3 p25 family;CONTAINS InterPro DOMAIN/s: SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); SAC3/GANP/Nin1/mts3/eIF-3 p25 family (TAIR:AT3G06290.1); Has 539 Blast hits to 535 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 200; Plants - 96; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G15860.3 | protein_coding | 1:5454766-5457022 | unclear | -17.2949 | 3656 | 3685 | 106 | 75 | Domain ofunknown function (DUF298) INVOLVED IN: biological_processunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Defective-in-cullin neddylation protein (InterPro:IPR014764), Protein ofunknown function DUF298 (InterPro:IPR005176); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G12760.1). |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT5G53920.1 | protein_coding | 5:21891983-21894267 | unclear | -17.2884 | 632 | 671 | 167 | 117 | ribosomal protein L11 methyltransferase-related ribosomal protein L11 methyltransferase-related;FUNCTIONS IN: protein methyltransferase activity; INVOLVED IN: protein amino acid methylation; LOCATED IN: cytoplasm;CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 methyltransferase (InterPro:IPR004498), Ribosomal L11 methyltransferase, PrmA (InterPro:IPR010456); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT5G58730.1 | protein_coding | 5:23723404-23725585 | unclear | -17.276 | 91 | 113 | 1058 | 1034 | pfkB-like carbohydrate kinase family protein pfkB-like carbohydrate kinase family protein;CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611), Carbohydrate/puine kinase, PfkB, conserved site (InterPro:IPR002173); pfkB-like carbohydrate kinase family protein (TAIR:AT4G10260.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT4G12610.2 | protein_coding | 4:7454722-7458422 | unclear | -17.2684 | 1071 | 1101 | 1120 | 1091 | transcription activators;DNA binding;RNA polymerase II transcription factors;catalytics;transcription initiation factors RAP74;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity, DNA binding, transcription activator activity, catalytic activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: shoot, root, guard cell;CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIF, alpha subunit (InterPro:IPR008851), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039); Has 34394 Blast hits to 22751 proteins in 1168 species: Archae - 120; Bacteria - 4390; Metazoa - 12539; Fungi - 6082; Plants - 2082; Viruses - 445; Other Eukaryotes - 8736 (source: NCBI BLink). |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT1G70590.1 | protein_coding | 1:26618099-26620421 | unclear | -17.2568 | 1063 | 1096 | 573 | 539 | F-box family protein F-box family protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Sel1-like (InterPro:IPR006597); HCP-like superfamily protein (TAIR:AT1G18260.1); Has 16059 Blast hits to 6577 proteins in 1289 species: Archae - 0; Bacteria - 11525; Metazoa - 502; Fungi - 723; Plants - 391; Viruses - 15; Other Eukaryotes - 2903 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT3G52620.1 | protein_coding | 3:19513044-19513822 | unclear | -17.2126 | 153 | 183 | 195 | 162 | unknown protein; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G55820.1 | protein_coding | 3:20713709-20714825 | unclear | -17.195 | 230 | 251 | 967 | 946 | Fasciclin-like arabinogalactan family protein Fasciclin-like arabinogalactan family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G17220.1 | protein_coding | 2:7487646-7490199 | unclear | -17.1746 | 3125 | 3147 | 27 | 4 | Protein kinase superfamily protein Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G76360.1); Has 115099 Blast hits to 113649 proteins in 4159 species: Archae - 97; Bacteria - 13440; Metazoa - 42787; Fungi - 9395; Plants - 32648; Viruses - 351; Other Eukaryotes - 16381 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G17340.1 | protein_coding | 1:5933780-5938817 | unclear | -17.1539 | 1241 | 1262 | 2852 | 2831 | Phosphoinositide phosphatase family protein Phosphoinositide phosphatase family protein;CONTAINS InterPro DOMAIN/s: Synaptojanin, N-terminal (InterPro:IPR002013); Phosphoinositide phosphatase family protein (TAIR:AT3G14205.1); Has 1726 Blast hits to 1665 proteins in 230 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 579; Plants - 272; Viruses - 0; Other Eukaryotes - 294 (source: NCBI BLink). |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT5G54780.1 | protein_coding | 5:22248369-22252191 | unclear | -17.141 | 1040 | 1082 | 72 | 34 | Ypt/Rab-GAP domain of gyp1p superfamily protein Ypt/Rab-GAP domain of gyp1p superfamily protein;FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT4G27100.2); Has 4120 Blast hits to 4004 proteins in 231 species: Archae - 0; Bacteria - 0; Metazoa - 2315; Fungi - 731; Plants - 615; Viruses - 0; Other Eukaryotes - 459 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G19950.1 | protein_coding | 3:6942623-6945224 | unclear | -17.1357 | 313 | 338 | 677 | 652 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT1G55530.1); Has 11106 Blast hits to 11075 proteins in 297 species: Archae - 0; Bacteria - 6; Metazoa - 2940; Fungi - 1152; Plants - 5266; Viruses - 73; Other Eukaryotes - 1669 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT2G36880.1 | protein_coding | 2:15479281-15481412 | unclear | -17.131 | 2776 | 2799 | 99 | 73 | methionine adenosyltransferase 3 methionine adenosyltransferase 3 (MAT3);FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133), S-adenosylmethionine synthetase superfamily (InterPro:IPR022636), S-adenosylmethionine synthetase, N-terminal (InterPro:IPR022628), S-adenosylmethionine synthetase, C-terminal (InterPro:IPR022630), S-adenosylmethionine synthetase, conserved site (InterPro:IPR022631), S-adenosylmethionine synthetase, central domain (InterPro:IPR022629); S-adenosylmethionine synthetase family protein (TAIR:AT3G17390.1); Has 10904 Blast hits to 10897 proteins in 2898 species: Archae - 12; Bacteria - 5503; Metazoa - 373; Fungi - 167; Plants - 705; Viruses - 1; Other Eukaryotes - 4143 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT2G27310.1 | protein_coding | 2:11683772-11685342 | unclear | -17.1047 | 50 | 107 | 919 | 842 | F-box family protein F-box family protein; F-box family protein (TAIR:AT2G36090.1); Has 105 Blast hits to 105 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G12610.2 | protein_coding | 4:7454722-7458422 | unclear | -17.0975 | 48 | 98 | 1120 | 1065 | transcription activators;DNA binding;RNA polymerase II transcription factors;catalytics;transcription initiation factors RAP74;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity, DNA binding, transcription activator activity, catalytic activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: shoot, root, guard cell;CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIF, alpha subunit (InterPro:IPR008851), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039); Has 34394 Blast hits to 22751 proteins in 1168 species: Archae - 120; Bacteria - 4390; Metazoa - 12539; Fungi - 6082; Plants - 2082; Viruses - 445; Other Eukaryotes - 8736 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT2G47000.1 | protein_coding | 2:19309643-19315343 | unclear | -17.0741 | 1863 | 1880 | 44 | 27 | ATP binding cassette subfamily B4 Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters.FUNCTIONS in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. ATP binding cassette subfamily B4 (ABCB4);FUNCTIONS IN: xenobiotic-transporting ATPase activity, ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: in 8 processes; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); P-glycoprotein 21 (TAIR:AT3G62150.1); Has 844144 Blast hits to 390751 proteins in 4168 species: Archae - 14748; Bacteria - 659498; Metazoa - 17847; Fungi - 13026; Plants - 10001; Viruses - 45; Other Eukaryotes - 128979 (source: NCBI BLink). |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT5G66760.1 | protein_coding | 5:26653607-26657696 | unclear | -17.0468 | 221 | 238 | 1931 | 1914 | succinate dehydrogenase 1-1One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. succinate dehydrogenase 1-1 (SDH1-1);FUNCTIONS IN: cobalt ion binding, succinate dehydrogenase activity, ATP binding; INVOLVED IN: mitochondrial electron transport, succinate to ubiquinone; LOCATED IN: mitochondrial respiratory chain complex II, mitochondrion, cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: Succinate dehydrogenase, flavoprotein subunit (InterPro:IPR011281), Fumarate reductase/succinate dehydrogenase, FAD-binding site (InterPro:IPR003952), Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (InterPro:IPR015939), Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (InterPro:IPR003953), Succinate dehydrogenase/fumarate reductase, flavoprotein subunit (InterPro:IPR014006), Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (InterPro:IPR004112); succinate dehydrogenase 1-2 (TAIR:AT2G18450.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT5G25220.1 | protein_coding | 5:8735944-8738601 | unclear | -17.0385 | 183 | 211 | 387 | 362 | KNOTTED1-like homeobox gene 3 A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia KNOTTED1-like homeobox gene 3 (KNAT3);FUNCTIONS IN: transcription activator activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to light stimulus, detection of cytokinin stimulus, cellular response to cytokine stimulus; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 35 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ELK (InterPro:IPR005539), Homeobox (InterPro:IPR001356), KNOX1 (InterPro:IPR005540), Homeodomain-like (InterPro:IPR009057), KNOX2 (InterPro:IPR005541), Homeodomain-related (InterPro:IPR012287); KNOTTED1-like homeobox gene 4 (TAIR:AT5G11060.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G32260.1 | protein_coding | 2:13697457-13700648 | unclear | -17.0239 | 235 | 264 | 1093 | 1062 | phosphorylcholine cytidylyltransferasephosphorylcholine cytidylyltransferase (CCT1);CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cytidyltransferase-related (InterPro:IPR004821), Cytidylyltransferase (InterPro:IPR004820); phosphorylcholine cytidylyltransferase2 (TAIR:AT4G15130.1); Has 2466 Blast hits to 2109 proteins in 632 species: Archae - 27; Bacteria - 791; Metazoa - 538; Fungi - 333; Plants - 250; Viruses - 5; Other Eukaryotes - 522 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT5G15500.2 | protein_coding | 5:5031648-5033540 | unclear | -17.0184 | 2184 | 2217 | 764 | 730 | Ankyrin repeat family protein Ankyrin repeat family protein;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Ankyrin repeat family protein (TAIR:AT4G10720.1); Has 18283 Blast hits to 10029 proteins in 436 species: Archae - 21; Bacteria - 1142; Metazoa - 9586; Fungi - 1012; Plants - 1920; Viruses - 51; Other Eukaryotes - 4551 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G52660.2 | protein_coding | 5:21359001-21362273 | unclear | -17.0158 | 2337 | 2355 | 519 | 496 | Homeodomain-like superfamily protein Homeodomain-like superfamily protein;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); Homeodomain-like superfamily protein (TAIR:AT4G01280.1); Has 1360 Blast hits to 1350 proteins in 120 species: Archae - 0; Bacteria - 4; Metazoa - 93; Fungi - 8; Plants - 1059; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT3G55880.2 | protein_coding | 3:20736508-20738967 | unclear | -16.9835 | 632 | 656 | 243 | 220 | Alpha/beta hydrolase related protein A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance.Alpha/beta hydrolase related protein; Alpha/beta hydrolase related protein (TAIR:AT2G40095.1); Has 87 Blast hits to 87 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G02460.1 | protein_coding | 3:505434-508723 | unclear | -16.9817 | 57 | 102 | 712 | 666 | Ypt/Rab-GAP domain of gyp1p superfamily protein Ypt/Rab-GAP domain of gyp1p superfamily protein;FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); plant adhesion molecule 1 (TAIR:AT5G15930.1); Has 5276 Blast hits to 5263 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 2708; Fungi - 1087; Plants - 526; Viruses - 0; Other Eukaryotes - 955 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G49640.1 | protein_coding | 5:20151163-20151842 | unclear | -16.9758 | 84 | 115 | 480 | 446 | unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT1G27290.1 | protein_coding | 1:9481405-9482992 | unclear | -16.9757 | 737 | 761 | 769 | 736 | unknown protein; Has 44 Blast hits to 44 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G53920.1 | protein_coding | 5:21891983-21894267 | unclear | -16.9741 | 15 | 46 | 177 | 147 | ribosomal protein L11 methyltransferase-related ribosomal protein L11 methyltransferase-related;FUNCTIONS IN: protein methyltransferase activity; INVOLVED IN: protein amino acid methylation; LOCATED IN: cytoplasm;CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 methyltransferase (InterPro:IPR004498), Ribosomal L11 methyltransferase, PrmA (InterPro:IPR010456); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_003570 | AT1G70518.1 | Ch1:26583570-26584684 | AT1G01490.1 | protein_coding | 1:180017-182749 | unclear | -16.973 | 72 | 113 | 632 | 589 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT1G63950.1); Has 7083 Blast hits to 3987 proteins in 399 species: Archae - 47; Bacteria - 875; Metazoa - 1731; Fungi - 337; Plants - 1157; Viruses - 96; Other Eukaryotes - 2840 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT5G19070.1 | protein_coding | 5:6375159-6377667 | unclear | -16.9715 | 631 | 648 | 758 | 741 | SNARE associated Golgi protein family SNARE associated Golgi protein family; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); SNARE associated Golgi protein family (TAIR:AT1G03260.1); Has 4755 Blast hits to 4755 proteins in 1226 species: Archae - 31; Bacteria - 3179; Metazoa - 263; Fungi - 112; Plants - 295; Viruses - 0; Other Eukaryotes - 875 (source: NCBI BLink). |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT1G33110.1 | protein_coding | 1:12004854-12008852 | unclear | -16.9712 | 203 | 240 | 1324 | 1298 | MATE efflux family protein MATE efflux family protein;FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); MATE efflux family protein (TAIR:AT1G33100.1); Has 9952 Blast hits to 9876 proteins in 1988 species: Archae - 205; Bacteria - 7065; Metazoa - 140; Fungi - 326; Plants - 1371; Viruses - 0; Other Eukaryotes - 845 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G02060.1 | protein_coding | 2:494745-497860 | unclear | -16.9572 | 1348 | 1372 | 716 | 692 | Homeodomain-like superfamily protein Homeodomain-like superfamily protein;CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); Homeodomain-like superfamily protein (TAIR:AT1G14600.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G32740.1 | protein_coding | 1:11844660-11846347 | unclear | -16.9282 | 2202 | 2239 | 531 | 503 | SBP (S-ribonuclease binding protein) family protein SBP (S-ribonuclease binding protein) family protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); SBP (S-ribonuclease binding protein) family protein (TAIR:AT4G17680.1); Has 798 Blast hits to 798 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 316; Fungi - 15; Plants - 388; Viruses - 21; Other Eukaryotes - 54 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G35860.1 | protein_coding | 4:16986840-16989047 | unclear | -16.9243 | 592 | 617 | 976 | 949 | GTP-binding 2 GTP-binding protein ATGB2 GTP-binding 2 (GB2);FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Small GTPase (InterPro:IPR020851), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); RAB GTPase homolog B1C (TAIR:AT4G17170.1); Has 26616 Blast hits to 26543 proteins in 733 species: Archae - 16; Bacteria - 127; Metazoa - 14148; Fungi - 3650; Plants - 2938; Viruses - 20; Other Eukaryotes - 5717 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT5G67620.1 | protein_coding | 5:26964551-26966010 | unclear | -16.9219 | 393 | 411 | 61 | 43 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: microtubule; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G62900.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT2G33380.1 | protein_coding | 2:14144831-14146555 | Unclear | -16.9197 | 1860 | 1902 | 117 | 69 | Caleosin-related family protein Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress.RESPONSIVE TO DESSICATION 20 (RD20);FUNCTIONS IN: lipoxygenase activity, calcium ion binding; INVOLVED IN: in 7 processes; LOCATED IN: chloroplast membrane, microsome, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Caleosin related (InterPro:IPR007736); seed gene 1 (TAIR:AT4G26740.1); Has 344 Blast hits to 339 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 60; Plants - 279; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G16040.1 | protein_coding | 1:5504608-5507059 | unclear | -16.9179 | 247 | 291 | 44 | 3 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 280 Blast hits to 280 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 111; Plants - 44; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G24040.1 | protein_coding | 4:12488040-12491298 | unclear | -16.8977 | 2684 | 2744 | 240 | 191 | trehalase 1Encodes a trehalase, member of Glycoside Hydrolase Family 37. trehalase 1 (TRE1);CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 37 (InterPro:IPR001661), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 37, conserved site (InterPro:IPR018232); Has 1925 Blast hits to 1909 proteins in 569 species: Archae - 2; Bacteria - 1056; Metazoa - 507; Fungi - 235; Plants - 71; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT1G27000.1 | protein_coding | 1:9373885-9376828 | unclear | -16.8666 | 173 | 190 | 277 | 260 | Protein ofunknown function (DUF1664) Protein ofunknown function (DUF1664);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1664 (InterPro:IPR012458); Protein ofunknown function (DUF1664) (TAIR:AT2G02730.2); Has 199 Blast hits to 190 proteins in 29 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 2; Plants - 161; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.6 | Ch1:9065955-9071457 | AT5G44790.1 | protein_coding | 5:18075562-18080160 | unclear | -16.8607 | 226 | 249 | 91 | 59 | copper-exporting ATPase / responsive-to-antagonist 1 / copper-transporting ATPase (RAN1) ATP dependent copper transporter vital for ethylene response pathway RESPONSIVE-TO-ANTAGONIST 1 (RAN1);CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121), ATPase, P type, cation/copper-transporter (InterPro:IPR006403), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), Heavy-metal-associated, conserved site (InterPro:IPR017969), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, heavy metal translocating (InterPro:IPR006416), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), Copper ion-binding (InterPro:IPR006122), ATPase, P-type phosphorylation site (InterPro:IPR018303); heavy metal atpase 5 (TAIR:AT1G63440.1); Has 47831 Blast hits to 34622 proteins in 3461 species: Archae - 1084; Bacteria - 31583; Metazoa - 5562; Fungi - 2713; Plants - 1975; Viruses - 3; Other Eukaryotes - 4911 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G61890.1 | protein_coding | 3:22914154-22915393 | unclear | -16.8525 | 56 | 79 | 167 | 145 | homeobox 12Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. homeobox 12 (HB-12);CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Helix-turn-helix motif, lambda-like repressor (InterPro:IPR000047), Leucine zipper, homeobox-associated (InterPro:IPR003106), Homeodomain-related (InterPro:IPR012287); homeobox 7 (TAIR:AT2G46680.1); Has 10279 Blast hits to 10246 proteins in 542 species: Archae - 1; Bacteria - 17; Metazoa - 7845; Fungi - 173; Plants - 2032; Viruses - 4; Other Eukaryotes - 207 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G75390.1 | protein_coding | 1:28291698-28293008 | unclear | -16.8199 | 41 | 81 | 715 | 674 | basic leucine-zipper 44 basic leucine-zipper 44 (bZIP44);FUNCTIONS IN: DNA binding, protein heterodimerization activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); G-box binding factor 6 (TAIR:AT4G34590.1); Has 1696 Blast hits to 1696 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 67; Plants - 1605; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G23190.1 | protein_coding | 4:12140899-12143858 | unclear | -16.8174 | 837 | 878 | 288 | 251 | cysteine-rich RLK (RECEPTOR-like protein kinase) 11Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) cysteine-rich RLK (RECEPTOR-like protein kinase) 11 (CRK11);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Protein ofunknown function DUF26 (InterPro:IPR002902), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); cysteine-rich RLK (RECEPTOR-like protein kinase) 22 (TAIR:AT4G23300.1); Has 122786 Blast hits to 121167 proteins in 4390 species: Archae - 103; Bacteria - 13685; Metazoa - 45057; Fungi - 10628; Plants - 34657; Viruses - 456; Other Eukaryotes - 18200 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G73920.1 | protein_coding | 1:27790737-27794928 | unclear | -16.8147 | 40 | 87 | 2431 | 2387 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: AB-hydrolase-associated lipase region (InterPro:IPR006693); alpha/beta-Hydrolases superfamily protein (TAIR:AT1G18460.1); Has 1703 Blast hits to 1686 proteins in 187 species: Archae - 0; Bacteria - 0; Metazoa - 1158; Fungi - 276; Plants - 166; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G24160.1 | protein_coding | 3:8726056-8729427 | unclear | -16.7896 | 621 | 687 | 114 | 62 | putative type 1 membrane proteinEncodes a putative Type 1 membrane protein (PMP). putative type 1 membrane protein (PMP);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G47056.1 | protein_coding | 1:17275890-17277839 | unclear | -16.7852 | 3357 | 3406 | 265 | 227 | VIER F-box proteine 1Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB2,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. VIER F-box proteine 1 (VFB1);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: stomatal complex, sepal, root, leaf; EXPRESSED DURING: seedling growth;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); VIER F-box proteine 3 (TAIR:AT4G07400.1); Has 4631 Blast hits to 2722 proteins in 229 species: Archae - 0; Bacteria - 68; Metazoa - 1574; Fungi - 394; Plants - 2158; Viruses - 0; Other Eukaryotes - 437 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G38240.1 | protein_coding | 5:15276929-15279384 | unclear | -16.7831 | 2596 | 2630 | 373 | 334 | Protein kinase family protein Protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase family protein (TAIR:AT5G38250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G25585.2 | protein_coding | 3:9295175-9298746 | unclear | -16.7792 | 3668 | 3709 | 89 | 40 | aminoalcoholphosphotransferase aminoalcoholphosphotransferase (AAPT2) mRNA, complete cds aminoalcoholphosphotransferase (AAPT2);FUNCTIONS IN: phosphatidyltransferase activity, phosphotransferase activity, for other substituted phosphate groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Choline/ethanolaminephosphotransferase (InterPro:IPR014472), CDP-alcohol phosphatidyltransferase (InterPro:IPR000462); aminoalcoholphosphotransferase 1 (TAIR:AT1G13560.1); Has 935 Blast hits to 929 proteins in 243 species: Archae - 10; Bacteria - 38; Metazoa - 367; Fungi - 228; Plants - 82; Viruses - 0; Other Eukaryotes - 210 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G23980.1 | protein_coding | 2:10201104-10205422 | Unclear | -16.7788 | 967 | 996 | 67 | 35 | cyclic nucleotide-gated channel 6 member of Cyclic nucleotide gated channel family cyclic nucleotide-gated channel 6 (CNGC6);FUNCTIONS IN: calmodulin binding; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Potassium channel, voltage-dependent, EAG/ELK/ERG (InterPro:IPR003938), Ion transport (InterPro:IPR005821), Cyclic nucleotide-binding-like (InterPro:IPR018490), RmlC-like jelly roll fold (InterPro:IPR014710), IQ calmodulin-binding region (InterPro:IPR000048); cyclic nucleotide gated channel 9 (TAIR:AT4G30560.1); Has 3569 Blast hits to 3382 proteins in 249 species: Archae - 0; Bacteria - 42; Metazoa - 1579; Fungi - 32; Plants - 1028; Viruses - 0; Other Eukaryotes - 888 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G24450.1 | protein_coding | 4:12635061-12642808 | unclear | -16.7768 | 42 | 72 | 3811 | 3780 | phosphoglucan, water dikinase "phosphoglucan, water dikinase" (PWD);FUNCTIONS IN: kinase activity, ATP binding; INVOLVED IN: phosphorylation; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192); Pyruvate phosphate dikinase, PEP/pyruvate binding domain (TAIR:AT1G10760.1); Has 1897 Blast hits to 1851 proteins in 785 species: Archae - 196; Bacteria - 1373; Metazoa - 4; Fungi - 3; Plants - 225; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G54380.1 | protein_coding | 3:20133893-20137007 | unclear | -16.77 | 541 | 558 | 89 | 72 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family SAC3/GANP/Nin1/mts3/eIF-3 p25 family;CONTAINS InterPro DOMAIN/s: SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); SAC3/GANP/Nin1/mts3/eIF-3 p25 family (TAIR:AT3G06290.1); Has 539 Blast hits to 535 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 200; Plants - 96; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G25585.2 | protein_coding | 3:9295175-9298746 | unclear | -16.7579 | 2777 | 2804 | 60 | 32 | aminoalcoholphosphotransferase aminoalcoholphosphotransferase (AAPT2) mRNA, complete cds aminoalcoholphosphotransferase (AAPT2);FUNCTIONS IN: phosphatidyltransferase activity, phosphotransferase activity, for other substituted phosphate groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Choline/ethanolaminephosphotransferase (InterPro:IPR014472), CDP-alcohol phosphatidyltransferase (InterPro:IPR000462); aminoalcoholphosphotransferase 1 (TAIR:AT1G13560.1); Has 935 Blast hits to 929 proteins in 243 species: Archae - 10; Bacteria - 38; Metazoa - 367; Fungi - 228; Plants - 82; Viruses - 0; Other Eukaryotes - 210 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G03210.1 | protein_coding | 5:762604-763480 | unclear | -16.7512 | 1508 | 1553 | 133 | 101 | Encodes a small polypeptide contributing to resistance to potyvirus. unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013613 | AT3G02025.1 | Ch3:2424354-2424597 | AT3G55460.1 | protein_coding | 3:20560802-20563885 | unclear | -16.7474 | 190 | 219 | 385 | 361 | SC35-like splicing factor 30 Encodes an SC35-like splicing factor that is localized to nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. SC35-like splicing factor 30 (SCL30);FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: response to oxidative stress, nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: nuclear speck; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); SC35-like splicing factor 30A (TAIR:AT3G13570.1); Has 999798 Blast hits to 999477 proteins in 36048 species: Archae - 21842; Bacteria - 604317; Metazoa - 201442; Fungi - 24075; Plants - 55248; Viruses - 69771; Other Eukaryotes - 23103 (source: NCBI BLink). |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT5G59490.1 | protein_coding | 5:23982621-23984656 | unclear | -16.7029 | 1006 | 1025 | 27 | 8 | Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinHaloacid dehalogenase-like hydrolase (HAD) superfamily protein;FUNCTIONS IN: hydrolase activity; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Pyrimidine 5-nucleotidase (InterPro:IPR010237), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT5G02230.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G10720.1 | protein_coding | 1:3562841-3564850 | unclear | -16.6965 | 2609 | 2629 | 295 | 275 | BSD domain-containing protein BSD domain-containing protein;CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BSD domain-containing protein (TAIR:AT3G49800.1); Has 1569 Blast hits to 1461 proteins in 180 species: Archae - 0; Bacteria - 14; Metazoa - 740; Fungi - 179; Plants - 264; Viruses - 21; Other Eukaryotes - 351 (source: NCBI BLink). |
| XLOC_013898 | AT3G13277.1 | Ch3:4290082-4291595 | AT5G49690.1 | protein_coding | 5:20189655-20191604 | unclear | -16.6945 | 1168 | 1196 | 254 | 222 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT5G65550.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT5G59780.3 | protein_coding | 5:24081868-24083562 | unclear | -16.6706 | 35 | 62 | 74 | 47 | myb domain protein 59Encodes a putative transcription factor (MYB59). myb domain protein 59 (MYB59);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to cadmium ion, regulation of transcription, DNA-dependent, response to chitin, response to salicylic acid stimulus; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Myb transcription factor (InterPro:IPR015495), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); myb domain protein 48 (TAIR:AT3G46130.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G10770.1 | protein_coding | 3:3372092-3374314 | unclear | -16.6697 | 3118 | 3134 | 102 | 86 | Single-stranded nucleic acid binding R3H protein Single-stranded nucleic acid binding R3H protein;FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Single-stranded nucleic acid binding R3H (InterPro:IPR001374); Single-stranded nucleic acid binding R3H protein (TAIR:AT5G05100.1); Has 376 Blast hits to 376 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 60; Plants - 124; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G27290.1 | protein_coding | 1:9481405-9482992 | unclear | -16.6617 | 232 | 274 | 770 | 725 | unknown protein; Has 44 Blast hits to 44 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT2G22430.1 | protein_coding | 2:9525988-9527845 | unclear | -16.6537 | 810 | 835 | 58 | 33 | homeobox protein 6 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. homeobox protein 6 (HB6);FUNCTIONS IN: protein binding, sequence-specific DNA binding, DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to water deprivation, positive regulation of transcription, abscisic acid mediated signaling pathway, negative regulation of abscisic acid mediated signaling pathway, regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Helix-turn-helix motif, lambda-like repressor (InterPro:IPR000047), Leucine zipper, homeobox-associated (InterPro:IPR003106), Homeodomain-related (InterPro:IPR012287); homeobox protein 16 (TAIR:AT4G40060.1); Has 10935 Blast hits to 10899 proteins in 558 species: Archae - 5; Bacteria - 20; Metazoa - 8544; Fungi - 195; Plants - 1932; Viruses - 5; Other Eukaryotes - 234 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G34380.1 | protein_coding | 2:14512707-14514516 | unclear | -16.6505 | 1448 | 1472 | 257 | 231 | Putative adipose-regulatory protein (Seipin) Putative adipose-regulatory protein (Seipin);CONTAINS InterPro DOMAIN/s: Adipose-regulatory protein, Seipin (InterPro:IPR009617); Putative adipose-regulatory protein (Seipin) (TAIR:AT1G29760.1); Has 254 Blast hits to 249 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 27; Plants - 76; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G42010.1 | protein_coding | 2:17532813-17538628 | unclear | -16.6503 | 174 | 212 | 377 | 350 | phospholipase D beta 1 phospholipase D (PLDbeta) phospholipase D beta 1 (PLDBETA1);FUNCTIONS IN: phospholipase D activity, protein binding, phosphatidylinositol-4,5-bisphosphate binding; INVOLVED IN: response to cadmium ion, defense response to bacterium, incompatible interaction; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), Phospholipase D (InterPro:IPR015679), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Phospholipase D/Transphosphatidylase (InterPro:IPR001736), C2 calcium-dependent membrane targeting (InterPro:IPR000008); phospholipase D beta 2 (TAIR:AT4G00240.1); Has 42228 Blast hits to 24253 proteins in 1246 species: Archae - 34; Bacteria - 3967; Metazoa - 15807; Fungi - 8808; Plants - 7882; Viruses - 972; Other Eukaryotes - 4758 (source: NCBI BLink). |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT1G76580.1 | protein_coding | 1:28734207-28738967 | unclear | -16.638 | 565 | 608 | 74 | 33 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); squamosa promoter binding protein-like 14 (TAIR:AT1G20980.1); Has 4275 Blast hits to 1172 proteins in 134 species: Archae - 0; Bacteria - 31; Metazoa - 161; Fungi - 128; Plants - 962; Viruses - 0; Other Eukaryotes - 2993 (source: NCBI BLink). |
| XLOC_000642 | AT1G04933.1 | Ch1:4123641-4124165 | AT1G61860.1 | protein_coding | 1:22862655-22864898 | unclear | -16.6246 | 332 | 361 | 213 | 174 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT3G20530.1); Has 115036 Blast hits to 113792 proteins in 4152 species: Archae - 89; Bacteria - 13305; Metazoa - 42775; Fungi - 9531; Plants - 32685; Viruses - 325; Other Eukaryotes - 16326 (source: NCBI BLink). |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT2G27150.1 | protein_coding | 2:11601727-11608450 | unclear | -16.6244 | 109 | 145 | 4134 | 4099 | abscisic aldehyde oxidase 3Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. abscisic aldehyde oxidase 3 (AAO3);CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); aldehyde oxidase 4 (TAIR:AT1G04580.1); Has 18285 Blast hits to 17524 proteins in 1277 species: Archae - 409; Bacteria - 10745; Metazoa - 1018; Fungi - 113; Plants - 280; Viruses - 0; Other Eukaryotes - 5720 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G70590.1 | protein_coding | 1:26618099-26620421 | unclear | -16.6059 | 388 | 412 | 245 | 222 | F-box family protein F-box family protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Sel1-like (InterPro:IPR006597); HCP-like superfamily protein (TAIR:AT1G18260.1); Has 16059 Blast hits to 6577 proteins in 1289 species: Archae - 0; Bacteria - 11525; Metazoa - 502; Fungi - 723; Plants - 391; Viruses - 15; Other Eukaryotes - 2903 (source: NCBI BLink). |
| XLOC_023962 | AT4G38545.2 | Ch4:18022932-18025298 | AT5G25280.1 | protein_coding | 5:8773734-8776594 | unclear | -16.6031 | 0 | 32 | 264 | 230 | serine-rich protein-related serine-rich protein-related; serine-rich protein-related (TAIR:AT5G11090.1); Has 1306 Blast hits to 350 proteins in 64 species: Archae - 0; Bacteria - 8; Metazoa - 365; Fungi - 73; Plants - 167; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT4G15420.1 | protein_coding | 4:8823402-8826152 | unclear | -16.6028 | 2201 | 2229 | 153 | 120 | Ubiquitin fusion degradation UFD1 family protein Ubiquitin fusion degradation UFD1 family protein;FUNCTIONS IN: peptidase activity, zinc ion binding; INVOLVED IN: proteolysis, ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Peptidase, C-terminal, archaeal/bacterial (InterPro:IPR007280), Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); Ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G29070.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G08560.1 | protein_coding | 5:2770782-2774714 | unclear | -16.5953 | 2260 | 2311 | 144 | 110 | transducin family protein / WD-40 repeat family protein transducin family protein / WD-40 repeat family protein;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), CTLH, C-terminal LisH motif (InterPro:IPR006595), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), LisH dimerisation motif (InterPro:IPR006594), WD40 repeat, subgroup (InterPro:IPR019781); transducin family protein / WD-40 repeat family protein (TAIR:AT5G43920.1); Has 58921 Blast hits to 28907 proteins in 822 species: Archae - 84; Bacteria - 8409; Metazoa - 23216; Fungi - 12597; Plants - 7341; Viruses - 6; Other Eukaryotes - 7268 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G14630.1 | protein_coding | 4:8392825-8393860 | unclear | -16.5823 | 106 | 156 | 149 | 97 | germin-like protein 9 germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. germin-like protein 9 (GLP9);FUNCTIONS IN: manganese ion binding, nutrient reservoir activity; INVOLVED IN: response to salt stress; LOCATED IN: extracellular region, plasma membrane, plant-type vacuole; EXPRESSED IN: stem, hypocotyl, sepal, root, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), Germin (InterPro:IPR001929), RmlC-like jelly roll fold (InterPro:IPR014710), Germin, manganese binding site (InterPro:IPR019780); RmlC-like cupins superfamily protein (TAIR:AT5G39110.1); Has 1524 Blast hits to 1518 proteins in 95 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 42; Plants - 1455; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G56200.1 | protein_coding | 5:22747478-22749427 | unclear | -16.5768 | 49 | 87 | 904 | 861 | C2H2 type zinc finger transcription factor family Encodes a transcription factor expressed in the female gametophyte.C2H2 type zinc finger transcription factor family;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); C2H2-type zinc finger family protein (TAIR:AT5G04390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G58730.1 | protein_coding | 5:23723404-23725585 | unclear | -16.5763 | 1475 | 1516 | 132 | 100 | pfkB-like carbohydrate kinase family protein pfkB-like carbohydrate kinase family protein;CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611), Carbohydrate/puine kinase, PfkB, conserved site (InterPro:IPR002173); pfkB-like carbohydrate kinase family protein (TAIR:AT4G10260.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G47750.1 | protein_coding | 1:17569256-17570249 | unclear | -16.5757 | 1969 | 1997 | 609 | 576 | peroxin 11Amember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. peroxin 11A (PEX11A);CONTAINS InterPro DOMAIN/s: Peroxisomal biogenesis factor 11 (InterPro:IPR008733); peroxin 11B (TAIR:AT3G47430.1); Has 271 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 15; Plants - 188; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| XLOC_023238 | AT4G26095.1 | Ch4:13224204-13227622 | AT3G62230.1 | protein_coding | 3:23031531-23033146 | unclear | -16.5581 | 93 | 137 | 319 | 282 | F-box family protein Target promoter of the male germline-specific transcription factor DUO1. F-box family protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); F-box/RNI-like superfamily protein (TAIR:AT5G54820.1); Has 483 Blast hits to 473 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT5G18110.1 | protein_coding | 5:5988744-5990681 | unclear | -16.5199 | 383 | 409 | 38 | 7 | novel cap-binding proteinnovel cap-binding protein (NCBP);FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 4E (eIF-4E) (InterPro:IPR001040), Eukaryotic translation initiation factor 4E (eIF-4E), conserved site (InterPro:IPR019770); eukaryotic translation initiation factor 4E (TAIR:AT4G18040.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G41640.1 | protein_coding | 2:17360374-17363788 | unclear | -16.5027 | 2948 | 2973 | 548 | 521 | Glycosyltransferase family 61 protein Glycosyltransferase family 61 protein;FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_processunknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyltransferase AER61, uncharacterised (InterPro:IPR007657); Glycosyltransferase family 61 protein (TAIR:AT3G57380.1); Has 674 Blast hits to 674 proteins in 105 species: Archae - 0; Bacteria - 55; Metazoa - 158; Fungi - 12; Plants - 386; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT5G05230.1 | protein_coding | 5:1551298-1553808 | unclear | -16.4618 | 395 | 411 | 19 | 3 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613); RING/U-box superfamily protein (TAIR:AT2G40640.1); Has 107 Blast hits to 107 proteins in 24 species: Archae - 0; Bacteria - 4; Metazoa - 14; Fungi - 6; Plants - 79; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G33970.1 | protein_coding | 1:12349304-12351318 | unclear | -16.4549 | 6 | 32 | 567 | 544 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: GTP binding; INVOLVED IN: response to bacterium; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: AIG1 (InterPro:IPR006703); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT4G09950.1); Has 5286 Blast hits to 4352 proteins in 536 species: Archae - 103; Bacteria - 667; Metazoa - 2039; Fungi - 248; Plants - 262; Viruses - 31; Other Eukaryotes - 1936 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G29970.2 | protein_coding | 1:10498351-10501498 | unclear | -16.4508 | 1967 | 1999 | 699 | 660 | 60S ribosomal protein L18A-1 60S ribosomal protein L18A-1 (RPL18AA);FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae/LX (InterPro:IPR021138), Ribosomal protein L18ae (InterPro:IPR002670); Ribosomal protein L18ae/LX family protein (TAIR:AT1G29965.1); Has 869 Blast hits to 867 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 315; Fungi - 155; Plants - 265; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G62570.2 | protein_coding | 5:25113948-25117314 | unclear | -16.4477 | 541 | 565 | 1625 | 1602 | Calmodulin binding protein-like Calmodulin binding protein-like;FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); Calmodulin-binding protein (TAIR:AT4G25800.2). |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT1G19660.1 | protein_coding | 1:6799969-6802906 | unclear | -16.4426 | 2714 | 2759 | 60 | 20 | Wound-responsive family protein Wound-responsive family protein;FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: response to wounding, nucleotide-excision repair; EXPRESSED IN: ovule;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF151 (InterPro:IPR003729), UvrB/UvrC protein (InterPro:IPR001943); bifunctional nuclease in basal defense response 1 (TAIR:AT1G75380.3); Has 886 Blast hits to 886 proteins in 308 species: Archae - 44; Bacteria - 551; Metazoa - 0; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G25360.1 | protein_coding | 5:8799710-8802753 | unclear | -16.4371 | 1351 | 1382 | 83 | 50 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G32342.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_007872 | AT1G75295.2 | Ch1:28254820-28257236 | AT2G41410.1 | protein_coding | 2:17261728-17263017 | unclear | -16.4297 | 1489 | 1528 | 269 | 238 | Calcium-binding EF-hand family proteinCalcium-binding EF-hand family protein;FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248); Calcium-binding EF-hand family protein (TAIR:AT3G10190.1); Has 13145 Blast hits to 9942 proteins in 1264 species: Archae - 0; Bacteria - 67; Metazoa - 5109; Fungi - 2319; Plants - 3772; Viruses - 0; Other Eukaryotes - 1878 (source: NCBI BLink). |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT1G46768.1 | protein_coding | 1:17265586-17266824 | unclear | -16.4295 | 336 | 356 | 142 | 122 | related to AP2 1Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The proteinCONTAINS one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. related to AP2 1 (RAP2.1);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); related to AP2 10 (TAIR:AT4G36900.1); Has 5681 Blast hits to 5559 proteins in 243 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5675; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G25900.1 | protein_coding | 5:9035817-9038423 | unclear | -16.4214 | 1448 | 1478 | 147 | 109 | GA requiring 3 Encodes a member of the CYP701A cytochrome p450 family that is involved in later steps of the gibberellin biosynthetic pathway. GA requiring 3 (GA3);FUNCTIONS IN: oxygen binding; INVOLVED IN: gibberellin biosynthetic process, gibberellic acid mediated signaling pathway, ent-kaurene oxidation to kaurenoic acid; LOCATED IN: chloroplast outer membrane, endoplasmic reticulum, microsome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); Cytochrome P450 superfamily protein (TAIR:AT5G07990.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G21690.1 | protein_coding | 3:7638584-7642389 | unclear | -16.4173 | 1863 | 1878 | 68 | 53 | MATE efflux family protein MATE efflux family protein;FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); MATE efflux family protein (TAIR:AT1G61890.1); Has 11325 Blast hits to 11232 proteins in 2038 species: Archae - 269; Bacteria - 8227; Metazoa - 142; Fungi - 332; Plants - 1357; Viruses - 0; Other Eukaryotes - 998 (source: NCBI BLink). |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT1G29970.2 | protein_coding | 1:10498351-10501498 | unclear | -16.4169 | 0 | 40 | 697 | 659 | 60S ribosomal protein L18A-1 60S ribosomal protein L18A-1 (RPL18AA);FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae/LX (InterPro:IPR021138), Ribosomal protein L18ae (InterPro:IPR002670); Ribosomal protein L18ae/LX family protein (TAIR:AT1G29965.1); Has 869 Blast hits to 867 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 315; Fungi - 155; Plants - 265; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G12760.1 | protein_coding | 1:4348498-4350993 | unclear | -16.4057 | 1238 | 1268 | 96 | 71 | Zinc finger, C3HC4 type (RING finger) family protein Zinc finger, C3HC4 type (RING finger) family protein;FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); Zinc finger, C3HC4 type (RING finger) family protein (TAIR:AT1G63170.1); Has 9873 Blast hits to 9851 proteins in 276 species: Archae - 0; Bacteria - 6; Metazoa - 2638; Fungi - 764; Plants - 5094; Viruses - 23; Other Eukaryotes - 1348 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G40640.1 | protein_coding | 5:16277042-16280424 | unclear | -16.3863 | 2692 | 2711 | 167 | 148 | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G27390.1); Has 104 Blast hits to 102 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 101; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G47128.1 | protein_coding | 1:17282749-17285749 | Unclear | -16.3846 | 2209 | 2243 | 433 | 399 | Granulin repeat cysteine protease family protein cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea. responsive to dehydration 21 (RD21);FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: response to water deprivation; LOCATED IN: apoplast, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Granulin (InterPro:IPR000118), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); Granulin repeat cysteine protease family protein (TAIR:AT5G43060.1); Has 8846 Blast hits to 8044 proteins in 757 species: Archae - 51; Bacteria - 244; Metazoa - 4223; Fungi - 6; Plants - 1942; Viruses - 134; Other Eukaryotes - 2246 (source: NCBI BLink). |
| XLOC_025053 | AT5G18255.1 | Ch5:6035619-6037641 | AT5G64310.1 | protein_coding | 5:25721733-25722678 | unclear | -16.3789 | 327 | 357 | 38 | 4 | arabinogalactan protein 1 Encodes arabinogalactan-protein (AGP1). arabinogalactan protein 1 (AGP1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G64070.1 | protein_coding | 5:25636882-25644478 | unclear | -16.3631 | 516 | 537 | 22 | 0 | phosphatidylinositol 4-OH kinase beta1 Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta1. ArabidopsisCONTAINS 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta1 is 83% identical to PI-4kbeta2 encoded by At5g09350. Interacts with the RabA4b GTPase. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta2, leads to the formation of abnormal root hairs.phosphatidylinositol 4-OH kinase beta1 (PI-4KBETA1);FUNCTIONS IN: 1-phosphatidylinositol 4-kinase activity; INVOLVED IN: phosphoinositide biosynthetic process, root hair cell tip growth, pollen tube growth; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: male gametophyte, root hair tip, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403), Phosphatidylinositol Kinase (InterPro:IPR015433), Armadillo-type fold (InterPro:IPR016024), Phosphatidylinositol 3/4-kinase, conserved site (InterPro:IPR018936), Protein kinase-like domain (InterPro:IPR011009); phosphatidylinositol 4-OH kinase beta2 (TAIR:AT5G09350.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G16680.1 | protein_coding | 5:5467228-5473592 | unclear | -16.3546 | 2136 | 2172 | 152 | 117 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT3G02890.1); Has 6870 Blast hits to 4822 proteins in 413 species: Archae - 8; Bacteria - 605; Metazoa - 3213; Fungi - 704; Plants - 729; Viruses - 19; Other Eukaryotes - 1592 (source: NCBI BLink). |
| XLOC_023238 | AT4G26095.1 | Ch4:13224204-13227622 | AT2G23450.2 | protein_coding | 2:9988678-9992010 | unclear | -16.3518 | 2837 | 2861 | 1969 | 1946 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), EGF-like (InterPro:IPR006210), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G66790.1); Has 113981 Blast hits to 112485 proteins in 3193 species: Archae - 103; Bacteria - 12981; Metazoa - 41291; Fungi - 9532; Plants - 32683; Viruses - 360; Other Eukaryotes - 17031 (source: NCBI BLink). |
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT2G46390.1 | protein_coding | 2:19042301-19043234 | unclear | -16.351 | 304 | 329 | 46 | 21 | predicted to encode subunit 8 of mitochondrial complex II and to participate in the respiratory chain unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013032 | AT2G45023.1 | Ch2:18570156-18572173 | AT3G03310.1 | protein_coding | 3:778568-781703 | unclear | -16.3498 | 126 | 164 | 156 | 120 | lecithin:cholesterol acyltransferase 3lecithin:cholesterol acyltransferase 3 (LCAT3);FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); alpha/beta-Hydrolases superfamily protein (TAIR:AT4G19860.1); Has 560 Blast hits to 555 proteins in 155 species: Archae - 2; Bacteria - 82; Metazoa - 189; Fungi - 22; Plants - 147; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT4G14900.1 | protein_coding | 4:8520782-8524217 | unclear | -16.3328 | 317 | 342 | 663 | 637 | FRIGIDA-like protein FRIGIDA-like protein;CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); FRIGIDA-like protein (TAIR:AT3G22440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G18265.1 | protein_coding | 1:6282233-6283348 | unclear | -16.3306 | 225 | 265 | 642 | 610 | Protein ofunknown function, DUF593 Protein ofunknown function, DUF593;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF593 (InterPro:IPR007656); Protein ofunknown function, DUF593 (TAIR:AT5G16720.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G10720.1 | protein_coding | 1:3562841-3564850 | unclear | -16.3288 | 1356 | 1391 | 518 | 483 | BSD domain-containing protein BSD domain-containing protein;CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BSD domain-containing protein (TAIR:AT3G49800.1); Has 1569 Blast hits to 1461 proteins in 180 species: Archae - 0; Bacteria - 14; Metazoa - 740; Fungi - 179; Plants - 264; Viruses - 21; Other Eukaryotes - 351 (source: NCBI BLink). |
| XLOC_025053 | AT5G18255.2 | Ch5:6035619-6037641 | AT2G23450.2 | protein_coding | 2:9988678-9992010 | unclear | -16.324 | 1269 | 1311 | 2043 | 1998 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), EGF-like (InterPro:IPR006210), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G66790.1); Has 113981 Blast hits to 112485 proteins in 3193 species: Archae - 103; Bacteria - 12981; Metazoa - 41291; Fungi - 9532; Plants - 32683; Viruses - 360; Other Eukaryotes - 17031 (source: NCBI BLink). |
| XLOC_012712 | AT2G09090.1 | Ch2:16671195-16672443 | AT5G53420.1 | protein_coding | 5:21673432-21675803 | unclear | -16.3182 | 525 | 568 | 1007 | 974 | CCT motif family protein CCT motif family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); CCT motif family protein (TAIR:AT4G27900.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G19660.1 | protein_coding | 3:6825433-6826585 | unclear | -16.3174 | 141 | 171 | 361 | 335 | unknown protein; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G14280.1 | protein_coding | 5:4608745-4610448 | unclear | -16.3135 | 673 | 694 | 922 | 901 | DNA-binding storekeeper protein-related DNA-binding storekeeper protein-related;FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_processunknown; LOCATED IN: integral to membrane;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF573 (InterPro:IPR007592), TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein (TAIR:AT3G27270.1); Has 335 Blast hits to 330 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 315; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G30270.1 | protein_coding | 1:10654800-10658924 | unclear | -16.2869 | 679 | 720 | 811 | 783 | CBL-interacting protein kinase 23 Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. CBL-interacting protein kinase 23 (CIPK23);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), NAF domain (InterPro:IPR004041), CBL-interacting protein kinase (InterPro:IPR020660), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); CBL-interacting protein kinase 9 (TAIR:AT1G01140.1); Has 132391 Blast hits to 130112 proteins in 4449 species: Archae - 167; Bacteria - 15551; Metazoa - 48688; Fungi - 13416; Plants - 32041; Viruses - 531; Other Eukaryotes - 21997 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G74890.1 | protein_coding | 1:28131447-28133025 | Unclear | -16.2673 | 632 | 661 | 46 | 18 | response regulator 15Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. response regulator 15 (ARR15);CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Signal transduction response regulator, receiver domain (InterPro:IPR001789); response regulator 7 (TAIR:AT1G19050.1); Has 46084 Blast hits to 45371 proteins in 2654 species: Archae - 273; Bacteria - 40324; Metazoa - 30; Fungi - 580; Plants - 1499; Viruses - 4; Other Eukaryotes - 3374 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G15740.1 | protein_coding | 1:5410908-5414919 | unclear | -16.2591 | 3350 | 3392 | 1706 | 1661 | Leucine-rich repeat family protein Leucine-rich repeat family protein; Leucine-rich repeat (LRR) family protein (TAIR:AT4G23840.1); Has 38052 Blast hits to 19856 proteins in 856 species: Archae - 6; Bacteria - 8624; Metazoa - 11681; Fungi - 680; Plants - 12072; Viruses - 79; Other Eukaryotes - 4910 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G01610.1 | protein_coding | 4:694582-697206 | Unclear | -16.2533 | 2686 | 2711 | 62 | 37 | Cysteine proteinases superfamily protein Cysteine proteinases superfamily protein;FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis, regulation of catalytic activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Peptidase C1A, cathepsin B (InterPro:IPR015643), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169), Peptidase C1A, propeptide (InterPro:IPR012599); Cysteine proteinases superfamily protein (TAIR:AT1G02305.1); Has 7486 Blast hits to 7443 proteins in 692 species: Archae - 63; Bacteria - 158; Metazoa - 3254; Fungi - 4; Plants - 1745; Viruses - 146; Other Eukaryotes - 2116 (source: NCBI BLink). |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT4G36710.1 | protein_coding | 4:17305758-17307648 | unclear | -16.248 | 186 | 230 | 217 | 179 | GRAS family transcription factor GRAS family transcription factor;CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT4G00150.1); Has 2023 Blast hits to 1999 proteins in 291 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 2019; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G09480.1 | protein_coding | 3:2914701-2915442 | unclear | -16.2472 | 1968 | 2001 | 155 | 120 | Histone superfamily protein Histone superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); Histone superfamily protein (TAIR:AT5G02570.1); Has 3226 Blast hits to 3226 proteins in 338 species: Archae - 0; Bacteria - 0; Metazoa - 2242; Fungi - 198; Plants - 460; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G69640.1 | protein_coding | 1:26193618-26195726 | unclear | -16.2384 | 65 | 97 | 386 | 354 | sphingoid base hydroxylase 1 Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. sphingoid base hydroxylase 1 (SBH1);CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); sphingoid base hydroxylase 2 (TAIR:AT1G14290.1); Has 2400 Blast hits to 2339 proteins in 395 species: Archae - 0; Bacteria - 406; Metazoa - 416; Fungi - 708; Plants - 429; Viruses - 3; Other Eukaryotes - 438 (source: NCBI BLink). |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G61250.1 | protein_coding | 1:22585752-22588969 | unclear | -16.2361 | 966 | 990 | 92 | 68 | secretory carrier 3Encodes a putative secretory carrier membrane protein (SC3). secretory carrier 3 (SC3);FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: leaf;CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); Secretory carrier membrane protein (SCAMP) family protein (TAIR:AT1G11180.1); Has 696 Blast hits to 694 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 383; Fungi - 14; Plants - 228; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G24400.1 | protein_coding | 4:12616979-12620714 | unclear | -16.2238 | 2680 | 2731 | 61 | 25 | CBL-interacting protein kinase 8Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. CBL-interacting protein kinase 8 (CIPK8);FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation, response to nitrate, root development, response to glucose stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), NAF domain (InterPro:IPR004041), CBL-interacting protein kinase (InterPro:IPR020660), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT5G35410.1); Has 132292 Blast hits to 130130 proteins in 4671 species: Archae - 192; Bacteria - 15224; Metazoa - 49173; Fungi - 13311; Plants - 31935; Viruses - 538; Other Eukaryotes - 21919 (source: NCBI BLink). |
| XLOC_025299 | AT5G23155.2 | Ch5:7792732-7794581 | AT5G39660.1 | protein_coding | 5:15878698-15881537 | unclear | -16.195 | 451 | 470 | 1851 | 1832 | cycling DOF factor 2 Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. cycling DOF factor 2 (CDF2);CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); cycling DOF factor 3 (TAIR:AT3G47500.1); Has 1150 Blast hits to 1134 proteins in 76 species: Archae - 0; Bacteria - 6; Metazoa - 18; Fungi - 6; Plants - 1095; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT2G45910.1 | protein_coding | 2:18894030-18898528 | unclear | -16.1937 | 632 | 653 | 210 | 189 | U-box domain-containing protein kinase family protein U-box domain-containing protein kinase family protein;FUNCTIONS IN: ubiquitin-protein ligase activity, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, response to stress, protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), U box domain (InterPro:IPR003613), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); U-box domain-containing protein kinase family protein (TAIR:AT3G49060.1); Has 126911 Blast hits to 124541 proteins in 4743 species: Archae - 223; Bacteria - 14733; Metazoa - 47002; Fungi - 10910; Plants - 34737; Viruses - 429; Other Eukaryotes - 18877 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G46270.1 | protein_coding | 2:19000180-19003403 | unclear | -16.1926 | 85 | 117 | 1602 | 1578 | G-box binding factor 3 encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh thatCONTAINS the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3??s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. G-box binding factor 3 (GBF3);CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), G-box binding, MFMR (InterPro:IPR012900), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); G-box binding factor 2 (TAIR:AT4G01120.1); Has 2267 Blast hits to 2266 proteins in 215 species: Archae - 0; Bacteria - 77; Metazoa - 736; Fungi - 40; Plants - 1305; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G63850.1 | protein_coding | 5:25550937-25553656 | unclear | -16.1691 | 67 | 106 | 1742 | 1709 | amino acid permease 4 Amino acid transporter whose expression is downregulated by dehydration. amino acid permease 4 (AAP4);CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); amino acid permease 2 (TAIR:AT5G09220.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G25585.2 | protein_coding | 3:9295175-9298746 | unclear | -16.1643 | 2678 | 2711 | 76 | 33 | aminoalcoholphosphotransferase aminoalcoholphosphotransferase (AAPT2) mRNA, complete cds aminoalcoholphosphotransferase (AAPT2);FUNCTIONS IN: phosphatidyltransferase activity, phosphotransferase activity, for other substituted phosphate groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Choline/ethanolaminephosphotransferase (InterPro:IPR014472), CDP-alcohol phosphatidyltransferase (InterPro:IPR000462); aminoalcoholphosphotransferase 1 (TAIR:AT1G13560.1); Has 935 Blast hits to 929 proteins in 243 species: Archae - 10; Bacteria - 38; Metazoa - 367; Fungi - 228; Plants - 82; Viruses - 0; Other Eukaryotes - 210 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G61370.1 | protein_coding | 5:24671770-24673657 | unclear | -16.157 | 301 | 333 | 1436 | 1393 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G60960.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G27300.1 | protein_coding | 1:9483157-9484368 | unclear | -16.1472 | 240 | 260 | 244 | 224 | unknown protein; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 6; Plants - 34; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G79680.1 | protein_coding | 1:29979973-29982819 | unclear | -16.1454 | 832 | 856 | 1450 | 1426 | WALL ASSOCIATED KINASE (WAK)-LIKE 10 Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP.WALL ASSOCIATED KINASE (WAK)-LIKE 10 (WAKL10);FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Wall-associated kinase (InterPro:IPR013695), EGF-like calcium-binding, conserved site (InterPro:IPR018097), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Wall-associated kinase family protein (TAIR:AT1G69730.1); Has 121485 Blast hits to 119425 proteins in 4418 species: Archae - 113; Bacteria - 13558; Metazoa - 45589; Fungi - 10331; Plants - 33597; Viruses - 488; Other Eukaryotes - 17809 (source: NCBI BLink). |
| XLOC_010840 | AT2G04285.1 | Ch2:763851-764640 | AT3G26220.1 | protein_coding | 3:9595930-9597927 | unclear | -16.1362 | 119 | 138 | 1126 | 1107 | cytochrome P450, family 71, subfamily B, polypeptide 3 cytochrome P450 monooxygenase "cytochrome P450, family 71, subfamily B, polypeptide 3" (CYP71B3);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 71, subfamily B, polypeptide 24 (TAIR:AT3G26230.1); Has 33108 Blast hits to 32883 proteins in 1657 species: Archae - 48; Bacteria - 3236; Metazoa - 11836; Fungi - 7129; Plants - 9646; Viruses - 3; Other Eukaryotes - 1210 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G15740.1 | protein_coding | 1:5410908-5414919 | unclear | -16.1337 | 2213 | 2231 | 2285 | 2267 | Leucine-rich repeat family protein Leucine-rich repeat family protein; Leucine-rich repeat (LRR) family protein (TAIR:AT4G23840.1); Has 38052 Blast hits to 19856 proteins in 856 species: Archae - 6; Bacteria - 8624; Metazoa - 11681; Fungi - 680; Plants - 12072; Viruses - 79; Other Eukaryotes - 4910 (source: NCBI BLink). |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT4G32130.1 | protein_coding | 4:15520025-15522695 | unclear | -16.123 | 423 | 451 | 179 | 155 | Protein ofunknown function (DUF2012)FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: male gametophyte, callus, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Protein ofunknown function DUF2012 (InterPro:IPR019008); Protein ofunknown function (DUF2012) (TAIR:AT2G25310.1); Has 295 Blast hits to 295 proteins in 131 species: Archae - 0; Bacteria - 8; Metazoa - 141; Fungi - 68; Plants - 50; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G70900.1 | protein_coding | 1:26731782-26734022 | Unclear | -16.116 | 317 | 371 | 94 | 29 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G23110.4); Has 57 Blast hits to 57 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G62240.1 | protein_coding | 3:23033355-23036808 | unclear | -16.1075 | 780 | 805 | 2276 | 2247 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); zinc ion binding;nucleic acid binding (TAIR:AT2G47090.1); Has 3461 Blast hits to 1592 proteins in 298 species: Archae - 0; Bacteria - 234; Metazoa - 759; Fungi - 420; Plants - 151; Viruses - 4; Other Eukaryotes - 1893 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G52800.1 | protein_coding | 3:19569256-19570710 | Unclear | -16.1062 | 1509 | 1547 | 447 | 409 | A20/AN1-like zinc finger family protein A20/AN1-like zinc finger family protein;FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); A20/AN1-like zinc finger family protein (TAIR:AT2G36320.1); Has 1056 Blast hits to 1045 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 9; Plants - 478; Viruses - 6; Other Eukaryotes - 118 (source: NCBI BLink). |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT2G23430.1 | protein_coding | 2:9976590-9978090 | unclear | -16.1011 | 1961 | 1990 | 695 | 669 | Cyclin-dependent kinase inhibitor family proteinEncodes a cyclin-dependent kinase inhibitor protein thatFUNCTIONS as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. ICK1;CONTAINS InterPro DOMAIN/s: Cyclin-dependent kinase inhibitor (InterPro:IPR003175), Cyclin-dependent kinase inhibitor, plant (InterPro:IPR016701); KIP-related protein 2 (TAIR:AT3G50630.1); Has 507 Blast hits to 479 proteins in 88 species: Archae - 0; Bacteria - 19; Metazoa - 119; Fungi - 13; Plants - 208; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| XLOC_020466 | AT4G06810.1 | Ch4:10180117-10180748 | AT1G14370.1 | protein_coding | 1:4915491-4918138 | unclear | -16.095 | 1 | 23 | 54 | 27 | protein kinase 2A Encodes protein kinase APK2a. Protein is N-myristoylated. protein kinase 2A (APK2A);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); protein kinase 2B (TAIR:AT2G02800.2); Has 112844 Blast hits to 111359 proteins in 3847 species: Archae - 89; Bacteria - 13219; Metazoa - 41419; Fungi - 9318; Plants - 32676; Viruses - 341; Other Eukaryotes - 15782 (source: NCBI BLink). |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT5G08240.1 | protein_coding | 5:2650837-2652535 | unclear | -16.0904 | 500 | 529 | 204 | 174 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G23160.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_000855 | AT1G05207.1 | Ch1:5447212-5447569 | AT5G03340.1 | protein_coding | 5:809830-813293 | unclear | -16.0683 | 315 | 345 | 880 | 850 | ATPase, AAA-type, CDC48 protein ATPase, AAA-type, CDC48 protein;FUNCTIONS IN: protein binding, ATPase activity; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); cell division cycle 48 (TAIR:AT3G09840.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G05250.1 | protein_coding | 3:1495572-1497523 | unclear | -16.0364 | 232 | 255 | 814 | 791 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); Has 547 Blast hits to 545 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 229; Fungi - 32; Plants - 178; Viruses - 65; Other Eukaryotes - 43 (source: NCBI BLink). |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT3G53960.1 | protein_coding | 3:19978122-19981086 | unclear | -16.0339 | 494 | 526 | 55 | 23 | Major facilitator superfamily protein Major facilitator superfamily protein;FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: PTR2 family proton/oligopeptide symporter, conserved site (InterPro:IPR018456), Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Major facilitator superfamily protein (TAIR:AT2G37900.1); Has 6025 Blast hits to 5886 proteins in 1158 species: Archae - 0; Bacteria - 2442; Metazoa - 501; Fungi - 426; Plants - 2213; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink). |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT1G08940.1 | protein_coding | 1:2877430-2879169 | unclear | -16.0279 | 830 | 868 | 614 | 579 | Phosphoglycerate mutase family proteinPhosphoglycerate mutase family protein;FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Histidine phosphatase superfamily, clade-1 (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase, active site (InterPro:IPR001345); Phosphoglycerate mutase family protein (TAIR:AT3G05170.1); Has 1152 Blast hits to 1140 proteins in 473 species: Archae - 9; Bacteria - 736; Metazoa - 2; Fungi - 189; Plants - 85; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| XLOC_022686 | AT4G06410.1 | Ch4:9386180-9387271 | AT3G14560.1 | protein_coding | 3:4889063-4890215 | unclear | -16.0276 | 384 | 410 | 290 | 266 | unknown protein; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_008571 | AT2G05215.1 | Ch2:3334410-3335689 | AT5G56140.1 | protein_coding | 5:22725238-22728473 | unclear | -16.0171 | 1059 | 1081 | 48 | 26 | RNA-binding KH domain-containing protein RNA-binding KH domain-containing protein;FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); RNA-binding KH domain-containing protein (TAIR:AT4G26480.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G62590.1 | protein_coding | 3:23147918-23150606 | unclear | -16.0146 | 819 | 848 | 1424 | 1396 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: triglyceride lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); alpha/beta-Hydrolases superfamily protein (TAIR:AT1G02660.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_001435 | AT1G26558.2 | Ch1:9175611-9177556 | AT1G73950.1 | protein_coding | 1:27799696-27804687 | unclear | -16.0112 | 674 | 707 | 134 | 99 | Transmembrane Fragile-X-F-associated protein Transmembrane Fragile-X-F-associated protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Transmembrane Fragile-X-F-associated protein (InterPro:IPR019396), Zinc finger, RING-type (InterPro:IPR001841); Transmembrane Fragile-X-F-associated protein (TAIR:AT1G18470.1); Has 2761 Blast hits to 2652 proteins in 224 species: Archae - 0; Bacteria - 0; Metazoa - 1645; Fungi - 8; Plants - 510; Viruses - 253; Other Eukaryotes - 345 (source: NCBI BLink). |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G66440.1 | protein_coding | 5:26529919-26531176 | unclear | -16.0042 | 2693 | 2709 | 42 | 26 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G34560.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_013837 | Ch3:3867698-3868357 | AT2G31100.1 | nontranslating_CDS | 2:13256738-13258176 | unclear | -16.0238 | 270 | 291 | 1212 | 1191 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: triglyceride lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: petal, leaf whorl, sepal, flower, cultured cell; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); alpha/beta-Hydrolases superfamily protein (TAIR:AT1G06250.1); Has 1135 Blast hits to 1126 proteins in 219 species: Archae - 0; Bacteria - 221; Metazoa - 9; Fungi - 172; Plants - 627; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). | |
| XLOC_031136 | Ch5:12134033-12135228 | AT3G25655.1 | protein_coding | 3:9337431-9338075 | unclear | -16.0318 | 587 | 625 | 93 | 56 | inflorescence deficient in abscission (IDA)-like 1 Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. inflorescence deficient in abscission (IDA)-like 1 (IDL1);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: floral organ abscission; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT2G44430.1 | protein_coding | 2:18333370-18336364 | unclear | -16.0389 | 108 | 155 | 1701 | 1657 | DNA-binding bromodomain-containing protein DNA-binding bromodomain-containing protein;FUNCTIONS IN: DNA binding; EXPRESSED IN: stem, male gametophyte, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Bromodomain (InterPro:IPR001487), MYB-like (InterPro:IPR017877); DNA-binding bromodomain-containing protein (TAIR:AT3G60110.1); Has 27183 Blast hits to 17808 proteins in 1233 species: Archae - 48; Bacteria - 2443; Metazoa - 11960; Fungi - 2852; Plants - 1222; Viruses - 306; Other Eukaryotes - 8352 (source: NCBI BLink). | |
| XLOC_024070 | Ch4:3092474-3093625 | AT1G68795.1 | protein_coding | 1:25840626-25841686 | unclear | -16.0617 | 646 | 692 | 477 | 419 | CLAVATA3/ESR-RELATED 12 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. CLAVATA3/ESR-RELATED 12 (CLE12); CLAVATA3/ESR-RELATED 13 (TAIR:AT1G73965.1); Has 65 Blast hits to 65 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001570 | Ch1:10056009-10056945 | AT3G12977.1 | protein_coding | 3:4143524-4146037 | unclear | -16.0626 | 426 | 449 | 800 | 777 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 1 (TAIR:AT1G56010.2); Has 2993 Blast hits to 2988 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2989; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_019396 | Ch3:13406889-13407945 | AT4G27260.1 | protein_coding | 4:13653579-13656285 | unclear | -16.085 | 465 | 508 | 2155 | 2107 | Auxin-responsive GH3 family proteinencodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). WES1;CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); Auxin-responsive GH3 family protein (TAIR:AT5G54510.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_031151 | Ch5:20148160-20148830 | AT1G28760.1 | protein_coding | 1:10103081-10104883 | unclear | -16.0858 | 400 | 423 | 29 | 6 | Uncharacterized conserved protein (DUF2215) Uncharacterized conserved protein (DUF2215);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2215 (InterPro:IPR019358); Uncharacterized conserved protein (DUF2215) (TAIR:AT3G49840.1); Has 153 Blast hits to 153 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_031142 | Ch5:13625843-13626916 | AT1G11765.1 | protein_coding | 1:3973874-3974594 | unclear | -16.1294 | 247 | 292 | 620 | 576 | Plant self-incompatibility protein S1 family Plant self-incompatibility protein S1 family;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); Plant self-incompatibility protein S1 family (TAIR:AT3G26880.1); Has 176 Blast hits to 174 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT5G58730.1 | protein_coding | 5:23723404-23725585 | unclear | -16.1406 | 546 | 579 | 601 | 569 | pfkB-like carbohydrate kinase family protein pfkB-like carbohydrate kinase family protein;CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611), Carbohydrate/puine kinase, PfkB, conserved site (InterPro:IPR002173); pfkB-like carbohydrate kinase family protein (TAIR:AT4G10260.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013211 | Ch2:6209444-6210098 | AT3G28580.1 | protein_coding | 3:10715597-10717393 | Unclear | -16.1461 | 198 | 231 | 1623 | 1577 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); AAA-ATPase 1 (TAIR:AT5G40010.1); Has 26015 Blast hits to 22183 proteins in 2894 species: Archae - 1297; Bacteria - 7409; Metazoa - 4737; Fungi - 2999; Plants - 2564; Viruses - 69; Other Eukaryotes - 6940 (source: NCBI BLink). | |
| XLOC_024076 | Ch4:3950404-3951724 | AT1G30040.1 | protein_coding | 1:10537457-10540044 | unclear | -16.1758 | 237 | 260 | 1228 | 1203 | gibberellin 2-oxidaseEncodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities.gibberellin 2-oxidase (GA2OX2);CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); gibberellin 2-oxidase 3 (TAIR:AT2G34555.1); Has 8540 Blast hits to 8490 proteins in 994 species: Archae - 0; Bacteria - 1137; Metazoa - 84; Fungi - 1033; Plants - 4909; Viruses - 0; Other Eukaryotes - 1377 (source: NCBI BLink). | |
| XLOC_012606 | Ch2:16025441-16028648 | AT4G22740.1 | protein_coding | 4:11943849-11946139 | unclear | -16.1833 | 590 | 613 | 115 | 86 | glycine-rich protein glycine-rich protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Myelodysplasia-myeloid leukemia factor 1-interacting protein (InterPro:IPR019376); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G45380.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT3G12740.1 | protein_coding | 3:4049309-4051775 | unclear | -16.2249 | 590 | 674 | 248 | 134 | ALA-interacting subunit 1 Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. ALA-interacting subunit 1 (ALIS1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein (TAIR:AT1G54320.1); Has 864 Blast hits to 864 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 252; Fungi - 234; Plants - 160; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). | |
| XLOC_001726 | Ch1:10966845-10968845 | AT4G36900.1 | protein_coding | 4:17388649-17389862 | unclear | -16.2387 | 1836 | 1862 | 574 | 541 | related to AP2 10 encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The proteinCONTAINS one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. related to AP2 10 (RAP2.10);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); DREB and EAR motif protein 3 (TAIR:AT2G23340.1); Has 5719 Blast hits to 5612 proteins in 252 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 0; Plants - 5703; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT2G23450.2 | protein_coding | 2:9988678-9992010 | unclear | -16.2494 | 267 | 288 | 199 | 176 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), EGF-like (InterPro:IPR006210), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G66790.1); Has 113981 Blast hits to 112485 proteins in 3193 species: Archae - 103; Bacteria - 12981; Metazoa - 41291; Fungi - 9532; Plants - 32683; Viruses - 360; Other Eukaryotes - 17031 (source: NCBI BLink). | |
| XLOC_005442 | Ch1:7892602-7894638 | AT5G22290.1 | protein_coding | 5:7375839-7377776 | unclear | -16.2534 | 733 | 773 | 478 | 444 | NAC domain containing protein 89Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. NAC domain containing protein 89 (NAC089);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 60 (TAIR:AT3G44290.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_025629 | Ch5:10615185-10617881 | AT3G61180.1 | protein_coding | 3:22645492-22647765 | unclear | -16.3249 | 62 | 93 | 1399 | 1365 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); Zinc finger, C3HC4 type (RING finger) family protein (TAIR:AT4G11680.1); Has 9287 Blast hits to 9262 proteins in 268 species: Archae - 0; Bacteria - 6; Metazoa - 2550; Fungi - 691; Plants - 4858; Viruses - 35; Other Eukaryotes - 1147 (source: NCBI BLink). | |
| XLOC_005057 | Ch1:5265681-5268418 | AT1G73220.1 | protein_coding | 1:27538190-27540235 | unclear | -16.3453 | 1160 | 1202 | 455 | 407 | organic cation/carnitine transporter1 organic cation/carnitine transporter1 (1-Oct);FUNCTIONS IN: carnitine transporter activity, carbohydrate transmembrane transporter activity, transporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Major facilitator superfamily (InterPro:IPR020846), General substrate transporter (InterPro:IPR005828), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); organic cation/carnitine transporter 2 (TAIR:AT1G79360.1); Has 16805 Blast hits to 16754 proteins in 1584 species: Archae - 351; Bacteria - 7847; Metazoa - 4511; Fungi - 2312; Plants - 1172; Viruses - 0; Other Eukaryotes - 612 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT5G06560.1 | protein_coding | 5:2003304-2006347 | unclear | -16.3485 | 1439 | 1457 | 169 | 149 | Protein ofunknown function, DUF593 Protein ofunknown function, DUF593;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF593 (InterPro:IPR007656); Protein ofunknown function, DUF593 (TAIR:AT3G11850.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_017765 | Ch3:9570313-9572031 | AT3G07870.1 | protein_coding | 3:2510570-2512479 | unclear | -16.3572 | 521 | 546 | 34 | 3 | F-box and associated interaction domains-containing protein F-box and associated interaction domains-containing protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); F-box and associated interaction domains-containing protein (TAIR:AT3G23880.1); Has 2008 Blast hits to 1989 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2006; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_024098 | Ch4:16891225-16892077 | AT3G12400.1 | protein_coding | 3:3943760-3945863 | unclear | -16.3725 | 351 | 369 | 852 | 834 | Ubiquitin-conjugating enzyme/RWD-like protein Mutants of this gene were initially identified because of the trichome morphogenesis phenotype. Those trichomes have multiple nuclei, a defect that turns out not to be restricted to the trichomes but also in all endoreduplicating cell types. This gene encodes a ubiquitin-binding protein with sequence similarities with yeast proteins that are components of the ESCRTI-III complexes. The Arabidopsis protein is found associated with the endosome. ELC;CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Tumour susceptibility gene 101 (InterPro:IPR008883), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), Steadiness box (InterPro:IPR017916); ELCH-like (TAIR:AT5G13860.1); Has 587 Blast hits to 537 proteins in 178 species: Archae - 0; Bacteria - 3; Metazoa - 278; Fungi - 177; Plants - 63; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). | |
| XLOC_022789 | Ch4:10093250-10095083 | AT1G73680.2 | protein_coding | 1:27703944-27707657 | unclear | -16.3891 | 1054 | 1082 | 1577 | 1551 | alpha dioxygenase Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. alpha dioxygenase (ALPHA DOX2);CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Haem peroxidase, animal (InterPro:IPR002007); Peroxidase superfamily protein (TAIR:AT3G01420.1). | |
| XLOC_010920 | Ch2:1382580-1383626 | AT3G20310.1 | protein_coding | 3:7084727-7086894 | unclear | -16.4005 | 672 | 697 | 41 | 9 | ethylene response factor 7 Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The proteinCONTAINS one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. ethylene response factor 7 (ERF7);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); ethylene responsive element binding factor 3 (TAIR:AT1G50640.1); Has 5826 Blast hits to 5594 proteins in 245 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5816; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT3G15040.1 | protein_coding | 3:5064704-5066745 | unclear | -16.4099 | 652 | 670 | 540 | 522 | Protein ofunknown function, DUF584 Protein ofunknown function, DUF584;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF584 (InterPro:IPR007608); Protein ofunknown function, DUF584 (TAIR:AT4G21970.1); Has 2569 Blast hits to 543 proteins in 84 species: Archae - 0; Bacteria - 28; Metazoa - 187; Fungi - 69; Plants - 343; Viruses - 0; Other Eukaryotes - 1942 (source: NCBI BLink). | |
| XLOC_001726 | Ch1:10966845-10968845 | AT4G27390.1 | protein_coding | 4:13703139-13704774 | unclear | -16.4383 | 1832 | 1881 | 327 | 264 | unknown protein; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT3G52810.1 | protein_coding | 3:19570961-19573733 | unclear | -16.4828 | 741 | 760 | 150 | 131 | purple acid phosphatase 21 purple acid phosphatase 21 (PAP21);FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: petal, leaf whorl, fruit, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); purple acid phosphatase 22 (TAIR:AT3G52820.1); Has 2230 Blast hits to 2213 proteins in 478 species: Archae - 3; Bacteria - 838; Metazoa - 257; Fungi - 79; Plants - 752; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT3G13772.1 | protein_coding | 3:4521532-4524674 | unclear | -16.5043 | 621 | 644 | 1561 | 1537 | transmembrane nine 7 Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Overexpression of this protein in yeast alters copper and zinc homeostasis. transmembrane nine 7 (TMN7); INVOLVED IN: cellular copper ion homeostasis, cellular zinc ion homeostasis; LOCATED IN: integral to membrane, Golgi apparatus, nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); Endomembrane protein 70 protein family (TAIR:AT1G55130.1); Has 1568 Blast hits to 1544 proteins in 321 species: Archae - 0; Bacteria - 1; Metazoa - 615; Fungi - 232; Plants - 456; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink). | |
| XLOC_019396 | Ch3:13406889-13407945 | AT1G80160.1 | protein_coding | 1:30150897-30152614 | unclear | -16.5822 | 483 | 503 | 806 | 787 | Lactoylglutathione lyase / glyoxalase I family proteinLactoylglutathione lyase / glyoxalase I family protein;CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Lactoylglutathione lyase / glyoxalase I family protein (TAIR:AT1G15380.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001570 | Ch1:10056009-10056945 | AT1G28270.1 | protein_coding | 1:9882951-9884189 | unclear | -16.6508 | 340 | 363 | 715 | 692 | ralf-like 4Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. ralf-like 4 (RALFL4);CONTAINS InterPro DOMAIN/s: Rapid ALkalinization Factor (InterPro:IPR008801); ralf-like 19 (TAIR:AT2G33775.1); Has 245 Blast hits to 245 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 243; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT2G32660.1 | protein_coding | 2:13853699-13856297 | unclear | -16.6622 | 261 | 289 | 2077 | 2043 | receptor like protein 22 receptor like protein 22 (RLP22);CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 27 (TAIR:AT2G33060.1); Has 72946 Blast hits to 23279 proteins in 925 species: Archae - 37; Bacteria - 3607; Metazoa - 12485; Fungi - 751; Plants - 51027; Viruses - 14; Other Eukaryotes - 5025 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT1G12320.1 | protein_coding | 1:4186624-4190342 | unclear | -16.7148 | 267 | 291 | 72 | 46 | Protein ofunknown function (DUF1442) Protein ofunknown function (DUF1442);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1442 (InterPro:IPR009902); Protein ofunknown function (DUF1442) (TAIR:AT1G62840.1); Has 98 Blast hits to 98 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G20460.1 | protein_coding | 4:11029736-11032677 | unclear | -16.7253 | 735 | 784 | 277 | 241 | NAD(P)-binding Rossmann-fold superfamily protein NAD(P)-binding Rossmann-fold superfamily protein;FUNCTIONS IN: coenzyme binding, UDP-glucose 4-epimerase activity, binding, catalytic activity; INVOLVED IN: galactose metabolic process, cellular metabolic process, nucleotide-sugar metabolic process, metabolic process; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040), UDP-glucose 4-epimerase (InterPro:IPR005886); NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT1G30620.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT5G16110.1 | protein_coding | 5:5260522-5262840 | unclear | -16.7637 | 601 | 676 | 320 | 280 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G02555.1); Has 133 Blast hits to 133 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 133; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_031151 | Ch5:20148160-20148830 | AT5G25350.1 | protein_coding | 5:8794252-8797349 | unclear | -16.8232 | 462 | 512 | 117 | 66 | EIN3-binding F box protein 2 Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. EIN3-binding F box protein 2 (EBF2);CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); EIN3-binding F box protein 1 (TAIR:AT2G25490.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_016650 | Ch3:2189530-2192451 | AT3G50650.1 | protein_coding | 3:18806139-18808243 | unclear | -16.9019 | 539 | 555 | 1542 | 1526 | GRAS family transcription factor GRAS family transcription factor;CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT5G66770.1); Has 2907 Blast hits to 2857 proteins in 413 species: Archae - 0; Bacteria - 24; Metazoa - 184; Fungi - 97; Plants - 2517; Viruses - 13; Other Eukaryotes - 72 (source: NCBI BLink). | |
| XLOC_016650 | Ch3:2189530-2192451 | AT4G38360.2 | protein_coding | 4:17967050-17969958 | unclear | -16.9041 | 1279 | 1303 | 389 | 365 | Protein ofunknown function (DUF300) Protein ofunknown function (DUF300); INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF300 (InterPro:IPR005178); Protein ofunknown function (DUF300) (TAIR:AT1G77220.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_031123 | Ch5:11401121-11401714 | AT5G54870.1 | protein_coding | 5:22289104-22291859 | unclear | -16.9122 | 555 | 593 | 771 | 729 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G27020.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT5G03470.1 | protein_coding | 5:866339-869252 | unclear | -16.9389 | 602 | 645 | 52 | 21 | Protein phosphatase 2A regulatory B subunit family protein Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.ATB' ALPHA;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT3G09880.1); Has 1194 Blast hits to 1162 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 571; Fungi - 171; Plants - 302; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). | |
| XLOC_011023 | Ch2:2893864-2896523 | AT5G07790.1 | protein_coding | 5:2483123-2486531 | unclear | -16.975 | 260 | 323 | 1110 | 1053 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G61300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_031137 | Ch5:12144798-12145822 | AT2G16500.1 | protein_coding | 2:7150514-7153430 | unclear | -16.9905 | 625 | 665 | 655 | 604 | arginine decarboxylase 1Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1CONTAINS 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. arginine decarboxylase 1 (ADC1);CONTAINS InterPro DOMAIN/s: Orn/DAP/Arg decarboxylase 2, C-terminal (InterPro:IPR022643), Orn/DAP/Arg decarboxylase 2, conserved site (InterPro:IPR022657), Orn/DAP/Arg decarboxylase 2, pyridoxal-phosphate binding site (InterPro:IPR022653), Ornithine/DAP/Arg decarboxylase (InterPro:IPR000183), Arginine decarboxylase (InterPro:IPR002985), Orn/DAP/Arg decarboxylase 2, N-terminal (InterPro:IPR022644); arginine decarboxylase 2 (TAIR:AT4G34710.2); Has 7460 Blast hits to 7389 proteins in 2069 species: Archae - 108; Bacteria - 5016; Metazoa - 91; Fungi - 35; Plants - 637; Viruses - 2; Other Eukaryotes - 1571 (source: NCBI BLink). | |
| XLOC_024070 | Ch4:3092474-3093625 | AT3G51730.1 | protein_coding | 3:19186666-19188733 | Unclear | -17.0068 | 602 | 629 | 193 | 166 | saposin B domain-containing protein saposin B domain-containing protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139), Saposin-like (InterPro:IPR011001), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138); saposin B domain-containing protein (TAIR:AT5G01800.1); Has 951 Blast hits to 460 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 738; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT4G19645.1 | protein_coding | 4:10689758-10692831 | unclear | -17.0378 | 552 | 592 | 168 | 135 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing proteinTRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: integral to membrane;CONTAINS InterPro DOMAIN/s: TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein (TAIR:AT1G31300.2); Has 553 Blast hits to 553 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 150; Plants - 160; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). | |
| XLOC_031142 | Ch5:13625843-13626916 | AT3G04520.1 | protein_coding | 3:1217174-1219847 | unclear | -17.0967 | 271 | 298 | 355 | 324 | threonine aldolase 2 Encodes a threonine aldolase, involved in threonine degradation to glycine. Expressed in vascular tissue through out the plant. threonine aldolase 2 (THA2);CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aromatic amino acid beta-eliminating lyase/threonine aldolase (InterPro:IPR001597), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); threonine aldolase 1 (TAIR:AT1G08630.4); Has 4083 Blast hits to 4076 proteins in 1195 species: Archae - 22; Bacteria - 2430; Metazoa - 91; Fungi - 241; Plants - 97; Viruses - 0; Other Eukaryotes - 1202 (source: NCBI BLink). | |
| XLOC_010824 | Ch2:612785-614695 | AT1G72770.1 | protein_coding | 1:27389948-27393327 | unclear | -17.1533 | 541 | 563 | 2310 | 2288 | HYPERSENSITIVE TO ABA1 mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. homology to ABI1 (HAB1);FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); homology to ABI2 (TAIR:AT1G17550.1); Has 6788 Blast hits to 6778 proteins in 499 species: Archae - 4; Bacteria - 382; Metazoa - 1655; Fungi - 745; Plants - 2728; Viruses - 7; Other Eukaryotes - 1267 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT5G57050.1 | protein_coding | 5:23087122-23089631 | Unclear | -17.2016 | 270 | 296 | 1626 | 1600 | Protein phosphatase 2C family proteinEncodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. ABA INSENSITIVE 2 (ABI2);CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT4G26080.1); Has 6785 Blast hits to 6667 proteins in 423 species: Archae - 6; Bacteria - 246; Metazoa - 1749; Fungi - 768; Plants - 2698; Viruses - 7; Other Eukaryotes - 1311 (source: NCBI BLink). | |
| XLOC_024070 | Ch4:3092474-3093625 | AT2G16740.1 | protein_coding | 2:7267722-7269055 | unclear | -17.2254 | 219 | 259 | 119 | 63 | ubiquitin-conjugating enzyme 29 ubiquitin-conjugating enzyme 29 (UBC29);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquitin-conjugating enzyme 10 (TAIR:AT5G53300.4); Has 10587 Blast hits to 10548 proteins in 402 species: Archae - 0; Bacteria - 4; Metazoa - 4577; Fungi - 2332; Plants - 1935; Viruses - 23; Other Eukaryotes - 1716 (source: NCBI BLink). | |
| XLOC_020392 | Ch4:9665049-9666099 | AT2G40000.1 | protein_coding | 2:16700490-16702336 | unclear | -17.2299 | 0 | 24 | 182 | 154 | ortholog of sugar beet HS1 PRO-1 2 ortholog of sugar beet HS1 PRO-1 2 (HSPRO2);CONTAINS InterPro DOMAIN/s: Hs1pro-1, C-terminal (InterPro:IPR009743), Hs1pro-1, N-terminal (InterPro:IPR009869); Hs1pro-1 protein (TAIR:AT3G55840.1); Has 71 Blast hits to 71 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
| XLOC_010824 | Ch2:612785-614695 | AT4G40020.1 | protein_coding | 4:18553168-18555355 | unclear | -17.2336 | 514 | 581 | 1308 | 1245 | Myosin heavy chain-related protein Myosin heavy chain-related protein; Plant protein ofunknown function (DUF827) (TAIR:AT5G16730.1); Has 160438 Blast hits to 85353 proteins in 3205 species: Archae - 2021; Bacteria - 26641; Metazoa - 65466; Fungi - 13044; Plants - 8368; Viruses - 589; Other Eukaryotes - 44309 (source: NCBI BLink). | |
| XLOC_019396 | Ch3:13406889-13407945 | AT5G50040.1 | protein_coding | 5:20356876-20358381 | unclear | -17.326 | 137 | 185 | 214 | 178 | Plant invertase/pectin methylesterase inhibitor superfamily protein Plant invertase/pectin methylesterase inhibitor superfamily protein;FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); Plant invertase/pectin methylesterase inhibitor superfamily protein (TAIR:AT5G50050.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT2G07687.1 | protein_coding | 2:3311654-3312651 | unclear | -17.3695 | 642 | 704 | 332 | 281 | Cytochrome c oxidase, subunit IIICytochrome c oxidase, subunit III;FUNCTIONS IN: cytochrome-c oxidase activity; INVOLVED IN: mitochondrial electron transport, cytochrome c to oxygen; LOCATED IN: membrane;CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit III (InterPro:IPR000298); cytochrome c oxidase subunit 3 (TAIR:ATMG00730.1); Has 29038 Blast hits to 29025 proteins in 5946 species: Archae - 74; Bacteria - 4466; Metazoa - 19232; Fungi - 401; Plants - 673; Viruses - 0; Other Eukaryotes - 4192 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT2G23430.1 | protein_coding | 2:9976590-9978090 | unclear | -17.3998 | 270 | 302 | 687 | 645 | Cyclin-dependent kinase inhibitor family proteinEncodes a cyclin-dependent kinase inhibitor protein thatFUNCTIONS as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. ICK1;CONTAINS InterPro DOMAIN/s: Cyclin-dependent kinase inhibitor (InterPro:IPR003175), Cyclin-dependent kinase inhibitor, plant (InterPro:IPR016701); KIP-related protein 2 (TAIR:AT3G50630.1); Has 507 Blast hits to 479 proteins in 88 species: Archae - 0; Bacteria - 19; Metazoa - 119; Fungi - 13; Plants - 208; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT4G34990.1 | protein_coding | 4:16661101-16662549 | unclear | -17.421 | 1435 | 1454 | 21 | 2 | myb domain protein 32 Member of the R2R3 factor gene family. myb domain protein 32 (MYB32);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 7 (TAIR:AT2G16720.1); Has 9023 Blast hits to 8385 proteins in 476 species: Archae - 0; Bacteria - 0; Metazoa - 680; Fungi - 473; Plants - 6077; Viruses - 3; Other Eukaryotes - 1790 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT1G74010.1 | protein_coding | 1:27832095-27834207 | unclear | -17.4286 | 3195 | 3212 | 135 | 118 | Calcium-dependent phosphotriesterase superfamily protein Calcium-dependent phosphotriesterase superfamily protein;FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: biosynthetic process; LOCATED IN: plant-type cell wall; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); strictosidine synthase 2 (TAIR:AT1G74020.1); Has 953 Blast hits to 943 proteins in 185 species: Archae - 1; Bacteria - 180; Metazoa - 219; Fungi - 0; Plants - 462; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G36820.1 | protein_coding | 4:17346805-17348265 | unclear | -17.4394 | 723 | 779 | 79 | 25 | Protein ofunknown function (DUF607) Protein ofunknown function (DUF607);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF607 (InterPro:IPR006769); Protein ofunknown function (DUF607) (TAIR:AT2G23790.1); Has 370 Blast hits to 370 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 148; Fungi - 54; Plants - 129; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT3G23790.1 | protein_coding | 3:8575051-8581331 | unclear | -17.4614 | 3186 | 3212 | 58 | 27 | AMP-dependent synthetase and ligase family protein acyl activating enzyme 16 (AAE16);FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding (InterPro:IPR020459), AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); acyl-activating enzyme 15 (TAIR:AT4G14070.1); Has 72182 Blast hits to 54949 proteins in 3465 species: Archae - 1133; Bacteria - 50819; Metazoa - 2739; Fungi - 2717; Plants - 2582; Viruses - 1; Other Eukaryotes - 12191 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT5G63490.1 | protein_coding | 5:25418594-25422466 | unclear | -17.4696 | 108 | 144 | 1550 | 1520 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing proteinCBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Cystathionine beta-synthase, core (InterPro:IPR000644); CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein (TAIR:AT5G50530.1); Has 8040 Blast hits to 6478 proteins in 1504 species: Archae - 1004; Bacteria - 5599; Metazoa - 7; Fungi - 119; Plants - 199; Viruses - 0; Other Eukaryotes - 1112 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT5G47060.1 | protein_coding | 5:19116719-19118744 | unclear | -17.533 | 1435 | 1458 | 31 | 9 | Protein ofunknown function (DUF581) Protein ofunknown function (DUF581);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF581 (InterPro:IPR007650); Protein ofunknown function (DUF581) (TAIR:AT4G17670.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT1G79270.1 | protein_coding | 1:29815470-29819678 | unclear | -17.5332 | 98 | 169 | 405 | 340 | evolutionarily conserved C-terminal region 8 evolutionarily conserved C-terminal region 8 (ECT8);CONTAINS InterPro DOMAIN/s: YTH domain (InterPro:IPR007275); evolutionarily conserved C-terminal region 6 (TAIR:AT3G17330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G25030.1 | protein_coding | 4:12864452-12866827 | unclear | -17.5626 | 743 | 774 | 46 | 21 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G45410.3); Has 125 Blast hits to 125 proteins in 36 species: Archae - 2; Bacteria - 31; Metazoa - 0; Fungi - 4; Plants - 88; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT5G35200.1 | protein_coding | 5:13462155-13466150 | unclear | -17.5723 | 621 | 674 | 96 | 52 | ENTH/ANTH/VHS superfamily proteinENTH/ANTH/VHS superfamily protein;FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); ENTH/ANTH/VHS superfamily protein (TAIR:AT2G01600.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT3G12750.1 | protein_coding | 3:4051651-4053201 | unclear | -17.6188 | 120 | 155 | 942 | 906 | zinc transporter 1 precursor A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. zinc transporter 1 precursor (ZIP1);FUNCTIONS IN: zinc ion transmembrane transporter activity; INVOLVED IN: response to zinc ion, zinc ion transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc/iron permease, fungal/plant (InterPro:IPR004698), Zinc/iron permease (InterPro:IPR003689); zinc transporter 5 precursor (TAIR:AT1G05300.1); Has 2022 Blast hits to 1850 proteins in 281 species: Archae - 0; Bacteria - 109; Metazoa - 565; Fungi - 630; Plants - 510; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT5G04340.1 | protein_coding | 5:1216058-1217362 | unclear | -17.6631 | 3144 | 3207 | 333 | 283 | zinc finger of Arabidopsis thaliana 6 putative c2h2 zinc finger transcription factor mRNA, zinc finger of Arabidopsis thaliana 6 (ZAT6);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); salt tolerance zinc finger (TAIR:AT1G27730.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT5G13160.1 | protein_coding | 5:4176506-4180009 | unclear | -17.7181 | 1435 | 1459 | 70 | 43 | Protein kinase superfamily protein Mutant is defective in perception of Pseudomonas syringae avirulence gene avrPphB. Encodes a putative serine-threonine kinase. avrPphB susceptible 1 (PBS1);FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, kinase activity; INVOLVED IN: defense response to bacterium, incompatible interaction, protein amino acid autophosphorylation, N-terminal protein myristoylation, defense response; LOCATED IN: microsome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT5G18610.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT5G10480.3 | protein_coding | 5:3297804-3300165 | unclear | -17.7703 | 457 | 524 | 60 | 4 | Protein-tyrosine phosphatase-like, PTPLA Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids).PASTICCINO 2 (PAS2);CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase-like, PTPLA (InterPro:IPR007482); Protein-tyrosine phosphatase-like, PTPLA (TAIR:AT5G59770.1). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT3G55430.1 | protein_coding | 3:20549423-20552215 | Unclear | -17.7852 | 3186 | 3220 | 253 | 227 | O-Glycosyl hydrolases family 17 protein O-Glycosyl hydrolases family 17 protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); glycosyl hydrolase family 17 protein (TAIR:AT2G39640.1); Has 2877 Blast hits to 2804 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 42; Plants - 2822; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_019394 | Ch3:12249462-12250360 | AT5G57655.2 | protein_coding | 5:23346675-23350065 | Unclear | -17.8572 | 82 | 119 | 325 | 292 | xylose isomerase family protein xylose isomerase family protein;FUNCTIONS IN: xylose isomerase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Xylose isomerase-like, TIM barrel domain (InterPro:IPR013022), Xylose isomerase, bacterial type (InterPro:IPR013452), Xylose isomerase (InterPro:IPR001998), Xylose isomerase, TIM barrel domain (InterPro:IPR012307); Has 2515 Blast hits to 2515 proteins in 856 species: Archae - 2; Bacteria - 1880; Metazoa - 11; Fungi - 2; Plants - 82; Viruses - 0; Other Eukaryotes - 538 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT1G08290.1 | protein_coding | 1:2609996-2613377 | unclear | -17.859 | 259 | 291 | 519 | 489 | WIP domain protein 3 WIP domain protein 3 (WIP3);CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); WIP domain protein 5 (TAIR:AT1G51220.1); Has 40394 Blast hits to 17903 proteins in 213 species: Archae - 0; Bacteria - 0; Metazoa - 38493; Fungi - 119; Plants - 685; Viruses - 0; Other Eukaryotes - 1097 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT5G43900.3 | protein_coding | 5:17656894-17667451 | unclear | -17.8818 | 130 | 159 | 167 | 140 | myosin 2Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. myosin 2 (MYA2);CONTAINS InterPro DOMAIN/s: Dil domain (InterPro:IPR018444), Dilute (InterPro:IPR002710), Myosin, N-terminal, SH3-like (InterPro:IPR004009), Myosin head, motor domain (InterPro:IPR001609), IQ calmodulin-binding region (InterPro:IPR000048); myosin XI B (TAIR:AT1G04160.1). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT4G20460.1 | protein_coding | 4:11029736-11032677 | unclear | -17.8941 | 1435 | 1454 | 167 | 148 | NAD(P)-binding Rossmann-fold superfamily protein NAD(P)-binding Rossmann-fold superfamily protein;FUNCTIONS IN: coenzyme binding, UDP-glucose 4-epimerase activity, binding, catalytic activity; INVOLVED IN: galactose metabolic process, cellular metabolic process, nucleotide-sugar metabolic process, metabolic process; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040), UDP-glucose 4-epimerase (InterPro:IPR005886); NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT1G30620.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005057 | Ch1:5265681-5268418 | AT2G29060.1 | protein_coding | 2:12481664-12484420 | unclear | -17.9099 | 587 | 652 | 1987 | 1923 | GRAS family transcription factor GRAS family transcription factor;CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); SCARECROW-like 14 (TAIR:AT1G07530.1); Has 4860 Blast hits to 2426 proteins in 308 species: Archae - 0; Bacteria - 15; Metazoa - 0; Fungi - 0; Plants - 4833; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT5G40690.1 | protein_coding | 5:16290386-16291713 | unclear | -18.0333 | 201 | 246 | 525 | 478 | CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G41730.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G05050.1 | protein_coding | 4:2588004-2589437 | unclear | -18.035 | 730 | 764 | 930 | 900 | ubiquitin 11 polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene.ubiquitin 11 (UBQ11);CONTAINS InterPro DOMAIN/s: Ubiquitin subgroup (InterPro:IPR019956), Ubiquitin conserved site (InterPro:IPR019954), Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955); polyubiquitin 10 (TAIR:AT4G05320.4); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT2G23320.1 | protein_coding | 2:9924886-9926372 | unclear | -18.097 | 640 | 683 | 255 | 219 | WRKY DNA-binding protein 15Encodes WRKY DNA-binding protein 15 (WRKY15). WRKY DNA-binding protein 15 (WRKY15);CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657), Transcription factor, WRKY, Zn-cluster (InterPro:IPR018872); WRKY DNA-binding protein 11 (TAIR:AT4G31550.1); Has 3350 Blast hits to 2896 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 1; Plants - 3315; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). | |
| XLOC_005057 | Ch1:5265681-5268418 | AT2G40340.1 | protein_coding | 2:16848160-16850494 | unclear | -18.1878 | 589 | 633 | 734 | 699 | Integrase-type DNA-binding superfamily protein Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The proteinCONTAINS one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. DREB2C;CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); Integrase-type DNA-binding superfamily protein (TAIR:AT2G40350.1); Has 5601 Blast hits to 5564 proteins in 248 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5583; Viruses - 4; Other Eukaryotes - 14 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT3G26000.1 | protein_coding | 3:9506778-9509302 | unclear | -18.2409 | 1435 | 1458 | 76 | 53 | Ribonuclease inhibitorRibonuclease inhibitor; RNI-like superfamily protein (TAIR:AT3G27290.1); Has 103 Blast hits to 103 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_031136 | Ch5:12134033-12135228 | AT3G02470.1 | protein_coding | 3:508886-511561 | unclear | -18.2808 | 307 | 344 | 906 | 866 | S-adenosylmethionine decarboxylase Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. S-adenosylmethionine decarboxylase (SAMDC);CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); Adenosylmethionine decarboxylase family protein (TAIR:AT5G15950.2); Has 1026 Blast hits to 1010 proteins in 271 species: Archae - 0; Bacteria - 57; Metazoa - 220; Fungi - 150; Plants - 531; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT5G44060.1 | protein_coding | 5:17731005-17732298 | unclear | -18.2836 | 601 | 676 | 63 | 9 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G04000.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013199 | Ch2:2384422-2385073 | AT5G08350.1 | protein_coding | 5:2685712-2687476 | unclear | -18.329 | 182 | 253 | 879 | 822 | GRAM domain-containing protein / ABA-responsive protein-related GRAM domain-containing protein / ABA-responsive protein-related;CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); GRAM domain-containing protein / ABA-responsive protein-related (TAIR:AT5G23370.1); Has 358 Blast hits to 358 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_024071 | Ch4:3178719-3179585 | AT4G28530.1 | protein_coding | 4:14090489-14094902 | unclear | -18.3622 | 370 | 400 | 941 | 910 | NAC domain containing protein 74 NAC domain containing protein 74 (NAC074);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC (No Apical Meristem) domain transcriptional regulator superfamily protein (TAIR:AT1G76420.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_031151 | Ch5:20148160-20148830 | AT5G66440.1 | protein_coding | 5:26529919-26531176 | unclear | -18.6355 | 391 | 435 | 42 | 1 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G34560.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT3G17410.1 | protein_coding | 3:5955862-5959214 | unclear | -18.7192 | 613 | 673 | 109 | 51 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G48210.2); Has 112711 Blast hits to 111551 proteins in 4660 species: Archae - 117; Bacteria - 13367; Metazoa - 41567; Fungi - 8923; Plants - 32528; Viruses - 331; Other Eukaryotes - 15878 (source: NCBI BLink). | |
| XLOC_024073 | Ch4:3283968-3284755 | AT1G27020.1 | protein_coding | 1:9378404-9380790 | unclear | -18.8073 | 503 | 532 | 1204 | 1173 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G27030.1); Has 514 Blast hits to 514 proteins in 175 species: Archae - 0; Bacteria - 311; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). | |
| XLOC_024071 | Ch4:3178719-3179585 | AT5G27920.1 | protein_coding | 5:9941734-9944942 | unclear | -18.9279 | 340 | 384 | 507 | 468 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); RNI-like superfamily protein (TAIR:AT5G01720.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G00940.1 | protein_coding | 4:402959-404873 | unclear | -18.9814 | 751 | 782 | 32 | 3 | Dof-type zinc finger DNA-binding family protein Dof-type zinc finger DNA-binding family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); Dof-type zinc finger DNA-binding family protein (TAIR:AT3G61850.3); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_008226 | Ch1:16637327-16637706 | AT2G35300.1 | protein_coding | 2:14862779-14863412 | unclear | -19.0788 | 220 | 272 | 48 | 1 | Late embryogenesis abundant protein, group 1 protein Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Late embryogenesis abundant protein, group 1 protein;CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 1 (InterPro:IPR005513); Late embryogenesis abundant protein, group 1 protein (TAIR:AT1G32560.1); Has 129 Blast hits to 129 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT5G08190.1 | protein_coding | 5:2635832-2637433 | unclear | -19.2553 | 271 | 300 | 568 | 537 | nuclear factor Y, subunit B12 "nuclear factor Y, subunit B12" (NF-YB12);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); nuclear factor Y, subunit B13 (TAIR:AT5G23090.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019767 | Ch4:3840791-3842075 | AT3G54680.1 | protein_coding | 3:20244284-20246080 | unclear | -19.2614 | 304 | 379 | 69 | 9 | proteophosphoglycan-related proteophosphoglycan-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4120 Blast hits to 443 proteins in 120 species: Archae - 2; Bacteria - 57; Metazoa - 120; Fungi - 93; Plants - 84; Viruses - 11; Other Eukaryotes - 3753 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT1G69260.1 | protein_coding | 1:26038905-26040720 | unclear | -19.4112 | 111 | 156 | 671 | 626 | ABI five binding protein ABI five binding protein (AFP1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1675 (InterPro:IPR012463); ABI five binding protein 2 (TAIR:AT1G13740.1); Has 267 Blast hits to 267 proteins in 42 species: Archae - 0; Bacteria - 6; Metazoa - 29; Fungi - 9; Plants - 184; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). | |
| XLOC_031142 | Ch5:13625843-13626916 | AT5G65300.1 | protein_coding | 5:26095143-26096114 | unclear | -19.4356 | 250 | 327 | 67 | 6 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013214 | Ch2:9922669-9923603 | AT5G47560.1 | protein_coding | 5:19287369-19291103 | unclear | -19.5096 | 768 | 785 | 434 | 417 | tonoplast dicarboxylate transporterEncodes a tonoplast malate/fumarate transporter. tonoplast dicarboxylate transporter (TDT);CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_031137 | Ch5:12144798-12145822 | AT5G11520.1 | protein_coding | 5:3684946-3687854 | unclear | -19.5259 | 628 | 668 | 85 | 47 | aspartate aminotransferase 3 Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. aspartate aminotransferase 3 (ASP3);FUNCTIONS IN: L-aspartate:2-oxoglutarate aminotransferase activity; INVOLVED IN: leaf senescence, nitrogen compound metabolic process; LOCATED IN: peroxisome, plastid, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferases, class-I, pyridoxal-phosphate-binding site (InterPro:IPR004838), Aspartate/other aminotransferase (InterPro:IPR000796), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); aspartate aminotransferase 2 (TAIR:AT5G19550.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT1G30620.1 | protein_coding | 1:10854517-10858280 | unclear | -19.6619 | 1433 | 1459 | 59 | 32 | NAD(P)-binding Rossmann-fold superfamily proteinEncodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. MURUS 4 (MUR4);FUNCTIONS IN: UDP-arabinose 4-epimerase activity, catalytic activity; INVOLVED IN: plant-type cell wall biogenesis, arabinose biosynthetic process, nucleotide-sugar metabolic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040), UDP-glucose 4-epimerase (InterPro:IPR005886); NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT4G20460.1); Has 42820 Blast hits to 42812 proteins in 2971 species: Archae - 775; Bacteria - 25948; Metazoa - 715; Fungi - 615; Plants - 1158; Viruses - 34; Other Eukaryotes - 13575 (source: NCBI BLink). | |
| XLOC_031142 | Ch5:13625843-13626916 | AT3G48580.1 | protein_coding | 3:18007098-18008535 | unclear | -20.285 | 244 | 297 | 65 | 3 | xyloglucan endotransglucosylase/hydrolase 11 xyloglucan endotransglucosylase/hydrolase 11 (XTH11);FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds, xyloglucan:xyloglucosyl transferase activity; INVOLVED IN: carbohydrate metabolic process, cellular glucan metabolic process; LOCATED IN: endomembrane system, apoplast, cell wall; EXPRESSED IN: embryo, pedicel, flower, carpel; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Beta-glucanase (InterPro:IPR008264), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Glycoside hydrolase, family 16 (InterPro:IPR000757); xyloglucan endotransglucosylase/hydrolase 3 (TAIR:AT3G25050.1); Has 1650 Blast hits to 1644 proteins in 223 species: Archae - 2; Bacteria - 196; Metazoa - 0; Fungi - 82; Plants - 1314; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). | |
| XLOC_024070 | Ch4:3092474-3093625 | AT5G27920.1 | protein_coding | 5:9941734-9944942 | unclear | -20.4083 | 445 | 527 | 507 | 438 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); RNI-like superfamily protein (TAIR:AT5G01720.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_009286 | Ch2:10267417-10270832 | AT4G13820.1 | protein_coding | 4:8007950-8010858 | unclear | -20.7011 | 417 | 456 | 2342 | 2303 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein;FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, hypocotyl, root, leaf; EXPRESSED DURING: LP.06 six leaves visible;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 47 (TAIR:AT4G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT5G01850.1 | protein_coding | 5:332330-334543 | unclear | -21.1498 | 629 | 674 | 45 | 2 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase, ATN1-like (InterPro:IPR015784); Protein kinase superfamily protein (TAIR:AT3G27560.1); Has 131148 Blast hits to 129643 proteins in 5072 species: Archae - 162; Bacteria - 15033; Metazoa - 49603; Fungi - 12189; Plants - 33321; Viruses - 522; Other Eukaryotes - 20318 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G24040.1 | protein_coding | 4:12488040-12491298 | unclear | -21.2048 | 729 | 787 | 243 | 189 | trehalase 1Encodes a trehalase, member of Glycoside Hydrolase Family 37. trehalase 1 (TRE1);CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 37 (InterPro:IPR001661), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 37, conserved site (InterPro:IPR018232); Has 1925 Blast hits to 1909 proteins in 569 species: Archae - 2; Bacteria - 1056; Metazoa - 507; Fungi - 235; Plants - 71; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT3G10320.1 | protein_coding | 3:3195314-3197457 | unclear | -21.4947 | 646 | 702 | 98 | 28 | Glycosyltransferase family 61 protein Glycosyltransferase family 61 protein;FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Glycosyltransferase AER61, uncharacterised (InterPro:IPR007657); Glycosyltransferase family 61 protein (TAIR:AT2G41640.1); Has 587 Blast hits to 587 proteins in 93 species: Archae - 2; Bacteria - 22; Metazoa - 130; Fungi - 6; Plants - 392; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). | |
| XLOC_024070 | Ch4:3092474-3093625 | AT2G28200.1 | protein_coding | 2:12023940-12025370 | unclear | -22.4932 | 517 | 602 | 83 | 3 | C2H2-type zinc finger family protein C2H2-type zinc finger family protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); C2H2-type zinc finger family protein (TAIR:AT5G04390.1); Has 1824 Blast hits to 1700 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 861; Fungi - 12; Plants - 927; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). | |
| XLOC_008226 | Ch1:16637327-16637706 | AT3G02140.1 | protein_coding | 3:385237-387051 | unclear | -22.8862 | 241 | 305 | 807 | 733 | AFP2 (ABI five-binding protein 2) family proteinEncodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. TWO OR MORE ABRES-CONTAINING GENE 2 (TMAC2);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1675 (InterPro:IPR012463); ABI five binding protein 3 (TAIR:AT3G29575.4); Has 163 Blast hits to 161 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 163; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT3G02150.2 | protein_coding | 3:390720-392767 | unclear | -23.0601 | 729 | 780 | 124 | 72 | plastid transcription factor 1 a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation.plastid transcription factor 1 (PTF1);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: cell differentiation, positive regulation of development, heterochronic, regulation of transcription, leaf morphogenesis; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 5 (TAIR:AT5G60970.1); Has 1452 Blast hits to 1452 proteins in 313 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 8; Plants - 1374; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | |
| XLOC_001570 | Ch1:10056009-10056945 | AT1G28650.1 | protein_coding | 1:10069365-10071108 | unclear | -23.9152 | 158 | 220 | 1068 | 1006 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: stem;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT1G28670.1); Has 3414 Blast hits to 3364 proteins in 185 species: Archae - 0; Bacteria - 266; Metazoa - 0; Fungi - 2; Plants - 3141; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | |
| XLOC_018021 | Ch3:11751847-11757079 | AT1G15110.2 | protein_coding | 1:5198940-5202315 | unclear | -24.1636 | 3164 | 3211 | 233 | 181 | phosphatidyl serine synthase family proteinPSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation.phosphatidyl serine synthase family protein;FUNCTIONS IN: CDP-diacylglycerol-serine O-phosphatidyltransferase activity; INVOLVED IN: phosphatidylserine biosynthetic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Phosphatidyl serine synthase (InterPro:IPR004277); Has 335 Blast hits to 331 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 175; Fungi - 10; Plants - 65; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). | |
| XLOC_001570 | Ch1:10056009-10056945 | AT1G28590.1 | protein_coding | 1:10047276-10049343 | unclear | -24.2485 | 447 | 493 | 824 | 776 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT2G27360.1); Has 3435 Blast hits to 3386 proteins in 204 species: Archae - 0; Bacteria - 302; Metazoa - 0; Fungi - 4; Plants - 3124; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | |
| XLOC_028786 | Ch5:7414961-7415895 | AT2G27310.1 | protein_coding | 2:11683772-11685342 | unclear | -25.3178 | 390 | 469 | 731 | 661 | F-box family protein F-box family protein; F-box family protein (TAIR:AT2G36090.1); Has 105 Blast hits to 105 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_010824 | Ch2:612785-614695 | AT2G02250.1 | protein_coding | 2:594484-595869 | unclear | -25.3615 | 390 | 443 | 942 | 888 | phloem protein 2-B2 phloem protein 2-B2 (PP2-B2);FUNCTIONS IN: carbohydrate binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); F-box family protein (TAIR:AT2G02240.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019396 | Ch3:13406889-13407945 | AT2G36630.1 | protein_coding | 2:15352491-15355330 | unclear | -26.7593 | 469 | 509 | 269 | 224 | Sulfite exporter TauE/SafE family proteinSulfite exporter TauE/SafE family protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF81 (InterPro:IPR002781); Sulfite exporter TauE/SafE family protein (TAIR:AT2G25737.1); Has 1587 Blast hits to 1517 proteins in 484 species: Archae - 83; Bacteria - 808; Metazoa - 0; Fungi - 0; Plants - 200; Viruses - 0; Other Eukaryotes - 496 (source: NCBI BLink). | |
| XLOC_010824 | Ch2:612785-614695 | AT5G51770.1 | protein_coding | 5:21030943-21033253 | unclear | -27.7914 | 500 | 571 | 1280 | 1188 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G25390.1); Has 88935 Blast hits to 72359 proteins in 3004 species: Archae - 64; Bacteria - 5807; Metazoa - 25667; Fungi - 4967; Plants - 43770; Viruses - 185; Other Eukaryotes - 8475 (source: NCBI BLink). | |
| XLOC_017765 | Ch3:9570313-9572031 | AT3G26280.1 | protein_coding | 3:9630128-9632145 | unclear | -27.9206 | 233 | 282 | 1456 | 1407 | cytochrome P450, family 71, subfamily B, polypeptide 4 cytochrome P450 monooxygenase "cytochrome P450, family 71, subfamily B, polypeptide 4" (CYP71B4);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 71, subfamily B, polypeptide 25 (TAIR:AT3G26270.1); Has 33116 Blast hits to 32807 proteins in 1665 species: Archae - 46; Bacteria - 3062; Metazoa - 12210; Fungi - 6959; Plants - 9691; Viruses - 3; Other Eukaryotes - 1145 (source: NCBI BLink). | |
| XLOC_003925 | Ch1:28787818-28789937 | AT5G54250.1 | protein_coding | 5:22025035-22030099 | Unclear | -27.958 | 89 | 186 | 246 | 141 | cyclic nucleotide-gated cation channel 4 member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent.cyclic nucleotide-gated cation channel 4 (CNGC4);CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), RmlC-like jelly roll fold (InterPro:IPR014710); Cyclic nucleotide-regulated ion channel family protein (TAIR:AT5G15410.2); Has 13099 Blast hits to 4876 proteins in 392 species: Archae - 0; Bacteria - 175; Metazoa - 8070; Fungi - 607; Plants - 1352; Viruses - 290; Other Eukaryotes - 2605 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT5G42900.1 | protein_coding | 5:17197641-17199910 | unclear | -28.6891 | 741 | 794 | 62 | 2 | cold regulated gene 27cold regulated gene 27 (COR27); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G33980.1); Has 74 Blast hits to 74 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_019408 | Ch3:15426764-15427680 | AT1G71100.1 | protein_coding | 1:26814260-26815922 | unclear | -28.9381 | 818 | 907 | 834 | 750 | Ribose 5-phosphate isomerase, type A protein Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. RADIAL SWELLING 10 (RSW10);FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: uridine biosynthetic process, response to karrikin, cellulose biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ribose 5-phosphate isomerase, type A (InterPro:IPR004788); ribose-5-phosphate isomerase 2 (TAIR:AT2G01290.1); Has 5045 Blast hits to 5045 proteins in 1956 species: Archae - 235; Bacteria - 3584; Metazoa - 111; Fungi - 145; Plants - 141; Viruses - 0; Other Eukaryotes - 829 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G01360.1 | protein_coding | 1:141870-143261 | promote | -29.7705 | 2183 | 2224 | 190 | 142 | regulatory component of ABA receptor 1 Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. FUNCTIONS as abscisic acid sensor. regulatory component of ABA receptor 1 (RCAR1);CONTAINS InterPro DOMAIN/s: Polyketide cyclase/dehydrase (InterPro:IPR019587); PYR1-like 7 (TAIR:AT4G01026.1); Has 395 Blast hits to 395 proteins in 28 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G17690.1 | protein_coding | 5:5827142-5829763 | promote | -24.7108 | 247 | 293 | 441 | 393 | like heterochromatin protein (LHP1)Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. TERMINAL FLOWER 2 (TFL2);CONTAINS InterPro DOMAIN/s: Chromo domain subgroup (InterPro:IPR017984), Chromo domain-like (InterPro:IPR016197), Chromo shadow, subgroup (InterPro:IPR018125), Chromo domain (InterPro:IPR000953); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G19890.1 | protein_coding | 4:10786557-10789070 | promote | -22.2625 | 626 | 658 | 163 | 125 | Pentatricopeptide repeat (PPR-like) superfamily protein Pentatricopeptide repeat (PPR-like) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G39710.1). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G47190.1 | protein_coding | 2:19375985-19377543 | promote | -21.6105 | 3643 | 3704 | 59 | 2 | myb domain protein 2 Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. myb domain protein 2 (MYB2);FUNCTIONS IN: calmodulin binding, DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 112 (TAIR:AT1G48000.1); Has 8762 Blast hits to 8122 proteins in 475 species: Archae - 0; Bacteria - 0; Metazoa - 719; Fungi - 467; Plants - 5817; Viruses - 4; Other Eukaryotes - 1755 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G66410.2 | protein_coding | 1:24774113-24775984 | promote | -21.2175 | 53 | 99 | 629 | 583 | calmodulin 4 Encodes a calmodulin calmodulin 4 (CAM4);CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand-like domain (InterPro:IPR011992), EF-hand (InterPro:IPR018248); calmodulin 1 (TAIR:AT5G37780.1). |
| XLOC_008744 | AT2G14878.1 | Ch2:6392167-6393042 | AT1G27450.3 | protein_coding | 1:9531809-9534141 | promote | -20.8841 | 553 | 576 | 301 | 279 | adenine phosphoribosyl transferase 1 Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. adenine phosphoribosyl transferase 1 (APT1);CONTAINS InterPro DOMAIN/s: Adenine phosphoribosyl transferase (InterPro:IPR005764), Phosphoribosyltransferase (InterPro:IPR000836); adenine phosphoribosyl transferase 3 (TAIR:AT4G22570.1). |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G29035.1 | protein_coding | 3:11033665-11035308 | promote | -20.7215 | 236 | 289 | 237 | 183 | NAC domain containing protein 3 Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. NAC domain containing protein 3 (NAC3);CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 6 (TAIR:AT5G39610.1); Has 2988 Blast hits to 2981 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2988; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G45860.1 | protein_coding | 5:18603990-18604677 | promote | -20.6393 | 1330 | 1370 | 405 | 350 | PYR1-like 11 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYR1-like 11 (PYL11);CONTAINS InterPro DOMAIN/s: Polyketide cyclase/dehydrase (InterPro:IPR019587); PYR1-like 12 (TAIR:AT5G45870.1); Has 514 Blast hits to 514 proteins in 53 species: Archae - 0; Bacteria - 8; Metazoa - 2; Fungi - 2; Plants - 502; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_028934 | AT5G24735.1 | Ch5:8468331-8469262 | AT5G03730.2 | protein_coding | 5:974360-979849 | promote | -19.422 | 448 | 472 | 614 | 591 | Protein kinase superfamily protein Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT4G24480.1); Has 126606 Blast hits to 124675 proteins in 4966 species: Archae - 112; Bacteria - 13843; Metazoa - 48138; Fungi - 11278; Plants - 33351; Viruses - 509; Other Eukaryotes - 19375 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G27110.1 | protein_coding | 3:9997808-10000230 | promote | -17.1592 | 1858 | 1901 | 1233 | 1204 | Peptidase family M48 family protein Peptidase family M48 family protein;FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M48 (InterPro:IPR001915); Has 2654 Blast hits to 2654 proteins in 909 species: Archae - 247; Bacteria - 2042; Metazoa - 0; Fungi - 12; Plants - 34; Viruses - 0; Other Eukaryotes - 319 (source: NCBI BLink). |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G20770.1 | protein_coding | 3:7260429-7263384 | promote | -16.7679 | 141 | 171 | 102 | 77 | Ethylene insensitive 3 family proteinEncodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. ETHYLENE-INSENSITIVE3 (EIN3);CONTAINS InterPro DOMAIN/s: Ethylene insensitive 3 (InterPro:IPR006957); ETHYLENE-INSENSITIVE3-like 1 (TAIR:AT2G27050.1); Has 12681 Blast hits to 4386 proteins in 108 species: Archae - 12; Bacteria - 9; Metazoa - 78; Fungi - 631; Plants - 331; Viruses - 0; Other Eukaryotes - 11620 (source: NCBI BLink). |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT1G45249.3 | protein_coding | 1:17165125-17167924 | promote | -16.6482 | 150 | 168 | 404 | 386 | abscisic acid responsive elements-binding factor 2 Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment.abscisic acid responsive elements-binding factor 2 (ABF2);CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); abscisic acid responsive elements-binding factor 3 (TAIR:AT4G34000.2). |
| XLOC_009092 | AT2G21187.1 | Ch2:9076289-9077494 | AT1G52890.1 | protein_coding | 1:19696923-19698482 | promote | -16.5969 | 262 | 293 | 997 | 968 | NAC domain containing protein 19Encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro.NAC domain containing protein 19 (NAC019);CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 3 (TAIR:AT3G15500.1); Has 3041 Blast hits to 3033 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3041; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G73500.1 | protein_coding | 1:27639091-27640643 | promote | -16.5858 | 622 | 641 | 265 | 246 | MAP kinase kinase 9member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. MAP kinase kinase 9 (MKK9);FUNCTIONS IN: protein kinase activator activity, MAP kinase kinase activity, kinase activity; INVOLVED IN: in 7 processes; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); MAP kinase kinase 7 (TAIR:AT1G18350.1); Has 126854 Blast hits to 125581 proteins in 4823 species: Archae - 172; Bacteria - 14892; Metazoa - 47012; Fungi - 12114; Plants - 31822; Viruses - 500; Other Eukaryotes - 20342 (source: NCBI BLink). |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G73000.1 | protein_coding | 1:27462983-27463968 | promote | -16.417 | 1470 | 1499 | 827 | 798 | PYR1-like 3Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYR1-like 3 (PYL3);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: carpel; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Polyketide cyclase/dehydrase (InterPro:IPR019587); PYR1-like 2 (TAIR:AT2G26040.1); Has 386 Blast hits to 386 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 386; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G50500.2 | protein_coding | 3:18741444-18744174 | promote | -16.1006 | 675 | 693 | 169 | 151 | SNF1-related protein kinase 2.2 encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. SNF1-related protein kinase 2.2 (SNRK2.2);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like, plant (InterPro:IPR015740); sucrose nonfermenting 1(SNF1)-related protein kinase 2.3 (TAIR:AT5G66880.1). |
| XLOC_031121 | Ch5:10933765-10934769 | AT3G20770.1 | protein_coding | 3:7260429-7263384 | promote | -16.3699 | 941 | 961 | 246 | 226 | Ethylene insensitive 3 family proteinEncodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. ETHYLENE-INSENSITIVE3 (EIN3);CONTAINS InterPro DOMAIN/s: Ethylene insensitive 3 (InterPro:IPR006957); ETHYLENE-INSENSITIVE3-like 1 (TAIR:AT2G27050.1); Has 12681 Blast hits to 4386 proteins in 108 species: Archae - 12; Bacteria - 9; Metazoa - 78; Fungi - 631; Plants - 331; Viruses - 0; Other Eukaryotes - 11620 (source: NCBI BLink). | |
| XLOC_012606 | Ch2:16025441-16028648 | AT1G44000.1 | protein_coding | 1:16708004-16709713 | promote | -16.797 | 1118 | 1156 | 619 | 592 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G11911.1); Has 216 Blast hits to 212 proteins in 76 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_024093 | Ch4:6209483-6211439 | AT1G69270.1 | protein_coding | 1:26040689-26042741 | promote | -17.4477 | 1426 | 1459 | 186 | 158 | receptor-like protein kinase 1 RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. receptor-like protein kinase 1 (RPK1);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); receptor-like protein kinase 2 (TAIR:AT3G02130.1); Has 135462 Blast hits to 127527 proteins in 4655 species: Archae - 122; Bacteria - 14490; Metazoa - 45605; Fungi - 10969; Plants - 44066; Viruses - 629; Other Eukaryotes - 19581 (source: NCBI BLink). | |
| XLOC_031151 | Ch5:20148160-20148830 | AT1G04620.1 | protein_coding | 1:1282163-1286619 | promote | -18.5106 | 391 | 422 | 79 | 49 | coenzyme F420 hydrogenase family / dehydrogenase, beta subunit familyEncodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a.coenzyme F420 hydrogenase family / dehydrogenase, beta subunit family;FUNCTIONS IN: coenzyme F420 hydrogenase activity; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Coenzyme F420 hydrogenase/dehydrogenase beta subunit, C-terminal (InterPro:IPR007525), Coenzyme F420 hydrogenase/dehydrogenase beta subunit, N-terminal (InterPro:IPR007516); Has 499 Blast hits to 498 proteins in 165 species: Archae - 202; Bacteria - 188; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). | |
| XLOC_022789 | Ch4:10093250-10095083 | AT1G01360.1 | protein_coding | 1:141870-143261 | promote | -19.1545 | 1026 | 1072 | 189 | 137 | regulatory component of ABA receptor 1 Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. FUNCTIONS as abscisic acid sensor. regulatory component of ABA receptor 1 (RCAR1);CONTAINS InterPro DOMAIN/s: Polyketide cyclase/dehydrase (InterPro:IPR019587); PYR1-like 7 (TAIR:AT4G01026.1); Has 395 Blast hits to 395 proteins in 28 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G08720.1 | protein_coding | 1:2773941-2779308 | delay | -26.0792 | 227 | 263 | 56 | 20 | Protein kinase superfamily protein enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum ENHANCED DISEASE RESISTANCE 1 (EDR1);FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, MAP kinase kinase kinase activity, kinase activity; INVOLVED IN: in 7 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G11850.1); Has 120792 Blast hits to 119043 proteins in 4682 species: Archae - 98; Bacteria - 12672; Metazoa - 46002; Fungi - 10646; Plants - 32815; Viruses - 475; Other Eukaryotes - 18084 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT5G64940.1 | protein_coding | 5:25948954-25953823 | delay | -23.0894 | 253 | 303 | 211 | 155 | ABC2 homolog 13 Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins. ABC2 homolog 13 (ATH13);FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT3G07700.2); Has 10051 Blast hits to 9997 proteins in 1795 species: Archae - 126; Bacteria - 4380; Metazoa - 442; Fungi - 487; Plants - 725; Viruses - 14; Other Eukaryotes - 3877 (source: NCBI BLink). |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT2G31260.1 | protein_coding | 2:13321833-13327496 | delay | -22.7362 | 90 | 152 | 88 | 33 | autophagy 9 (APG9) Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence. autophagy 9 (APG9);CONTAINS InterPro DOMAIN/s: Autophagy-related protein 9 (InterPro:IPR007241); Has 489 Blast hits to 477 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 214; Fungi - 166; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G59950.1 | protein_coding | 3:22144280-22147712 | delay | -21.5332 | 1868 | 1893 | 62 | 37 | Peptidase family C54 protein Peptidase family C54 protein;FUNCTIONS IN: peptidase activity; INVOLVED IN: autophagy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase C54 (InterPro:IPR005078); Peptidase family C54 protein (TAIR:AT2G44140.1); Has 844 Blast hits to 806 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 426; Fungi - 182; Plants - 81; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT1G01260.1 | protein_coding | 1:108946-111699 | delay | -20.7623 | 332 | 359 | 1773 | 1747 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1); Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 174; Fungi - 93; Plants - 3336; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G41310.1 | protein_coding | 2:17221840-17224880 | delay | -20.1704 | 1356 | 1382 | 871 | 847 | response regulator 3 Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. response regulator 3 (RR3);CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Signal transduction response regulator, receiver domain (InterPro:IPR001789); response regulator 9 (TAIR:AT3G57040.1); Has 36974 Blast hits to 36596 proteins in 2486 species: Archae - 189; Bacteria - 32197; Metazoa - 9; Fungi - 371; Plants - 1334; Viruses - 4; Other Eukaryotes - 2870 (source: NCBI BLink). |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G08720.1 | protein_coding | 1:2773941-2779308 | delay | -18.9357 | 181 | 217 | 251 | 219 | Protein kinase superfamily protein enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum ENHANCED DISEASE RESISTANCE 1 (EDR1);FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, MAP kinase kinase kinase activity, kinase activity; INVOLVED IN: in 7 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G11850.1); Has 120792 Blast hits to 119043 proteins in 4682 species: Archae - 98; Bacteria - 12672; Metazoa - 46002; Fungi - 10646; Plants - 32815; Viruses - 475; Other Eukaryotes - 18084 (source: NCBI BLink). |
| XLOC_009092 | AT2G21187.2 | Ch2:9076289-9077494 | AT5G52300.1 | protein_coding | 5:21237021-21239531 | delay | -18.7242 | 644 | 678 | 1831 | 1799 | CAP160 protein encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter regionCONTAINS two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. LOW-TEMPERATURE-INDUCED 65 (LTI65);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to water deprivation, response to salt stress, response to cold, abscisic acid mediated signaling pathway, response to abscisic acid stimulus; LOCATED IN: cellular_componentunknown; EXPRESSED IN: leaf, seed; EXPRESSED DURING: dry seed stage, LP.04 four leaves visible;CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); CAP160 protein (TAIR:AT4G25580.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G41310.1 | protein_coding | 2:17221840-17224880 | delay | -18.6571 | 2058 | 2083 | 549 | 522 | response regulator 3 Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. response regulator 3 (RR3);CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Signal transduction response regulator, receiver domain (InterPro:IPR001789); response regulator 9 (TAIR:AT3G57040.1); Has 36974 Blast hits to 36596 proteins in 2486 species: Archae - 189; Bacteria - 32197; Metazoa - 9; Fungi - 371; Plants - 1334; Viruses - 4; Other Eukaryotes - 2870 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G31260.1 | protein_coding | 2:13321833-13327496 | delay | -18.47 | 55 | 96 | 2846 | 2795 | autophagy 9 (APG9) Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence. autophagy 9 (APG9);CONTAINS InterPro DOMAIN/s: Autophagy-related protein 9 (InterPro:IPR007241); Has 489 Blast hits to 477 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 214; Fungi - 166; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G12570.1 | protein_coding | 4:7445278-7449205 | delay | -18.4408 | 2775 | 2811 | 2889 | 2856 | ubiquitin protein ligase 5 Knock-out mutants showed accelerated senescence of leaves. ubiquitin protein ligase 5 (UPL5);CONTAINS InterPro DOMAIN/s: Ubiquitin subgroup (InterPro:IPR019956), Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955), HECT (InterPro:IPR000569); ubiquitin-protein ligase 1 (TAIR:AT1G55860.1); Has 13201 Blast hits to 8328 proteins in 676 species: Archae - 0; Bacteria - 15; Metazoa - 6234; Fungi - 1825; Plants - 2664; Viruses - 167; Other Eukaryotes - 2296 (source: NCBI BLink). |
| XLOC_000417 | AT1G04647.1 | Ch1:2620439-2621546 | AT2G23140.1 | protein_coding | 2:9845410-9849379 | delay | -17.648 | 809 | 831 | 2022 | 2000 | RING/U-box superfamily protein with ARM repeat domain RING/U-box superfamily protein with ARM repeat domain;FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT5G67340.1); Has 11466 Blast hits to 5570 proteins in 449 species: Archae - 8; Bacteria - 346; Metazoa - 2626; Fungi - 852; Plants - 4850; Viruses - 10; Other Eukaryotes - 2774 (source: NCBI BLink). |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G17290.1 | protein_coding | 5:5686135-5689947 | delay | -16.8747 | 55 | 102 | 963 | 922 | autophagy protein Apg5 family Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. AUTOPHAGY 5 (APG5);FUNCTIONS IN: transporter activity; INVOLVED IN: autophagy, leaf senescence, response to starvation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Autophagy-related protein 5 (InterPro:IPR007239); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G36400.1 | protein_coding | 4:17197188-17200932 | delay | -16.7676 | 867 | 910 | 1320 | 1271 | FAD-linked oxidases family protein Encodes a (D)-2-hydroxyglutarate dehydrogenase. FAD-linked oxidases family protein;FUNCTIONS IN: electron carrier activity, (R)-2-hydroxyglutarate dehydrogenase activity; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); FAD-linked oxidases family protein (TAIR:AT5G06580.1); Has 16802 Blast hits to 16669 proteins in 1978 species: Archae - 280; Bacteria - 10481; Metazoa - 384; Fungi - 582; Plants - 134; Viruses - 0; Other Eukaryotes - 4941 (source: NCBI BLink). |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT4G04955.1 | protein_coding | 4:2522034-2525352 | delay | -16.7271 | 169 | 230 | 112 | 67 | allantoinase Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. allantoinase (ALN);CONTAINS InterPro DOMAIN/s: Amidohydrolase 1 (InterPro:IPR006680), Allantoinase (InterPro:IPR017593), Metal-dependent hydrolase, composite domain (InterPro:IPR011059); pyrimidine 2 (TAIR:AT5G12200.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT5G67300.1 | protein_coding | 5:26854022-26856006 | delay | -16.648 | 52 | 79 | 1868 | 1841 | myb domain protein r1 Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. myb domain protein r1 (MYBR1);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 77 (TAIR:AT3G50060.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| XLOC_002495 | AT1G52347.2 | Ch1:19496461-19497686 | AT1G26670.1 | protein_coding | 1:9215770-9218010 | delay | -16.5776 | 21 | 47 | 631 | 604 | Vesicle transport v-SNARE family protein member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. VTI1B;CONTAINS InterPro DOMAIN/s: Vesicle transport v-SNARE, N-terminal (InterPro:IPR007705); Vesicle transport v-SNARE family protein (TAIR:AT5G39510.1); Has 841 Blast hits to 839 proteins in 213 species: Archae - 2; Bacteria - 11; Metazoa - 288; Fungi - 144; Plants - 215; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). |
| XLOC_024071 | Ch4:3178719-3179585 | AT3G62770.1 | protein_coding | 3:23218610-23221243 | delay | -17.1563 | 510 | 537 | 1599 | 1572 | Transducin/WD40 repeat-like superfamily protein Required for autophagosome formation during nutrient deprivation and senescence. AtATG18a;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: autophagy, leaf senescence, response to starvation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); homolog of yeast autophagy 18 (ATG18) D (TAIR:AT3G56440.1); Has 1516 Blast hits to 1443 proteins in 266 species: Archae - 0; Bacteria - 93; Metazoa - 578; Fungi - 450; Plants - 210; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). | |
| XLOC_025629 | Ch5:10615185-10617881 | AT3G51860.1 | protein_coding | 3:19239305-19242913 | delay | -17.7583 | 126 | 167 | 1578 | 1521 | cation exchanger 3 cation exchanger 3 (CAX3);CONTAINS InterPro DOMAIN/s: Sodium/calcium exchanger membrane region (InterPro:IPR004837), Calcium/proton exchanger superfamily (InterPro:IPR004798), Calcium/proton exchanger (InterPro:IPR004713); cation exchanger 1 (TAIR:AT2G38170.1); Has 3567 Blast hits to 3405 proteins in 1022 species: Archae - 24; Bacteria - 2167; Metazoa - 14; Fungi - 725; Plants - 252; Viruses - 0; Other Eukaryotes - 385 (source: NCBI BLink). | |
| XLOC_013837 | Ch3:3867698-3868357 | AT4G16110.1 | nontranslating_CDS | 4:9112686-9116164 | delay | -18.8432 | 259 | 302 | 909 | 853 | response regulator 2 Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation.response regulator 2 (RR2);CONTAINS InterPro DOMAIN/s: Response regulator, plant B-type (InterPro:IPR017053), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), CheY-like (InterPro:IPR011006), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Signal transduction response regulator, receiver domain (InterPro:IPR001789), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); response regulator 1 (TAIR:AT3G16857.2); Has 95443 Blast hits to 94483 proteins in 2985 species: Archae - 623; Bacteria - 84652; Metazoa - 47; Fungi - 382; Plants - 2721; Viruses - 2; Other Eukaryotes - 7016 (source: NCBI BLink). | |
| XLOC_029141 | Ch5:10789078-10790317 | AT4G04620.1 | protein_coding | 4:2328442-2330590 | delay | -18.8733 | 744 | 785 | 80 | 20 | Ubiquitin-like superfamily protein autophagy 8b (ATG8B);CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); Ubiquitin-like superfamily protein (TAIR:AT4G21980.2); Has 1515 Blast hits to 1513 proteins in 273 species: Archae - 0; Bacteria - 0; Metazoa - 720; Fungi - 178; Plants - 303; Viruses - 3; Other Eukaryotes - 311 (source: NCBI BLink). | |
| XLOC_023074 | Ch4:12152276-12153519 | AT5G09330.1 | protein_coding | 5:2892338-2895480 | delay | -21.7005 | 966 | 996 | 309 | 278 | NAC domain containing protein 82 NAC domain containing protein 82 (NAC082);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 103 (TAIR:AT5G64060.1); Has 3286 Blast hits to 2997 proteins in 111 species: Archae - 0; Bacteria - 34; Metazoa - 211; Fungi - 2; Plants - 2912; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). | |
| XLOC_011416 | AT2G18440.1 | Ch2:7994941-7997239 | AT2G18440.1 | ncRNA | 2:7994941-7997239 | -896.155 | 253 | 1357 | 1377 | 273 | GUT15 (GENE WITH UNSTABLE TRANSCRIPT 15); other RNAEncodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. | |
| XLOC_019022 | AT3G57965.1 | Ch3:21464619-21466799 | AT3G57965.1 | lncRNA | 3:21464619-21466799 | -836.974 | 857 | 1822 | 1428 | 463 | Potential natural antisense gene, locus overlaps with AT3G57970 | |
| XLOC_016579 | AT3G05932.1 | Ch3:1770239-1773461 | AT3G05932.1 | lncRNA | 3:1770239-1773461 | -753.136 | 1485 | 2336 | 1158 | 307 | Potential natural antisense gene, locus overlaps with AT3G05930 | |
| XLOC_006987 | AT1G60525.1 | Ch1:22299435-22301441 | AT1G60525.1 | lncRNA | 1:22299435-22301441 | -618.126 | 777 | 1503 | 1668 | 942 | other RNA Potential natural antisense gene, locus overlaps with AT1G60530 | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G63445.1 | lncRNA | 3:23422590-23426390 | -617.906 | 1398 | 2077 | 1738 | 1059 | other RNA Potential natural antisense gene, locus overlaps with AT3G63440 | |
| XLOC_005049 | AT1G15175.1 | Ch1:5222729-5224055 | AT1G15175.1 | lncRNA | 1:5222729-5224143 | -606.595 | 507 | 1246 | 828 | 89 | other RNA Potential natural antisense gene, locus overlaps with AT1G15170 | |
| XLOC_023962 | AT4G38545.1 | Ch4:18022932-18025298 | AT4G38545.1 | lncRNA | 4:18022932-18025298 | -554.69 | 1229 | 1845 | 1139 | 520 | other RNA Potential natural antisense gene, locus overlaps with AT4G38530 and AT4G38540 | |
| XLOC_005827 | AT1G29785.1 | Ch1:10426779-10429143 | AT1G29785.1 | lncRNA | 1:10426779-10429143 | -546.041 | 505 | 1129 | 624 | 0 | other RNA Potential natural antisense gene, locus overlaps with AT1G29780 | |
| XLOC_005827 | AT1G29785.1 | Ch1:10426779-10429143 | AT1G29785.1 | lncRNA | 1:10426779-10429143 | -546.041 | 505 | 1129 | 624 | 0 | other RNA Potential natural antisense gene, locus overlaps with AT1G29780 | |
| XLOC_007872 | AT1G75295.2 | Ch1:28254820-28257236 | AT1G75295.1 | lncRNA | 1:28254820-28257236 | -545.359 | 661 | 1300 | 1326 | 687 | other RNA Potential natural antisense gene, locus overlaps with AT1G75290 and AT1G75300 | |
| XLOC_016579 | AT3G05932.1 | Ch3:1770239-1773461 | AT3G05935.1 | protein_coding | 3:1770911-1773461 | -535.57 | 574 | 1211 | 637 | 0 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G26208.1 | lncRNA | 1:9065955-9071468 | -528.426 | 2523 | 3190 | 1498 | 831 | other RNA Potential natural antisense gene, locus overlaps with AT1G26210 | |
| XLOC_029693 | AT5G43403.1 | Ch5:17430539-17431765 | AT5G43403.1 | ncRNA | 5:17430539-17431765 | -459.034 | 316 | 872 | 872 | 316 | other RNA unknown gene | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G23410.1 | ncRNA | 5:7885591-7886785 | -445.894 | 456 | 958 | 958 | 456 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; FKF1 (FLAVIN-BINDING, KELCH REPEAT, F BOX 1); signal transducer/ two-component sensor/ ubiquitin-protein ligase (TAIR:AT1G68050.1); Has 53 Blast hits to 53 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.6 | Ch3:19312062-19314685 | AT3G52072.1 | lncRNA | 3:19312062-19314685 | -412.562 | 322 | 765 | 1153 | 710 | other RNA Potential natural antisense gene, locus overlaps with AT3G52070 | |
| XLOC_006986 | AT1G60505.5 | Ch1:22294362-22297374 | AT1G60505.1 | lncRNA | 1:22294362-22297374 | -406.829 | 2077 | 2539 | 1927 | 1465 | other RNA Potential natural antisense gene, locus overlaps with AT1G60510 | |
| XLOC_006986 | AT1G60505.1 | Ch1:22294362-22297374 | AT1G60505.1 | lncRNA | 1:22294362-22297374 | -406.829 | 1975 | 2437 | 1927 | 1465 | other RNA Potential natural antisense gene, locus overlaps with AT1G60510 | |
| XLOC_005039 | AT1G15002.1 | Ch1:5168516-5170571 | AT1G15002.1 | lncRNA | 1:5168516-5170571 | -406.775 | 1424 | 1919 | 495 | 0 | Potential natural antisense gene, locus overlaps with AT1G15000 | |
| XLOC_022427 | AT4G12917.1 | Ch4:7563157-7563847 | AT4G12917.1 | ncRNA | 4:7563157-7563847 | -402.066 | 77 | 552 | 552 | 77 | other RNA unknown gene | |
| XLOC_029764 | AT5G44562.1 | Ch5:17947617-17948398 | AT5G44562.1 | lncRNA | 5:17947617-17948398 | -392.063 | 254 | 695 | 695 | 254 | other RNA Potential natural antisense gene, locus overlaps with AT5G44560 | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT1G56612.1 | lncRNA | 1:21213625-21215407 | -389.155 | 904 | 1353 | 802 | 353 | other RNA Potential natural antisense gene, locus overlaps with AT1G56610 | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G26218.1 | lncRNA | 1:9071058-9072273 | -372.794 | 839 | 1248 | 1134 | 725 | other RNA Potential natural antisense gene, locus overlaps with AT1G26220 | |
| XLOC_027921 | AT5G06165.1 | Ch5:1867197-1868244 | AT5G06165.1 | ncRNA | 5:1867197-1868244 | -359.502 | 484 | 918 | 918 | 484 | ||
| XLOC_019227 | AT3G61198.1 | Ch3:22655884-22656599 | AT3G61198.1 | ncRNA | 3:22655884-22656599 | -357.832 | 200 | 621 | 619 | 198 | other RNA unknown gene | |
| XLOC_004773 | AT1G10682.1 | Ch1:3544913-3545614 | AT1G10682.1 | ncRNA | 1:3544913-3545614 | -353.483 | 78 | 500 | 480 | 58 | other RNA | |
| XLOC_021964 | AT4G03038.1 | Ch4:1340115-1341289 | AT4G03038.1 | ncRNA | 4:1340115-1341289 | -312.862 | 140 | 545 | 721 | 316 | other RNA unknown gene | |
| XLOC_005446 | AT1G22403.1 | Ch1:7908568-7909708 | AT1G22403.1 | ncRNA | 1:7908568-7909708 | -296.262 | 218 | 561 | 561 | 218 | other RNA | |
| XLOC_005726 | AT1G27921.3 | Ch1:9726607-9730185 | AT1G27921.1 | lncRNA | 1:9726607-9730424 | -291.549 | 1821 | 2188 | 997 | 630 | other RNA Potential natural antisense gene, locus overlaps with AT1G27920 | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT3G29644.1 | lncRNA | 3:11498879-11501424 | -267.089 | 644 | 950 | 638 | 332 | other RNA Potential natural antisense gene, locus overlaps with AT3G29642 | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT1G11592.1 | ncRNA | 1:3895179-3896934 | -237.018 | 1088 | 1358 | 1072 | 802 | other RNA unknown gene | |
| XLOC_017896 | AT3G27990.4 | Ch3:10392571-10398221 | AT3G27990.1 | lncRNA | 3:10392571-10398235 | -213.526 | 1277 | 1526 | 1526 | 1277 | other RNA unknown gene | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT3G59070.1 | protein_coding | 3:21832364-21834514 | -202.785 | 172 | 367 | 1400 | 1205 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain Cytochrome b561/ferric reductase transmembrane with DOMON related domain;CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Protein ofunknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); Cytochrome b561/ferric reductase transmembrane with DOMON related domain (TAIR:AT5G48750.1); Has 587 Blast hits to 587 proteins in 87 species: Archae - 0; Bacteria - 7; Metazoa - 93; Fungi - 15; Plants - 452; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | |
| XLOC_004253 | AT1G04117.1 | Ch1:494008-495548 | AT1G02430.1 | protein_coding | 1:495050-496332 | -188.444 | 1042 | 1252 | 697 | 487 | ADP-ribosylation factor D1BA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating andFUNCTIONS in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. ADP-ribosylation factor D1B (ARFD1B);FUNCTIONS IN: GTP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: ADP-ribosylation factor (InterPro:IPR006688), Small GTPase SAR1-type (InterPro:IPR006687), ARF/SAR superfamily (InterPro:IPR006689); ADP-ribosylation factor D1A (TAIR:AT1G02440.1); Has 8851 Blast hits to 8846 proteins in 396 species: Archae - 6; Bacteria - 6; Metazoa - 3723; Fungi - 1395; Plants - 1867; Viruses - 3; Other Eukaryotes - 1851 (source: NCBI BLink). | |
| XLOC_013057 | AT2G09640.1 | Ch2:18756673-18757928 | AT2G45540.2 | protein_coding | 2:18757489-18772906 | -171.036 | 0 | 197 | 9407 | 9210 | WD-40 repeat family protein / beige-related WD-40 repeat family protein / beige-related;FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat 2 (InterPro:IPR019782), Beige/BEACH (InterPro:IPR000409), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G60920.1). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G11100.2 | protein_coding | 1:3703672-3709586 | -99.0527 | 1118 | 1242 | 4071 | 3947 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-relatedSNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related;FUNCTIONS IN: helicase activity, DNA binding, zinc ion binding, nucleic acid binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related (TAIR:AT1G61140.1). | |
| XLOC_004253 | AT1G04117.1 | Ch1:494008-495548 | AT1G02440.1 | protein_coding | 1:496372-497555 | -77.7745 | 1167 | 1252 | 572 | 487 | ADP-ribosylation factor D1AA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating andFUNCTIONS in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. ADP-ribosylation factor D1A (ARFD1A);FUNCTIONS IN: GTP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: ADP-ribosylation factor (InterPro:IPR006688), Ras GTPase (InterPro:IPR001806), Small GTPase SAR1-type (InterPro:IPR006687), ARF/SAR superfamily (InterPro:IPR006689); ADP-ribosylation factor D1B (TAIR:AT1G02430.1); Has 8047 Blast hits to 8044 proteins in 397 species: Archae - 6; Bacteria - 20; Metazoa - 3487; Fungi - 1271; Plants - 1683; Viruses - 3; Other Eukaryotes - 1577 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.1 | Ch1:7908568-7909708 | AT1G07645.1 | protein_coding | 1:2367437-2368436 | -77.1106 | 28 | 109 | 406 | 325 | dessication-induced 1VOC superfamily protein dessication-induced 1VOC superfamily protein (DSI-1VOC);FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: seed;CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_017691 | AT3G04775.1 | Ch3:8979070-8979756 | AT3G24612.1 | snoRNA | 3:8979067-8979153 | -66.1933 | 0 | 83 | 83 | 0 | snoRNAsnoRNA | |
| XLOC_007143 | AT1G08577.1 | Ch1:23271551-23271796 | AT1G62850.2 | protein_coding | 1:23271703-23274340 | -65.9984 | 152 | 245 | 1669 | 1576 | Class I peptide chain release factor Class I peptide chain release factor;FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 2349 Blast hits to 2349 proteins in 1057 species: Archae - 0; Bacteria - 1715; Metazoa - 148; Fungi - 110; Plants - 54; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). | |
| XLOC_029056 | AT5G04325.1 | Ch5:9494431-9495015 | AT1G08115.1 | snRNA | 1:2538074-2538238 | -52.6367 | 0 | 97 | 157 | 60 | snRNA U1A small nuclear RNA gi|22293581|emb|AJ505685.1|ATH505685 Arabidopsis putative U1a snRNA (U1asnRNA gene), 5' end incomplete, At5g05684 | |
| XLOC_016989 | AT3G12965.1 | Ch3:4136961-4137674 | AT1G56045.1 | protein_coding | 1:20962570-20963546 | -52.3717 | 304 | 373 | 145 | 74 | Ribosomal protein L41 family Ribosomal protein L41 family;FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome;CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_022116 | AT4G06701.5 | Ch4:3939266-3940749 | AT4G06701.1 | ncRNA | 4:3939266-3940797 | -51.9175 | 262 | 327 | 257 | 192 | other RNA unknown gene | |
| XLOC_006986 | AT1G60505.5 | Ch1:22294362-22297374 | AT1G60525.1 | lncRNA | 1:22299435-22301441 | -51.0068 | 2287 | 2369 | 1262 | 1180 | other RNA Potential natural antisense gene, locus overlaps with AT1G60530 | |
| XLOC_006986 | AT1G60505.1 | Ch1:22294362-22297374 | AT1G60525.1 | lncRNA | 1:22299435-22301441 | -51.0068 | 2185 | 2267 | 1262 | 1180 | other RNA Potential natural antisense gene, locus overlaps with AT1G60530 | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT1G65280.1 | protein_coding | 1:24245122-24248762 | -45.5428 | 108 | 240 | 400 | 285 | DNAJ heat shock N-terminal domain-containing protein DNAJ heat shock N-terminal domain-containing protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Protein ofunknown function DUF3752 (InterPro:IPR022226); Chaperone DnaJ-domain superfamily protein (TAIR:AT5G22080.2); Has 26180 Blast hits to 20391 proteins in 2424 species: Archae - 138; Bacteria - 5225; Metazoa - 9539; Fungi - 2558; Plants - 2202; Viruses - 36; Other Eukaryotes - 6482 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G38040.1 | protein_coding | 5:15184947-15186854 | -45.0645 | 776 | 843 | 1260 | 1189 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT5G38010.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005064 | AT1G05163.1 | Ch1:5297847-5298571 | AT2G31141.1 | protein_coding | 2:13271726-13272534 | -42.5918 | 18 | 109 | 408 | 315 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G64563.1 | ncRNA | 1:23975085-23978335 | -38.1334 | 157 | 232 | 2682 | 2605 | other RNA | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT5G45300.1 | protein_coding | 5:18353525-18356888 | -37.2617 | 24 | 119 | 331 | 254 | beta-amylase 2 Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast.CONTAINS BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. beta-amylase 2 (BMY2);FUNCTIONS IN: cation binding, beta-amylase activity, catalytic activity; INVOLVED IN: cellulose biosynthetic process, carbohydrate metabolic process, polysaccharide catabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 14 (InterPro:IPR001554), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), BZR1, transcriptional repressor (InterPro:IPR008540); beta-amylase 7 (TAIR:AT2G45880.1); Has 1218 Blast hits to 1198 proteins in 187 species: Archae - 0; Bacteria - 92; Metazoa - 210; Fungi - 10; Plants - 824; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G35660.1 | protein_coding | 5:13852387-13853742 | -36.9482 | 1312 | 1385 | 1035 | 960 | Glycine-rich protein family Glycine-rich protein family; LOCATED IN: endomembrane system; Has 242106 Blast hits to 44248 proteins in 2411 species: Archae - 458; Bacteria - 59126; Metazoa - 88892; Fungi - 17902; Plants - 27548; Viruses - 3419; Other Eukaryotes - 44761 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G69210.1 | protein_coding | 1:26018438-26020058 | -35.9007 | 623 | 677 | 205 | 132 | Uncharacterised protein family UPF0090Uncharacterised protein family UPF0090;CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0090 (InterPro:IPR003728); Uncharacterised protein family UPF0090 (TAIR:AT1G77122.1); Has 169 Blast hits to 169 proteins in 64 species: Archae - 0; Bacteria - 102; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G20670.1 | protein_coding | 1:7164082-7168041 | -33.1749 | 2186 | 2263 | 98 | 12 | DNA-binding bromodomain-containing protein DNA-binding bromodomain-containing protein;CONTAINS InterPro DOMAIN/s: Bromodomain, conserved site (InterPro:IPR018359), Bromodomain (InterPro:IPR001487); DNA-binding bromodomain-containing protein (TAIR:AT1G76380.2); Has 11096 Blast hits to 8233 proteins in 323 species: Archae - 0; Bacteria - 121; Metazoa - 4363; Fungi - 1457; Plants - 677; Viruses - 7; Other Eukaryotes - 4471 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G48760.1 | protein_coding | 1:18035967-18039405 | -32.6408 | 237 | 281 | 2674 | 2631 | delta-adaptinEncodes the putative delta subunit of the AP(adaptor protein)-3 complex and plays a role in vacuolar function. delta-adaptin (delta-ADR);FUNCTIONS IN: protein transporter activity, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex AP-3, delta subunit (InterPro:IPR017105), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); Adaptor protein complex AP-1, gamma subunit (TAIR:AT1G60070.1); Has 3854 Blast hits to 3636 proteins in 331 species: Archae - 0; Bacteria - 22; Metazoa - 1599; Fungi - 800; Plants - 408; Viruses - 0; Other Eukaryotes - 1025 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G36730.1 | protein_coding | 1:13898210-13900831 | -32.1587 | 621 | 679 | 58 | 4 | Translation initiation factor IF2/IF5 Translation initiation factor IF2/IF5;FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Translation initiation factor IF2/IF5, N-terminal (InterPro:IPR016189), Translation initiation factor IF2/IF5, zinc-binding (InterPro:IPR016190), eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Translation initiation factor IF2/IF5 (InterPro:IPR002735), Armadillo-type fold (InterPro:IPR016024); Translation initiation factor IF2/IF5 (TAIR:AT1G77840.1); Has 6371 Blast hits to 4946 proteins in 714 species: Archae - 245; Bacteria - 804; Metazoa - 2020; Fungi - 758; Plants - 416; Viruses - 40; Other Eukaryotes - 2088 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G26440.3 | protein_coding | 1:9143937-9146106 | -31.6675 | 235 | 283 | 744 | 690 | ureide permease 5 uptake assays in yeast mutants indicated this splice variant is a cellular importer for allantoin, uracil and xanthine ureide permease 5 (UPS5);FUNCTIONS IN: xanthine transmembrane transporter activity, uracil transmembrane transporter activity, allantoin uptake transmembrane transporter activity; INVOLVED IN: xanthine transport, uracil transport, allantoin transport; LOCATED IN: endomembrane system; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 13 growth stages; ureide permease 2 (TAIR:AT2G03530.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G01400.1 | protein_coding | 5:162522-171302 | -31.6354 | 1348 | 1379 | 4399 | 4368 | HEAT repeat-containing protein Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64.ENHANCED SILENCING PHENOTYPE 4 (ESP4);FUNCTIONS IN: binding; INVOLVED IN: posttranscriptional gene silencing by RNA, RNA processing; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Symplekin tight junction protein C-terminal (InterPro:IPR022075), Armadillo-type fold (InterPro:IPR016024), Protein ofunknown function DUF3453 (InterPro:IPR021850); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G27595.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G10400.1 | protein_coding | 3:3232608-3233690 | -31.6113 | 83 | 170 | 773 | 688 | RNA recognition motif and CCHC-type zinc finger domains containing protein Encodes a U12-type spliceosomal protein U11/U12-31K. Involved in U12 intron splicing via RNA chaperone activity and affects plant development. RNA recognition motif and CCHC-type zinc finger domains containing protein;FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); ortholog of human splicing factor SC35 (TAIR:AT5G64200.2); Has 867 Blast hits to 867 proteins in 310 species: Archae - 0; Bacteria - 0; Metazoa - 452; Fungi - 160; Plants - 158; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G67520.1 | protein_coding | 5:26939159-26941050 | -30.76 | 612 | 675 | 1029 | 978 | adenosine-5'-phosphosulfate (APS) kinase 4 Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. adenosine-5'-phosphosulfate (APS) kinase 4 (APK4);FUNCTIONS IN: kinase activity, transferase activity, transferring phosphorus-containing groups, ATP binding; INVOLVED IN: male gamete generation, sulfate assimilation; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Adenylylsulphate kinase, C-terminal (InterPro:IPR002891); APS kinase (TAIR:AT2G14750.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G53625.1 | protein_coding | 1:20014379-20015038 | -30.3298 | 1135 | 1217 | 388 | 301 | unknown protein; Has 29996 Blast hits to 6987 proteins in 655 species: Archae - 23; Bacteria - 6686; Metazoa - 10521; Fungi - 1178; Plants - 7439; Viruses - 681; Other Eukaryotes - 3468 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G24764.1 | protein_coding | 1:8759533-8763469 | -30.0108 | 2183 | 2263 | 2279 | 2205 | microtubule-associated proteins 70-2 Member of the MAP70 protein family.microtubule-associated proteins 70-2 (MAP70-2);FUNCTIONS IN: microtubule binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: microtubule; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Myosin II heavy chain-like (InterPro:IPR009768); microtubule-associated proteins 70-1 (TAIR:AT1G68060.1); Has 48419 Blast hits to 29383 proteins in 2175 species: Archae - 681; Bacteria - 6937; Metazoa - 23825; Fungi - 4071; Plants - 3202; Viruses - 118; Other Eukaryotes - 9585 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G32980.1 | protein_coding | 2:13997325-13999949 | -29.9172 | 230 | 261 | 939 | 908 | unknown protein; Has 158 Blast hits to 154 proteins in 73 species: Archae - 0; Bacteria - 61; Metazoa - 0; Fungi - 0; Plants - 55; Viruses - 28; Other Eukaryotes - 14 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT3G55790.1 | protein_coding | 3:20708196-20708658 | -29.9063 | 1339 | 1370 | 232 | 201 | unknown protein; Has 698 Blast hits to 549 proteins in 106 species: Archae - 0; Bacteria - 92; Metazoa - 317; Fungi - 24; Plants - 183; Viruses - 2; Other Eukaryotes - 80 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G27160.1 | protein_coding | 3:10017321-10019442 | -29.7057 | 1449 | 1486 | 43 | 2 | Ribosomal protein S21 family protein GHS1 encodes plastid ribosomal protein S21 GLUCOSE HYPERSENSITIVE 1 (GHS1);FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein S21 (InterPro:IPR001911); Ribosomal protein S21 family protein (TAIR:AT5G63300.1); Has 1937 Blast hits to 1937 proteins in 824 species: Archae - 0; Bacteria - 1717; Metazoa - 0; Fungi - 4; Plants - 72; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G57910.1 | protein_coding | 3:21442642-21446183 | -29.6607 | 235 | 291 | 706 | 634 | D111/G-patch domain-containing proteinD111/G-patch domain-containing protein;FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); D111/G-patch domain-containing protein (TAIR:AT5G26610.3); Has 4544 Blast hits to 3364 proteins in 343 species: Archae - 10; Bacteria - 136; Metazoa - 2001; Fungi - 471; Plants - 301; Viruses - 43; Other Eukaryotes - 1582 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT4G10930.1 | protein_coding | 4:6704911-6711248 | -29.5599 | 87 | 157 | 2439 | 2381 | unknown protein; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G01895.1 | protein_coding | 4:819957-820379 | -29.5324 | 42 | 93 | 370 | 307 | systemic acquired resistance (SAR) regulator protein NIMIN-1-related systemic acquired resistance (SAR) regulator protein NIMIN-1-related; NIM1-interacting 1 (TAIR:AT1G02450.1); Has 7634 Blast hits to 2740 proteins in 217 species: Archae - 4; Bacteria - 24; Metazoa - 4803; Fungi - 436; Plants - 277; Viruses - 156; Other Eukaryotes - 1934 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G47800.1 | protein_coding | 5:19353532-19356448 | -29.2993 | 1448 | 1477 | 218 | 189 | Phototropic-responsive NPH3 family protein Phototropic-responsive NPH3 family protein;FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); Phototropic-responsive NPH3 family protein (TAIR:AT1G67900.3); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT2G45315.1 | lncRNA | 2:18682089-18684072 | -29.1497 | 51 | 94 | 1236 | 1193 | other RNA Potential natural antisense gene, locus overlaps with AT2G45310 | |
| XLOC_004828 | AT1G11592.1 | Ch1:3895179-3896917 | AT3G27990.1 | lncRNA | 3:10392571-10398235 | -29.1074 | 984 | 1025 | 1087 | 1046 | other RNA unknown gene | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G02470.1 | protein_coding | 2:652564-654985 | -29.0258 | 1354 | 1399 | 843 | 798 | alfin-like 6 Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins that acts as a novel upstream regulator of root hair formation during Pi starvation. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). alfin-like 6 (AL6);CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Protein ofunknown function DUF3594 (InterPro:IPR021998), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); alfin-like 7 (TAIR:AT1G14510.1); Has 1820 Blast hits to 1777 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 798; Fungi - 350; Plants - 563; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G24630.1 | protein_coding | 2:10471196-10474610 | -28.8393 | 230 | 269 | 2499 | 2457 | Glycosyl transferase family 2 proteinEncodes a gene similar to cellulose synthase ATCSLC08;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); Cellulose-synthase-like C5 (TAIR:AT4G31590.1); Has 5319 Blast hits to 5316 proteins in 1532 species: Archae - 206; Bacteria - 4134; Metazoa - 30; Fungi - 95; Plants - 510; Viruses - 14; Other Eukaryotes - 330 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G55680.1 | protein_coding | 1:20804592-20807940 | -28.7485 | 629 | 688 | 90 | 26 | Transducin/WD40 repeat-like superfamily protein Transducin/WD40 repeat-like superfamily protein;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat 2 (InterPro:IPR019782), WD40-repeat-containing domain (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT3G13340.2); Has 20114 Blast hits to 9589 proteins in 506 species: Archae - 80; Bacteria - 6727; Metazoa - 4776; Fungi - 4188; Plants - 1687; Viruses - 0; Other Eukaryotes - 2656 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G28060.1 | protein_coding | 1:9778851-9782907 | -28.6205 | 41 | 93 | 2228 | 2172 | Pre-mRNA-splicing factor 3 Pre-mRNA-splicing factor 3;CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); Pre-mRNA-splicing factor 3 (TAIR:AT3G55930.1); Has 22923 Blast hits to 12760 proteins in 707 species: Archae - 18; Bacteria - 1085; Metazoa - 11525; Fungi - 3053; Plants - 1999; Viruses - 93; Other Eukaryotes - 5150 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G12350.1 | protein_coding | 3:3931451-3933404 | -28.5954 | 641 | 726 | 823 | 758 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); Has 51 Blast hits to 51 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 45; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G03130.1 | protein_coding | 1:753307-754262 | -28.3372 | 1223 | 1287 | 184 | 107 | photosystem I subunit D-2 Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2)photosystem I subunit D-2 (PSAD-2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Photosystem I protein PsaD (InterPro:IPR003685); photosystem I subunit D-1 (TAIR:AT4G02770.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 143; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 3; Other Eukaryotes - 198 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G38130.1 | protein_coding | 2:15978377-15980763 | -28.1005 | 643 | 691 | 55 | 5 | Acyl-CoA N-acyltransferases (NAT) superfamily proteinEncodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. ATMAK3;FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase, C-terminal (InterPro:IPR022610), GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Acyl-CoA N-acyltransferases (NAT) superfamily protein (TAIR:AT5G13780.1); Has 3613 Blast hits to 3609 proteins in 1331 species: Archae - 279; Bacteria - 1857; Metazoa - 641; Fungi - 294; Plants - 213; Viruses - 0; Other Eukaryotes - 329 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G53000.1 | protein_coding | 5:21485317-21488042 | -27.9733 | 231 | 278 | 1253 | 1207 | 2A phosphatase associated protein of 46 kD PP2A-associated protein with a possible function in the chilling response 2A phosphatase associated protein of 46 kD (TAP46);CONTAINS InterPro DOMAIN/s: TAP42-like protein (InterPro:IPR007304); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT2G20790.1 | protein_coding | 2:8949453-8952874 | -27.8641 | 10 | 75 | 1716 | 1649 | clathrin adaptor complexes medium subunit family protein clathrin adaptor complexes medium subunit family protein; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968); Has 294 Blast hits to 294 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 151; Fungi - 30; Plants - 53; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G32885.1 | protein_coding | 2:13951686-13953478 | -27.3315 | 174 | 237 | 1504 | 1427 | Rapid alkalinization factor (RALF) family protein Encodes a Rapid ALkalinization Factor (RALF) family proteinRapid alkalinization factor (RALF) family protein; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Rapid ALkalinization Factor (InterPro:IPR008801); RALF-like 20 (TAIR:AT2G34825.1); Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G25720.1 | protein_coding | 2:10955430-10956090 | -27.2206 | 1350 | 1387 | 151 | 116 | unknown protein; Has 38 Blast hits to 38 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT1G28050.1 | protein_coding | 1:9775522-9778043 | -27.1781 | 790 | 847 | 882 | 815 | B-box type zinc finger protein with CCT domainB-box type zinc finger protein with CCT domain;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); B-box type zinc finger protein with CCT domain (TAIR:AT2G33500.2); Has 3090 Blast hits to 2261 proteins in 129 species: Archae - 2; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 2990; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G35940.1 | protein_coding | 4:17021380-17024108 | -27.1615 | 46 | 94 | 232 | 167 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G17787.1); Has 45288 Blast hits to 24095 proteins in 1140 species: Archae - 93; Bacteria - 2895; Metazoa - 13424; Fungi - 2873; Plants - 1183; Viruses - 123; Other Eukaryotes - 24697 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G59990.1 | protein_coding | 3:22155705-22158954 | -27.0508 | 232 | 270 | 319 | 278 | methionine aminopeptidase 2B Encodes a MAP2 like methionine aminopeptidase methionine aminopeptidase 2B (MAP2B);FUNCTIONS IN: metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: protein processing; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M24A, methionine aminopeptidase, subfamily 2 (InterPro:IPR002468), Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24A, methionine aminopeptidase, subfamily 2, binding site (InterPro:IPR018349), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); methionine aminopeptidase 2A (TAIR:AT2G44180.1); Has 5644 Blast hits to 5631 proteins in 1905 species: Archae - 231; Bacteria - 3326; Metazoa - 515; Fungi - 331; Plants - 172; Viruses - 0; Other Eukaryotes - 1069 (source: NCBI BLink). | |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT4G31354.1 | protein_coding | 4:15218069-15220811 | -26.9857 | 158 | 212 | 163 | 103 | This gene encodes a small protein and has either evidence of transcription or purifying selection.unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G31351.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G42670.2 | protein_coding | 2:17771697-17774647 | -26.6858 | 626 | 664 | 271 | 232 | Protein ofunknown function (DUF1637) Protein ofunknown function (DUF1637);FUNCTIONS IN: cysteamine dioxygenase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1637 (InterPro:IPR012864); Protein ofunknown function (DUF1637) (TAIR:AT3G58670.3); Has 366 Blast hits to 366 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G03580.1 | protein_coding | 4:1596985-1599091 | -26.5609 | 42 | 92 | 105 | 55 | Cysteine proteinases superfamily protein (TAIR:AT5G17080.1); Has 155 Blast hits to 136 proteins in 31 species: Archae - 0; Bacteria - 11; Metazoa - 28; Fungi - 14; Plants - 17; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G60550.1 | protein_coding | 5:24339229-24342590 | -26.3058 | 229 | 269 | 676 | 634 | geminivirus rep interacting kinase 2 Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. geminivirus rep interacting kinase 2 (GRIK2);CONTAINS InterPro DOMAIN/s: Calcium/calmodulin-dependent protein kinase kinase (InterPro:IPR020657), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); geminivirus rep interacting kinase 1 (TAIR:AT3G45240.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G04690.1 | protein_coding | 2:1644456-1646443 | -26.2923 | 971 | 1014 | 187 | 146 | Pyridoxamine 5'-phosphate oxidase family protein Pyridoxamine 5'-phosphate oxidase family protein;FUNCTIONS IN: FMN binding; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G44180.1 | protein_coding | 5:17782428-17790234 | -26.2883 | 236 | 261 | 4903 | 4878 | Homeodomain-like transcriptional regulator Homeodomain-like transcriptional regulator;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: DDT domain superfamily (InterPro:IPR018501), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), DDT domain, subgroup (InterPro:IPR018500), DDT domain (InterPro:IPR004022), Homeodomain-related (InterPro:IPR012287); homeobox-1 (TAIR:AT1G28420.1); Has 67503 Blast hits to 37811 proteins in 2117 species: Archae - 251; Bacteria - 7621; Metazoa - 32181; Fungi - 4940; Plants - 2680; Viruses - 355; Other Eukaryotes - 19475 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G04020.1 | protein_coding | 5:1081521-1086772 | -26.2357 | 230 | 273 | 4030 | 3987 | calmodulin binding calmodulin binding;FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Calmodulin-binding protein, plant (InterPro:IPR012417); Plant calmodulin-binding protein-related (TAIR:AT2G38800.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G05930.1 | protein_coding | 5:1779870-1783465 | -26.1947 | 232 | 281 | 61 | 12 | guanylyl cyclase 1 guanylyl cyclase 1 (GC1);CONTAINS InterPro DOMAIN/s: Guanylyl cyclase (InterPro:IPR018616); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT4G35600.2 | protein_coding | 4:16896153-16898933 | -26.1545 | 231 | 266 | 230 | 195 | Protein kinase superfamily protein Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. CONNEXIN 32;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT2G17220.2). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G18295.1 | protein_coding | 3:6281204-6282306 | -26.1295 | 632 | 689 | 218 | 162 | Protein ofunknown function (DUF1639) Protein ofunknown function (DUF1639);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1639 (InterPro:IPR012438); Protein ofunknown function (DUF1639) (TAIR:AT1G48770.1); Has 259 Blast hits to 258 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 259; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_006987 | AT1G60525.1 | Ch1:22299435-22301441 | AT2G26440.1 | protein_coding | 2:11247160-11249620 | -26.1262 | 76 | 138 | 91 | 32 | Plant invertase/pectin methylesterase inhibitor superfamily Plant invertase/pectin methylesterase inhibitor superfamily;FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); Plant invertase/pectin methylesterase inhibitor superfamily (TAIR:AT4G02330.1); Has 2898 Blast hits to 2847 proteins in 362 species: Archae - 6; Bacteria - 671; Metazoa - 1; Fungi - 192; Plants - 2003; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G35030.1 | protein_coding | 2:14760728-14763134 | -25.9578 | 231 | 292 | 1820 | 1761 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09410.1); Has 50772 Blast hits to 15060 proteins in 312 species: Archae - 12; Bacteria - 55; Metazoa - 198; Fungi - 231; Plants - 49530; Viruses - 0; Other Eukaryotes - 746 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G20850.1 | protein_coding | 4:11160721-11170071 | -25.8547 | 42 | 111 | 3857 | 3794 | tripeptidyl peptidase ii Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant.tripeptidyl peptidase ii (TPP2);FUNCTIONS IN: tripeptidyl-peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Peptidase S8A, tripeptidyl peptidase II (InterPro:IPR022229); Has 6394 Blast hits to 6195 proteins in 1270 species: Archae - 226; Bacteria - 4362; Metazoa - 666; Fungi - 272; Plants - 126; Viruses - 0; Other Eukaryotes - 742 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G43770.2 | protein_coding | 1:16548417-16551909 | -25.8528 | 41 | 90 | 580 | 532 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT5G16680.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G24290.2 | protein_coding | 4:12594045-12598097 | -25.7235 | 632 | 664 | 94 | 62 | MAC/Perforin domain-containing proteinMAC/Perforin domain-containing protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin (MACPF) domain (InterPro:IPR020864), Membrane attack complex component/perforin (MACPF) domain, metazoa (InterPro:IPR020865); MAC/Perforin domain-containing protein (TAIR:AT1G28380.1); Has 264 Blast hits to 263 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 51; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G18540.1 | protein_coding | 5:6153785-6156309 | -25.7002 | 232 | 278 | 482 | 430 | unknown protein; Has 2026 Blast hits to 792 proteins in 129 species: Archae - 2; Bacteria - 12; Metazoa - 1126; Fungi - 267; Plants - 292; Viruses - 0; Other Eukaryotes - 327 (source: NCBI BLink). | |
| XLOC_023962 | AT4G38545.1 | Ch4:18022932-18025298 | AT1G65270.2 | protein_coding | 1:24241706-24245074 | -25.5934 | 2 | 52 | 194 | 142 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 149 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G57360.2 | protein_coding | 5:23241320-23244590 | -25.5899 | 757 | 800 | 1910 | 1867 | Galactose oxidase/kelch repeat superfamily protein Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. ZEITLUPE (ZTL);CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Kelch repeat type 1 (InterPro:IPR006652), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), PAS fold (InterPro:IPR013767), Kelch repeat type 2 (InterPro:IPR011498), PAS (InterPro:IPR000014), Kelch-type beta propeller (InterPro:IPR015915); LOV KELCH protein 2 (TAIR:AT2G18915.2); Has 8358 Blast hits to 5610 proteins in 807 species: Archae - 89; Bacteria - 2025; Metazoa - 1889; Fungi - 901; Plants - 2129; Viruses - 0; Other Eukaryotes - 1325 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G67195.1 | miRNA | 1:25137456-25137563 | -25.563 | 3583 | 3632 | 206 | 157 | MIR414 (MICRORNA 414) miRNA (MIR414) MICRORNA 414 (MIR414);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 29 Blast hits to 29 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 16; Viruses - 4; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G16440.1 | protein_coding | 5:5371627-5373809 | -25.5552 | 152 | 195 | 219 | 185 | isopentenyl diphosphate isomerase 1Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that itFUNCTIONS in the mevalonate, but not the MEP biosynthetic pathway. isopentenyl diphosphate isomerase 1 (IPP1);FUNCTIONS IN: isopentenyl-diphosphate delta-isomerase activity; INVOLVED IN: chlorophyll biosynthetic process, isoprenoid biosynthetic process, isopentenyl diphosphate biosynthetic process; LOCATED IN: cytosol, chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: NUDIX hydrolase domain-like (InterPro:IPR015797), NUDIX hydrolase domain (InterPro:IPR000086), Isopentenyl-diphosphate delta-isomerase, type 1 (InterPro:IPR011876); isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase 2 (TAIR:AT3G02780.1); Has 2226 Blast hits to 2225 proteins in 801 species: Archae - 35; Bacteria - 1199; Metazoa - 210; Fungi - 137; Plants - 180; Viruses - 0; Other Eukaryotes - 465 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT4G34430.4 | protein_coding | 4:16460907-16465524 | -25.5498 | 325 | 379 | 531 | 452 | DNA-binding family protein Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). CHB3;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity, zinc ion binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), SWIRM (InterPro:IPR007526), SANT, eukarya (InterPro:IPR017884), Zinc finger, ZZ-type (InterPro:IPR000433); SWITCH/sucrose nonfermenting 3C (TAIR:AT1G21700.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G27860.1 | protein_coding | 5:9874718-9876500 | -25.4312 | 15 | 67 | 387 | 344 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G45240.1 | protein_coding | 3:16570478-16573762 | -25.4297 | 771 | 819 | 933 | 885 | geminivirus rep interacting kinase 1 Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. geminivirus rep interacting kinase 1 (GRIK1);CONTAINS InterPro DOMAIN/s: Calcium/calmodulin-dependent protein kinase kinase (InterPro:IPR020657), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); geminivirus rep interacting kinase 2 (TAIR:AT5G60550.1); Has 117743 Blast hits to 115793 proteins in 4740 species: Archae - 114; Bacteria - 14389; Metazoa - 44129; Fungi - 12221; Plants - 26959; Viruses - 496; Other Eukaryotes - 19435 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G52870.1 | protein_coding | 3:19593073-19595834 | -25.3262 | 598 | 672 | 98 | 22 | IQ calmodulin-binding motif family protein IQ calmodulin-binding motif family protein;CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); calmodulin-binding family protein (TAIR:AT3G58480.1); Has 341 Blast hits to 277 proteins in 58 species: Archae - 0; Bacteria - 26; Metazoa - 0; Fungi - 100; Plants - 209; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G67650.1 | protein_coding | 1:25359612-25362444 | -25.3198 | 52 | 95 | 1684 | 1643 | SRP72 RNA-binding domain SRP72 RNA-binding domain;FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle;CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); SRP72 RNA-binding domain (TAIR:AT1G67680.1); Has 433 Blast hits to 428 proteins in 197 species: Archae - 4; Bacteria - 29; Metazoa - 154; Fungi - 136; Plants - 31; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G11150.1 | protein_coding | 3:3492804-3494653 | -25.191 | 52 | 107 | 1062 | 988 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; Has 428 Blast hits to 428 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 428; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT5G56340.1 | protein_coding | 5:22817480-22819730 | -25.0667 | 78 | 146 | 73 | 6 | RING/U-box superfamily proteinATCRT1;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT4G26400.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G63140.1 | protein_coding | 3:23326867-23328789 | -25.0422 | 1449 | 1477 | 249 | 221 | chloroplast stem-loop binding protein of 41 kDaEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. chloroplast stem-loop binding protein of 41 kDa (CSP41A);FUNCTIONS IN: mRNA binding, poly(U) RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040); chloroplast RNA binding (TAIR:AT1G09340.1); Has 1047 Blast hits to 1047 proteins in 372 species: Archae - 70; Bacteria - 649; Metazoa - 6; Fungi - 5; Plants - 106; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G20340.1 | protein_coding | 4:10984618-10988008 | -24.9919 | 1354 | 1409 | 1521 | 1465 | Transcription factor TFIIE, alpha subunitTranscription factor TFIIE, alpha subunit;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: endomembrane system, transcription factor TFIIE complex;CONTAINS InterPro DOMAIN/s: Transcription factor TFIIE, alpha subunit (InterPro:IPR002853), Transcription factor TFE/TFIIEalpha, HTH domain (InterPro:IPR017919); Transcription factor TFIIE, alpha subunit (TAIR:AT1G03280.1); Has 775 Blast hits to 709 proteins in 197 species: Archae - 3; Bacteria - 16; Metazoa - 261; Fungi - 178; Plants - 106; Viruses - 31; Other Eukaryotes - 180 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G25320.1 | protein_coding | 4:12954077-12956588 | -24.9664 | 1354 | 1413 | 1591 | 1527 | AT hook motif DNA-binding family protein AT hook motif DNA-binding family protein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); AT hook motif DNA-binding family protein (TAIR:AT5G51590.1); Has 750 Blast hits to 746 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 748; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G67680.1 | protein_coding | 1:25365756-25368834 | -24.957 | 237 | 280 | 1792 | 1747 | SRP72 RNA-binding domain SRP72 RNA-binding domain;FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); SRP72 RNA-binding domain (TAIR:AT1G67650.1); Has 655 Blast hits to 637 proteins in 232 species: Archae - 21; Bacteria - 65; Metazoa - 237; Fungi - 154; Plants - 42; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G22125.1 | protein_coding | 2:9406059-9414578 | -24.9169 | 23 | 56 | 3223 | 3191 | binding Encodes a protein involved in cell elongation in root and anther filaments. Mutants have greater cell volumes in root tissues and have additive phenotypes with other cell expansion mutants such as those carrying mutations in COB, QUI and POM1 loci. POM2/CSI1 promotes Cellulose Synthase and microtubule co-alignment. binding;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), Armadillo-like helical (InterPro:IPR011989), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024), C2 calcium-dependent membrane targeting (InterPro:IPR000008); Armadillo/beta-catenin-like repeat ; C2 calcium/lipid-binding domain (CaLB) protein (TAIR:AT1G77460.2); Has 7763 Blast hits to 3084 proteins in 288 species: Archae - 8; Bacteria - 60; Metazoa - 1765; Fungi - 937; Plants - 4329; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G24360.1 | protein_coding | 2:10364451-10366902 | -24.7691 | 608 | 688 | 116 | 48 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G31170.3); Has 132546 Blast hits to 130322 proteins in 4939 species: Archae - 142; Bacteria - 14767; Metazoa - 50018; Fungi - 12226; Plants - 34060; Viruses - 645; Other Eukaryotes - 20688 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT3G56140.1 | protein_coding | 3:20829282-20833252 | -24.7645 | 1182 | 1222 | 1897 | 1857 | Protein ofunknown function (DUF399 and DUF3411) Protein ofunknown function (DUF399 and DUF3411);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF399 (InterPro:IPR007314), Protein ofunknown function DUF3411 (InterPro:IPR021825); Protein ofunknown function (DUF399 and DUF3411) (TAIR:AT2G40400.2); Has 538 Blast hits to 538 proteins in 131 species: Archae - 0; Bacteria - 182; Metazoa - 33; Fungi - 6; Plants - 279; Viruses - 6; Other Eukaryotes - 32 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G05990.1 | protein_coding | 3:1796839-1800082 | -24.7627 | 3668 | 3707 | 213 | 171 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); Leucine-rich repeat (LRR) family protein (TAIR:AT3G19230.1); Has 48781 Blast hits to 12236 proteins in 453 species: Archae - 4; Bacteria - 457; Metazoa - 323; Fungi - 23; Plants - 45747; Viruses - 0; Other Eukaryotes - 2227 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G56630.1 | protein_coding | 3:20978901-20980772 | -24.7616 | 617 | 681 | 95 | 24 | cytochrome P450, family 94, subfamily D, polypeptide 2 member of CYP94D "cytochrome P450, family 94, subfamily D, polypeptide 2" (CYP94D2);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 94, subfamily D, polypeptide 1 (TAIR:AT1G34540.1); Has 28588 Blast hits to 28499 proteins in 1478 species: Archae - 44; Bacteria - 2617; Metazoa - 10641; Fungi - 6172; Plants - 8084; Viruses - 3; Other Eukaryotes - 1027 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G11890.2 | protein_coding | 3:3755456-3757842 | -24.7507 | 756 | 841 | 1513 | 1435 | Sterile alpha motif (SAM) domain-containing protein Sterile alpha motif (SAM) domain-containing protein;CONTAINS InterPro DOMAIN/s: Sterile alpha motif (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993), Sterile alpha motif, type 2 (InterPro:IPR011510); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G11860.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G12010.1 | protein_coding | 5:3877680-3879657 | -24.728 | 50 | 96 | 123 | 80 | unknown protein; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G29780.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G25840.1 | protein_coding | 3:9451861-9457554 | -24.7084 | 1866 | 1924 | 1201 | 1145 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G13350.1); Has 159605 Blast hits to 120248 proteins in 3358 species: Archae - 256; Bacteria - 15698; Metazoa - 69851; Fungi - 20258; Plants - 17457; Viruses - 788; Other Eukaryotes - 35297 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G40010.1 | protein_coding | 4:18548444-18551183 | -24.6956 | 48 | 96 | 918 | 843 | SNF1-related protein kinase 2.7 encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. SNF1-related protein kinase 2.7 (SNRK2.7);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Serine/threonine-protein kinase-like, plant (InterPro:IPR015740); Protein kinase superfamily protein (TAIR:AT4G33950.1); Has 113721 Blast hits to 111945 proteins in 3588 species: Archae - 122; Bacteria - 13185; Metazoa - 42626; Fungi - 12251; Plants - 25423; Viruses - 494; Other Eukaryotes - 19620 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G07990.1 | protein_coding | 1:2476953-2483196 | -24.639 | 239 | 293 | 2573 | 2520 | SIT4 phosphatase-associated family protein SIT4 phosphatase-associated family protein; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SIT4 phosphatase-associated protein (InterPro:IPR007587); SIT4 phosphatase-associated family protein (TAIR:AT2G28360.1); Has 1048 Blast hits to 891 proteins in 200 species: Archae - 0; Bacteria - 31; Metazoa - 354; Fungi - 329; Plants - 109; Viruses - 3; Other Eukaryotes - 222 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G35560.2 | protein_coding | 4:16881336-16887083 | -24.6317 | 2693 | 2750 | 74 | 11 | Transducin/WD40 repeat-like superfamily protein Target promoter of the male germline-specific transcription factor DUO1. Transducin/WD40 repeat-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); transducin family protein / WD-40 repeat family protein (TAIR:AT5G05570.2). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G50000.1 | protein_coding | 3:18534450-18537073 | -24.5181 | 785 | 832 | 392 | 339 | casein kinase II, alpha chain 2 Encodes the casein kinase II (CK2) catalytic subunit (alpha). "casein kinase II, alpha chain 2" (CKA2);FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); casein kinase alpha 1 (TAIR:AT5G67380.1); Has 86321 Blast hits to 85419 proteins in 2558 species: Archae - 72; Bacteria - 9686; Metazoa - 32978; Fungi - 11348; Plants - 15028; Viruses - 319; Other Eukaryotes - 16890 (source: NCBI BLink). | |
| XLOC_028301 | AT5G02095.1 | Ch5:4341236-4341690 | AT1G27752.1 | protein_coding | 1:9662021-9667550 | -24.5159 | 74 | 125 | 2726 | 2669 | Ubiquitin system component Cue proteinUbiquitin system component Cue protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Ubiquitin system component Cue (InterPro:IPR003892); Has 423 Blast hits to 397 proteins in 140 species: Archae - 0; Bacteria - 35; Metazoa - 153; Fungi - 103; Plants - 62; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT3G10070.1 | protein_coding | 3:3103880-3106826 | -24.464 | 174 | 255 | 400 | 326 | TBP-associated factor 12Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12.TBP-associated factor 12 (TAF12);FUNCTIONS IN: DNA binding, transcription initiation factor activity; INVOLVED IN: transcription initiation; LOCATED IN: chloroplast, transcription factor TFIID complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIID (InterPro:IPR003228), Histone-fold (InterPro:IPR009072); Transcription initiation factor TFIID subunit A (TAIR:AT1G17440.2); Has 50598 Blast hits to 32470 proteins in 1374 species: Archae - 31; Bacteria - 3770; Metazoa - 21452; Fungi - 11498; Plants - 4385; Viruses - 864; Other Eukaryotes - 8598 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G76780.1 | protein_coding | 1:28814434-28822256 | -24.4582 | 53 | 107 | 5434 | 5383 | HSP20-like chaperones superfamily proteinHSP20-like chaperones superfamily protein;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); HSP20-like chaperones superfamily protein (TAIR:AT1G76770.1); Has 310212 Blast hits to 103002 proteins in 3336 species: Archae - 2366; Bacteria - 38795; Metazoa - 125626; Fungi - 30439; Plants - 14934; Viruses - 1639; Other Eukaryotes - 96413 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G33055.1 | protein_coding | 1:11971308-11972580 | -24.4402 | 1565 | 1599 | 240 | 198 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: anaerobic respiration; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G01430.1 | protein_coding | 3:165392-166542 | -24.3827 | 663 | 713 | 452 | 398 | NHL domain-containing protein (TAIR:AT5G14890.1); Has 98 Blast hits to 98 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G44800.1 | protein_coding | 5:18083277-18093907 | -24.3722 | 233 | 274 | 7022 | 6976 | chromatin remodeling 4chromatin remodeling 4 (CHR4);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: chromatin assembly or disassembly, regulation of transcription; LOCATED IN: chromatin, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1087 (InterPro:IPR009463), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Chromo domain (InterPro:IPR000953), SNF2-related (InterPro:IPR000330), DEAD-like helicase, N-terminal (InterPro:IPR014001), Chromo domain-like (InterPro:IPR016197), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), Homeodomain-related (InterPro:IPR012287), Zinc finger, PHD-finger (InterPro:IPR019787); chromatin remodeling factor CHD3 (PICKLE) (TAIR:AT2G25170.1); Has 35726 Blast hits to 27895 proteins in 2283 species: Archae - 135; Bacteria - 6476; Metazoa - 12546; Fungi - 6155; Plants - 3074; Viruses - 328; Other Eukaryotes - 7012 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G08010.1 | protein_coding | 5:2569098-2571877 | -24.2524 | 231 | 272 | 1595 | 1556 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G61040.1); Has 5732 Blast hits to 4319 proteins in 440 species: Archae - 66; Bacteria - 397; Metazoa - 2437; Fungi - 292; Plants - 238; Viruses - 35; Other Eukaryotes - 2267 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G07020.1 | protein_coding | 5:2180501-2182538 | -24.2238 | 604 | 644 | 88 | 48 | proline-rich family protein proline-rich family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G19560.1 | protein_coding | 2:8465690-8469145 | -24.1289 | 181 | 250 | 201 | 134 | proteasome family protein encodes a protein with a PAM domain involved in ethylene signaling. eer5 mutants show ethylene hypersensitivity in relation to hypocotyl elongation. EER5 interacts with EIN2 and with COP9 in Y2H assays. EIN3 protein levels are the same in WT and eer5-1 mutants. EER5 may be involved in promoting a dampening of the ethylene response. ENHANCED ETHYLENE RESPONSE 5 (EER5);CONTAINS InterPro DOMAIN/s: Proteasome component (PCI) domain (InterPro:IPR000717), PCI/PINT associated module (InterPro:IPR013143); Has 771 Blast hits to 770 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 260; Fungi - 323; Plants - 58; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G75860.1 | protein_coding | 1:28484129-28486077 | -24.1124 | 232 | 274 | 368 | 326 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G20100.1); Has 258 Blast hits to 235 proteins in 58 species: Archae - 0; Bacteria - 4; Metazoa - 59; Fungi - 16; Plants - 90; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.3 | Ch3:23422590-23425169 | AT1G76380.2 | protein_coding | 1:28651069-28654660 | -24.1112 | 728 | 774 | 55 | 0 | DNA-binding bromodomain-containing protein DNA-binding bromodomain-containing protein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Bromodomain, conserved site (InterPro:IPR018359), Bromodomain (InterPro:IPR001487); DNA-binding bromodomain-containing protein (TAIR:AT1G20670.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT4G33945.1 | protein_coding | 4:16267884-16270925 | -24.1095 | 1009 | 1045 | 184 | 140 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: cotyledon;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT5G60590.2 | protein_coding | 5:24357021-24358769 | -24.0093 | 1345 | 1380 | 899 | 862 | DHBP synthase RibB-like alpha/beta domainDHBP synthase RibB-like alpha/beta domain;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sua5/YciO/YrdC/YwlC (InterPro:IPR004388), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945), Sua5/YciO/YrdC, N-terminal (InterPro:IPR006070); DHBP synthase RibB-like alpha/beta domain (TAIR:AT3G01920.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G39380.2 | protein_coding | 4:18308854-18312748 | -24.0065 | 3661 | 3711 | 1921 | 1859 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; TSL-kinase interacting protein 1 (TAIR:AT2G36960.2). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G18480.1 | protein_coding | 3:6336692-6341788 | -23.9192 | 608 | 665 | 274 | 225 | CCAAT-displacement protein alternatively spliced product This gene is predicted to encode a protein thatFUNCTIONS as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation.CCAAT-displacement protein alternatively spliced product (CASP); INVOLVED IN: intra-Golgi vesicle-mediated transport; LOCATED IN: integral to membrane, Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: CASP, C-terminal (InterPro:IPR012955); Has 108439 Blast hits to 62245 proteins in 2877 species: Archae - 1242; Bacteria - 16953; Metazoa - 49041; Fungi - 8922; Plants - 5181; Viruses - 394; Other Eukaryotes - 26706 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G26730.1 | protein_coding | 3:9823524-9827547 | -23.9185 | 1565 | 1599 | 235 | 194 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841); Has 5292 Blast hits to 2238 proteins in 281 species: Archae - 3; Bacteria - 121; Metazoa - 1602; Fungi - 487; Plants - 437; Viruses - 6; Other Eukaryotes - 2636 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G20340.1 | protein_coding | 4:10984618-10988008 | -23.7908 | 51 | 113 | 1518 | 1463 | Transcription factor TFIIE, alpha subunitTranscription factor TFIIE, alpha subunit;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: endomembrane system, transcription factor TFIIE complex;CONTAINS InterPro DOMAIN/s: Transcription factor TFIIE, alpha subunit (InterPro:IPR002853), Transcription factor TFE/TFIIEalpha, HTH domain (InterPro:IPR017919); Transcription factor TFIIE, alpha subunit (TAIR:AT1G03280.1); Has 775 Blast hits to 709 proteins in 197 species: Archae - 3; Bacteria - 16; Metazoa - 261; Fungi - 178; Plants - 106; Viruses - 31; Other Eukaryotes - 180 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G11150.1 | protein_coding | 4:6799887-6801961 | -23.7449 | 22 | 96 | 358 | 293 | vacuolar ATP synthase subunit E1Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis. vacuolar ATP synthase subunit E1 (TUF);FUNCTIONS IN: proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: in 7 processes; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 18 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit E (InterPro:IPR002842); vacuolar H+-ATPase subunit E isoform 3 (TAIR:AT1G64200.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G27470.1 | protein_coding | 4:13734922-13736518 | -23.7312 | 2769 | 2805 | 972 | 932 | RING membrane-anchor 3 Encodes a RING finger E3 ubiquitin ligase. RING membrane-anchor 3 (RMA3);CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING membrane-anchor 1 (TAIR:AT4G03510.2); Has 2828 Blast hits to 2826 proteins in 265 species: Archae - 0; Bacteria - 0; Metazoa - 1348; Fungi - 459; Plants - 695; Viruses - 22; Other Eukaryotes - 304 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G62310.1 | protein_coding | 1:23033403-23039787 | -23.6644 | 238 | 270 | 2238 | 2207 | transcription factor jumonji (jmjC) domain-containing protein transcription factor jumonji (jmjC) domain-containing protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); Transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G11950.1); Has 795 Blast hits to 740 proteins in 102 species: Archae - 0; Bacteria - 2; Metazoa - 384; Fungi - 24; Plants - 360; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT2G29065.1 | protein_coding | 2:12484658-12487110 | -23.6488 | 43 | 93 | 792 | 741 | GRAS family transcription factor GRAS family transcription factor;CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT1G07520.1). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G38340.1 | protein_coding | 4:17954710-17958063 | -23.5428 | 971 | 1004 | 1765 | 1730 | Plant regulator RWP-RK family protein Plant regulator RWP-RK family protein;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035), GAF (InterPro:IPR003018); Plant regulator RWP-RK family protein (TAIR:AT1G76350.1); Has 720 Blast hits to 573 proteins in 47 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G20850.1 | protein_coding | 4:11160721-11170071 | -23.4683 | 1353 | 1408 | 3865 | 3810 | tripeptidyl peptidase ii Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant.tripeptidyl peptidase ii (TPP2);FUNCTIONS IN: tripeptidyl-peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Peptidase S8A, tripeptidyl peptidase II (InterPro:IPR022229); Has 6394 Blast hits to 6195 proteins in 1270 species: Archae - 226; Bacteria - 4362; Metazoa - 666; Fungi - 272; Plants - 126; Viruses - 0; Other Eukaryotes - 742 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G30630.1 | protein_coding | 1:10858232-10860322 | -23.4541 | 236 | 265 | 85 | 57 | Coatomer epsilon subunit Coatomer epsilon subunit;FUNCTIONS IN: protein transporter activity, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); Coatomer epsilon subunit (TAIR:AT2G34840.1); Has 442 Blast hits to 442 proteins in 180 species: Archae - 6; Bacteria - 14; Metazoa - 175; Fungi - 90; Plants - 92; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G56090.1 | protein_coding | 1:20977541-20979448 | -23.4224 | 1790 | 1829 | 106 | 59 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G30480.2); Has 5535 Blast hits to 5000 proteins in 436 species: Archae - 33; Bacteria - 410; Metazoa - 2580; Fungi - 616; Plants - 880; Viruses - 6; Other Eukaryotes - 1010 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G71860.1 | protein_coding | 1:27026677-27029092 | -23.3931 | 3654 | 3697 | 270 | 232 | protein tyrosine phosphatase 1 Encodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress.protein tyrosine phosphatase 1 (PTP1);FUNCTIONS IN: protein tyrosine phosphatase activity; INVOLVED IN: intracellular protein kinase cascade; LOCATED IN: nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Dual-specific/protein-tyrosine phosphatase, conserved region (InterPro:IPR000387), Protein-tyrosine phosphatase, receptor/non-receptor type (InterPro:IPR000242); Has 6497 Blast hits to 5202 proteins in 282 species: Archae - 2; Bacteria - 98; Metazoa - 5552; Fungi - 319; Plants - 71; Viruses - 173; Other Eukaryotes - 282 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT4G08500.1 | protein_coding | 4:5403671-5407320 | -23.3604 | 167 | 232 | 74 | 27 | MAPK/ERK kinase kinase 1Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. MAPK/ERK kinase kinase 1 (MEKK1);FUNCTIONS IN: protein binding, kinase binding, DNA binding, MAP kinase kinase kinase activity, kinase activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); mitogen-activated protein kinase kinase kinase 9 (TAIR:AT4G08480.1); Has 132336 Blast hits to 130259 proteins in 4567 species: Archae - 142; Bacteria - 14700; Metazoa - 49430; Fungi - 12971; Plants - 32949; Viruses - 685; Other Eukaryotes - 21459 (source: NCBI BLink). | |
| XLOC_002446 | AT1G07737.1 | Ch1:19052139-19052358 | AT3G21055.1 | protein_coding | 3:7376432-7377226 | -23.2786 | 33 | 75 | 425 | 383 | photosystem II subunit TEncodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). photosystem II subunit T (PSBTN);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast photosystem II, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Photosystem II 5 kD protein (TAIR:AT1G51400.1); Has 88 Blast hits to 88 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G64355.1 | protein_coding | 1:23885982-23887323 | -23.143 | 3647 | 3687 | 45 | 0 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3593 (InterPro:IPR021995); Has 301 Blast hits to 301 proteins in 96 species: Archae - 0; Bacteria - 143; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G48420.1 | protein_coding | 3:17929581-17931713 | -23.137 | 617 | 672 | 338 | 289 | Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinHaloacid dehalogenase-like hydrolase (HAD) superfamily protein;FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT4G39970.1); Has 12560 Blast hits to 12559 proteins in 2179 species: Archae - 78; Bacteria - 10284; Metazoa - 135; Fungi - 145; Plants - 385; Viruses - 3; Other Eukaryotes - 1530 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G64570.1 | protein_coding | 1:23978613-23983925 | -23.081 | 49 | 97 | 126 | 75 | Homeodomain-like superfamily protein DUO POLLEN 3 (DUO3);CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057); Has 1836 Blast hits to 1575 proteins in 289 species: Archae - 4; Bacteria - 248; Metazoa - 589; Fungi - 287; Plants - 112; Viruses - 46; Other Eukaryotes - 550 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G20100.1 | protein_coding | 1:6969025-6971036 | -23.047 | 232 | 280 | 426 | 375 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G75860.1); Has 471 Blast hits to 438 proteins in 92 species: Archae - 0; Bacteria - 14; Metazoa - 217; Fungi - 43; Plants - 91; Viruses - 1; Other Eukaryotes - 105 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT4G27520.1 | protein_coding | 4:13750156-13752103 | -23.0468 | 34 | 80 | 608 | 562 | early nodulin-like protein 2 early nodulin-like protein 2 (ENODL2);FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); early nodulin-like protein 1 (TAIR:AT5G53870.1); Has 168805 Blast hits to 80761 proteins in 2510 species: Archae - 213; Bacteria - 30974; Metazoa - 63826; Fungi - 28998; Plants - 14037; Viruses - 3902; Other Eukaryotes - 26855 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT1G73940.1 | protein_coding | 1:27798237-27799695 | -23.0269 | 21 | 75 | 78 | 26 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G49410.2); Has 54 Blast hits to 54 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G23530.1 | protein_coding | 1:8345595-8346733 | -22.9965 | 229 | 304 | 714 | 633 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G70470.1); Has 38 Blast hits to 38 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G51630.1 | protein_coding | 5:20969128-20975940 | -22.9912 | 233 | 293 | 3661 | 3590 | Disease resistance protein (TIR-NBS-LRR class) family Disease resistance protein (TIR-NBS-LRR class) family;FUNCTIONS IN: transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, apoptosis, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157), Disease resistance protein (InterPro:IPR000767); disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT4G16890.1); Has 26294 Blast hits to 18044 proteins in 708 species: Archae - 26; Bacteria - 1938; Metazoa - 2435; Fungi - 200; Plants - 20794; Viruses - 0; Other Eukaryotes - 901 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G52060.1 | protein_coding | 3:19310531-19312281 | -22.941 | 406 | 451 | 328 | 288 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth.Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT5G22070.1); Has 568 Blast hits to 568 proteins in 19 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 545; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT4G27890.1 | protein_coding | 4:13886033-13887272 | -22.8505 | 328 | 380 | 227 | 173 | HSP20-like chaperones superfamily proteinHSP20-like chaperones superfamily protein;CONTAINS InterPro DOMAIN/s: CS-like domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS domain (InterPro:IPR017447); HSP20-like chaperones superfamily protein (TAIR:AT5G53400.1); Has 1077 Blast hits to 1040 proteins in 209 species: Archae - 0; Bacteria - 27; Metazoa - 492; Fungi - 104; Plants - 168; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G55090.1 | protein_coding | 1:20554352-20558529 | -22.8492 | 973 | 1009 | 64 | 27 | carbon-nitrogen hydrolase family protein carbon-nitrogen hydrolase family protein;FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, NAD+ synthase (glutamine-hydrolyzing) activity, ATP binding; INVOLVED IN: nitrogen compound metabolic process, NAD biosynthetic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010), NAD synthase (InterPro:IPR003694), Glutamine-dependent NAD(+) synthetase, GAT domain-containing (InterPro:IPR014445), NAD/GMP synthase (InterPro:IPR022310); Has 5923 Blast hits to 5903 proteins in 2409 species: Archae - 233; Bacteria - 4478; Metazoa - 145; Fungi - 142; Plants - 70; Viruses - 0; Other Eukaryotes - 855 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G20130.1 | protein_coding | 2:8690293-8692490 | -22.8059 | 2034 | 2087 | 67 | 11 | like COV 1 like COV 1 (LCV1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF502 (InterPro:IPR007462); Protein ofunknown function (DUF502) (TAIR:AT2G20120.1); Has 2460 Blast hits to 2460 proteins in 579 species: Archae - 32; Bacteria - 1090; Metazoa - 1; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 1182 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G15240.1 | protein_coding | 2:6615456-6619074 | -22.8025 | 1350 | 1373 | 78 | 55 | UNC-50 family protein UNC-50 family protein;CONTAINS InterPro DOMAIN/s: UNC-50 (InterPro:IPR007881); Has 331 Blast hits to 331 proteins in 162 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 93; Plants - 47; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G18560.1 | protein_coding | 3:6393747-6394842 | -22.7955 | 1946 | 2008 | 497 | 432 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G49000.1); Has 95 Blast hits to 95 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_023962 | AT4G38545.2 | Ch4:18022932-18025298 | AT1G79050.1 | protein_coding | 1:29736959-29740179 | -22.7799 | 5 | 52 | 133 | 82 | recA DNA recombination family protein recA DNA recombination family protein;FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: DNA repair, SOS response, DNA recombination, DNA metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: DNA recombination/repair protein RecA/RadB, ATP-binding domain (InterPro:IPR020588), ATPase, AAA+ type, core (InterPro:IPR003593), DNA recombination/repair protein RecA, conserved site (InterPro:IPR020584), DNA recombination and repair protein RecA (InterPro:IPR013765), DNA recombination/repair protein RecA, monomer-monomer interface (InterPro:IPR020587); recA DNA recombination family protein (TAIR:AT2G19490.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G02810.1 | protein_coding | 3:608437-611139 | -22.7449 | 42 | 86 | 1732 | 1689 | Protein kinase superfamily protein Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G16500.1); Has 153092 Blast hits to 133237 proteins in 4793 species: Archae - 164; Bacteria - 24814; Metazoa - 52285; Fungi - 12626; Plants - 34968; Viruses - 826; Other Eukaryotes - 27409 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT3G27700.1 | protein_coding | 3:10256895-10261975 | -22.7428 | 3365 | 3416 | 83 | 43 | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 3784 Blast hits to 2558 proteins in 341 species: Archae - 8; Bacteria - 515; Metazoa - 625; Fungi - 291; Plants - 164; Viruses - 7; Other Eukaryotes - 2174 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT5G37950.1 | protein_coding | 5:15115883-15118085 | -22.7122 | 443 | 493 | 1215 | 1165 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: metabolic process;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT5G38010.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT5G04160.1 | protein_coding | 5:1142735-1145008 | -22.6924 | 3119 | 3152 | 75 | 40 | Nucleotide-sugar transporter family protein Nucleotide-sugar transporter family protein;FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF250 (InterPro:IPR004853); Nucleotide-sugar transporter family protein (TAIR:AT3G10290.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G50170.1 | protein_coding | 5:20420951-20425604 | -22.6877 | 3651 | 3698 | 75 | 33 | C2 calcium/lipid-binding and GRAM domain containing protein C2 calcium/lipid-binding and GRAM domain containing protein;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); C2 calcium/lipid-binding and GRAM domain containing protein (TAIR:AT1G03370.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G05490.1 | protein_coding | 1:1618504-1623489 | -22.6624 | 66 | 116 | 970 | 915 | chromatin remodeling 31 chromatin remodeling 31 (chr31);FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); chromatin remodeling 40 (TAIR:AT3G24340.1); Has 38115 Blast hits to 26256 proteins in 2107 species: Archae - 207; Bacteria - 10267; Metazoa - 11226; Fungi - 5719; Plants - 1929; Viruses - 244; Other Eukaryotes - 8523 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT5G57660.1 | protein_coding | 5:23355337-23356989 | -22.6021 | 100 | 153 | 1018 | 957 | CONSTANS-like 5 CONSTANS-like 5 (COL5);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); CONSTANS-like 4 (TAIR:AT5G24930.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G29000.1 | protein_coding | 4:14293513-14297066 | -22.5621 | 971 | 993 | 156 | 134 | Tesmin/TSO1-like CXC domain-containing proteinTesmin/TSO1-like CXC domain-containing protein;CONTAINS InterPro DOMAIN/s: Tesmin/TSO1-like, CXC (InterPro:IPR005172); Tesmin/TSO1-like CXC domain-containing protein (TAIR:AT2G20110.1); Has 1016 Blast hits to 666 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 285; Fungi - 4; Plants - 322; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT3G10960.1 | protein_coding | 3:3424813-3427058 | -22.4898 | 1 | 51 | 1963 | 1900 | AZA-guanine resistant1 Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). AZA-guanine resistant1 (AZG1);FUNCTIONS IN: transmembrane transporter activity, purine transmembrane transporter activity; INVOLVED IN: purine transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Xanthine/uracil/vitamin C permease (InterPro:IPR006043); Xanthine/uracil permease family protein (TAIR:AT5G50300.1); Has 8325 Blast hits to 8321 proteins in 1933 species: Archae - 105; Bacteria - 6300; Metazoa - 12; Fungi - 117; Plants - 83; Viruses - 0; Other Eukaryotes - 1708 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G52320.2 | protein_coding | 1:19484221-19487997 | -22.476 | 231 | 265 | 2268 | 2231 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF630 (InterPro:IPR006868), Protein ofunknown function DUF632 (InterPro:IPR006867); Protein ofunknown function (DUF630 and DUF632) (TAIR:AT5G25590.1); Has 8725 Blast hits to 7476 proteins in 620 species: Archae - 10; Bacteria - 622; Metazoa - 3286; Fungi - 1319; Plants - 1442; Viruses - 221; Other Eukaryotes - 1825 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G51140.1 | protein_coding | 3:18997600-18999904 | -22.4592 | 1862 | 1884 | 1298 | 1276 | Protein ofunknown function (DUF3353) Protein ofunknown function (DUF3353); INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3353 (InterPro:IPR021788); Protein ofunknown function (DUF3353) (TAIR:AT5G23040.1); Has 193 Blast hits to 193 proteins in 61 species: Archae - 0; Bacteria - 77; Metazoa - 0; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G23740.2 | protein_coding | 2:10097265-10103398 | -22.44 | 191 | 242 | 83 | 39 | nucleic acid binding;sequence-specific DNA binding transcription factors;zinc ion binding Encodes a SET-domain protein SUVR5 that mediates H3K9me2 deposition and silencing at stimulus response genes in a DNA methylation-independent manner. nucleic acid binding;sequence-specific DNA binding transcription factors;zinc ion binding;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: chromatin modification; LOCATED IN: intracellular, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), SET domain (InterPro:IPR001214), Pre-SET domain (InterPro:IPR007728), Post-SET domain (InterPro:IPR003616), Zinc finger, C2H2-type (InterPro:IPR007087); SU(VAR)3-9 homolog 5 (TAIR:AT2G35160.1). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G38600.1 | protein_coding | 4:18040623-18049700 | -22.4331 | 622 | 675 | 5980 | 5928 | HEAT repeat ;HECT-domain (ubiquitin-transferase)Encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. KAKTUS (KAK);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: trichome branching, DNA endoreduplication; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024), HECT (InterPro:IPR000569); ubiquitin-protein ligase 4 (TAIR:AT5G02880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G24240.1 | protein_coding | 3:8780238-8784453 | -22.431 | 3659 | 3710 | 317 | 266 | Leucine-rich repeat receptor-like protein kinase family protein Leucine-rich repeat receptor-like protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Leucine-rich repeat transmembrane protein kinase family protein (TAIR:AT5G48940.1); Has 246558 Blast hits to 135557 proteins in 3810 species: Archae - 176; Bacteria - 24262; Metazoa - 71588; Fungi - 10499; Plants - 111580; Viruses - 361; Other Eukaryotes - 28092 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.5 | Ch1:22294362-22297374 | AT3G11030.1 | protein_coding | 3:3456257-3459380 | -22.4195 | 1428 | 1512 | 362 | 290 | TRICHOME BIREFRINGENCE-LIKE 32 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 32 (TBL32);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 33 (TAIR:AT2G40320.1); Has 40045 Blast hits to 14436 proteins in 846 species: Archae - 57; Bacteria - 5065; Metazoa - 12608; Fungi - 2698; Plants - 11562; Viruses - 2042; Other Eukaryotes - 6013 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.1 | Ch1:22294362-22297374 | AT3G11030.1 | protein_coding | 3:3456257-3459380 | -22.4195 | 1326 | 1410 | 362 | 290 | TRICHOME BIREFRINGENCE-LIKE 32 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 32 (TBL32);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 33 (TAIR:AT2G40320.1); Has 40045 Blast hits to 14436 proteins in 846 species: Archae - 57; Bacteria - 5065; Metazoa - 12608; Fungi - 2698; Plants - 11562; Viruses - 2042; Other Eukaryotes - 6013 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G20350.1 | protein_coding | 5:6876441-6881506 | -22.4059 | 971 | 1004 | 36 | 1 | Ankyrin repeat family protein with DHHC zinc finger domain Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. TIP GROWTH DEFECTIVE 1 (TIP1);FUNCTIONS IN: acyl binding, S-acyltransferase activity; INVOLVED IN: response to salt stress, cell tip growth; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Ankyrin repeat family protein with DHHC zinc finger domain (TAIR:AT2G14255.1); Has 74376 Blast hits to 32836 proteins in 1312 species: Archae - 100; Bacteria - 6632; Metazoa - 35576; Fungi - 7192; Plants - 4422; Viruses - 788; Other Eukaryotes - 19666 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G16260.1 | protein_coding | 3:5509344-5513245 | -22.3668 | 228 | 265 | 2798 | 2759 | tRNAse Z4 Encodes a tRNase Z.tRNAse Z4 (TRZ4);FUNCTIONS IN: 3'-tRNA processing endoribonuclease activity, catalytic activity; INVOLVED IN: tRNA 3'-end processing, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribonuclease Z (InterPro:IPR013471); tRNAse Z3 (TAIR:AT1G52160.1); Has 6299 Blast hits to 4396 proteins in 1654 species: Archae - 442; Bacteria - 4351; Metazoa - 254; Fungi - 243; Plants - 108; Viruses - 0; Other Eukaryotes - 901 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G55620.1 | protein_coding | 3:20634057-20636555 | -22.3579 | 406 | 451 | 112 | 65 | Translation initiation factor IF6embryo defective 1624 (emb1624);FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: translational initiation, embryo development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); Translation initiation factor IF6 (TAIR:AT2G39820.1); Has 941 Blast hits to 941 proteins in 349 species: Archae - 255; Bacteria - 0; Metazoa - 235; Fungi - 146; Plants - 134; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT1G14590.1 | protein_coding | 1:4998767-5000710 | -22.3422 | 4080 | 4106 | 652 | 626 | Nucleotide-diphospho-sugar transferase family protein Nucleotide-diphospho-sugar transferase family protein;CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); Nucleotide-diphospho-sugar transferase family protein (TAIR:AT2G02061.1); Has 314 Blast hits to 308 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 294; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT4G04614.1 | protein_coding | 4:2327044-2328264 | -22.3302 | 1346 | 1398 | 582 | 512 | unknown protein; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G73110.1 | protein_coding | 1:27494121-27496969 | -22.2724 | 970 | 999 | 109 | 79 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: ATPase activity, ATP binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959); rubisco activase (TAIR:AT2G39730.1); Has 469 Blast hits to 469 proteins in 170 species: Archae - 27; Bacteria - 71; Metazoa - 17; Fungi - 60; Plants - 256; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G01810.1 | protein_coding | 1:295207-295859 | -22.268 | 42 | 93 | 275 | 237 | unknown protein; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G19600.1 | protein_coding | 4:10672765-10676929 | -22.2243 | 89 | 156 | 1531 | 1448 | Cyclin family proteinEncodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV). CYCT1;4;FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle, response to virus, trichome morphogenesis, leaf development; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367), Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); Cyclin family protein (TAIR:AT5G45190.1); Has 2421 Blast hits to 2391 proteins in 275 species: Archae - 2; Bacteria - 35; Metazoa - 1157; Fungi - 528; Plants - 373; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT1G49832.1 | ncRNA | 1:18447615-18448335 | -22.2 | 267 | 322 | 167 | 114 | ||
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G29910.1 | protein_coding | 2:12751147-12753241 | -22.1933 | 235 | 266 | 1316 | 1283 | F-box/RNI-like superfamily protein F-box/RNI-like superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Leucine-rich repeat 2 (InterPro:IPR013101); F-box/RNI-like superfamily protein (TAIR:AT2G29930.3); Has 1593 Blast hits to 1569 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1593; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT5G66690.1 | protein_coding | 5:26625049-26626822 | -22.1772 | 217 | 260 | 1397 | 1353 | UDP-Glycosyltransferase superfamily proteinUGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides.UGT72E2;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT5G26310.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT2G28360.1 | protein_coding | 2:12124152-12130092 | -22.1547 | 11 | 39 | 187 | 156 | SIT4 phosphatase-associated family protein SIT4 phosphatase-associated family protein; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SIT4 phosphatase-associated protein (InterPro:IPR007587); SIT4 phosphatase-associated family protein (TAIR:AT1G07990.1); Has 1543 Blast hits to 1191 proteins in 250 species: Archae - 2; Bacteria - 177; Metazoa - 564; Fungi - 334; Plants - 115; Viruses - 14; Other Eukaryotes - 337 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G27830.1 | protein_coding | 3:10318455-10319920 | -22.1328 | 626 | 673 | 154 | 105 | ribosomal protein L12-A 50S ribosomal protein L12-Aribosomal protein L12-A (RPL12-A);FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: cotyledon, juvenile leaf, leaf;CONTAINS InterPro DOMAIN/s: Ribosomal protein L7/L12 (InterPro:IPR000206), Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); ribosomal protein L12-C (TAIR:AT3G27850.1); Has 8536 Blast hits to 8536 proteins in 2747 species: Archae - 0; Bacteria - 5673; Metazoa - 193; Fungi - 128; Plants - 248; Viruses - 0; Other Eukaryotes - 2294 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G28470.1 | protein_coding | 2:12168840-12173991 | -22.1226 | 607 | 655 | 101 | 57 | beta-galactosidase 8 putative beta-galactosidase (BGAL8 gene) beta-galactosidase 8 (BGAL8);FUNCTIONS IN: cation binding, sugar binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35, conserved site (InterPro:IPR019801), Glycoside hydrolase, family 35 (InterPro:IPR001944), D-galactoside/L-rhamnose binding SUEL lectin (InterPro:IPR000922), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Galactose-binding domain-like (InterPro:IPR008979); beta galactosidase 1 (TAIR:AT3G13750.1); Has 2800 Blast hits to 2372 proteins in 478 species: Archae - 15; Bacteria - 1080; Metazoa - 760; Fungi - 211; Plants - 631; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT3G57910.1 | protein_coding | 3:21442642-21446183 | -22.0805 | 23 | 74 | 703 | 656 | D111/G-patch domain-containing proteinD111/G-patch domain-containing protein;FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); D111/G-patch domain-containing protein (TAIR:AT5G26610.3); Has 4544 Blast hits to 3364 proteins in 343 species: Archae - 10; Bacteria - 136; Metazoa - 2001; Fungi - 471; Plants - 301; Viruses - 43; Other Eukaryotes - 1582 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G44200.1 | protein_coding | 3:15906348-15912040 | -22.0787 | 1354 | 1383 | 50 | 25 | NIMA (never in mitosis, gene A)-related 6 Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. "NIMA (never in mitosis, gene A)-related 6" (NEK6);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: microtubule-based process, epidermal cell differentiation; LOCATED IN: cortical microtubule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); NIMA-related serine/threonine kinase 1 (TAIR:AT1G54510.3); Has 127749 Blast hits to 124714 proteins in 4408 species: Archae - 106; Bacteria - 14910; Metazoa - 47444; Fungi - 12949; Plants - 30417; Viruses - 519; Other Eukaryotes - 21404 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G28720.1 | protein_coding | 2:12326808-12327808 | -22.0785 | 218 | 263 | 242 | 192 | Histone superfamily protein Histone superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); Histone superfamily protein (TAIR:AT3G45980.1); Has 3535 Blast hits to 3431 proteins in 349 species: Archae - 0; Bacteria - 57; Metazoa - 2253; Fungi - 226; Plants - 491; Viruses - 2; Other Eukaryotes - 506 (source: NCBI BLink). | |
| XLOC_011026 | AT2G07042.1 | Ch2:2919953-2922249 | AT4G13880.1 | protein_coding | 4:8025804-8028614 | -22.0629 | 421 | 473 | 2431 | 2359 | receptor like protein 48 receptor like protein 48 (RLP48); INVOLVED IN: signal transduction; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 47 (TAIR:AT4G13810.2); Has 81614 Blast hits to 24875 proteins in 996 species: Archae - 37; Bacteria - 6005; Metazoa - 13733; Fungi - 821; Plants - 54574; Viruses - 20; Other Eukaryotes - 6424 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G32810.2 | protein_coding | 1:11881311-11886015 | -22.0202 | 224 | 255 | 3142 | 3111 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT4G10600.1); Has 8965 Blast hits to 5782 proteins in 447 species: Archae - 8; Bacteria - 670; Metazoa - 4118; Fungi - 1126; Plants - 398; Viruses - 78; Other Eukaryotes - 2567 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G05630.1 | protein_coding | 5:1682301-1684504 | -21.9773 | 323 | 370 | 1191 | 1143 | Amino acid permease family protein Encodes POLYAMINE UPTAKE TRANSPORTER 3, an amino acid permease family protein. Amino acid permease family protein;FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: transport, amino acid transport, transmembrane transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: shoot apex, leaf whorl, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease domain (InterPro:IPR004841); Amino acid permease family protein (TAIR:AT1G31830.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G26830.1 | protein_coding | 1:9295565-9298629 | -21.9666 | 669 | 718 | 2197 | 2149 | cullin 3 Cullin, putative, similar to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens);CONTAINS Pfam profile PF00888: Cullin family. Interacts with other components of E3 ligase complex suggesting itFUNCTIONS in RUB-modification. Forms complexes with BTB domain proteins forming a novel class of E3-based ubiquitin protein-ligase complexes. Mutant is early flowering and has a reduced sensitivity to far-red light. cul3a/cul3b homozygous/heterozygous plants are embryo lethal. cullin 3 (CUL3);CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Cullin homology (InterPro:IPR016158), Cullin protein, neddylation domain (InterPro:IPR019559), Cullin, N-terminal (InterPro:IPR001373), Cullin repeat-like-containing domain (InterPro:IPR016159); cullin 3B (TAIR:AT1G69670.1); Has 2310 Blast hits to 2269 proteins in 235 species: Archae - 0; Bacteria - 9; Metazoa - 1034; Fungi - 455; Plants - 372; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G52870.1 | protein_coding | 3:19593073-19595834 | -21.9664 | 1448 | 1479 | 70 | 28 | IQ calmodulin-binding motif family protein IQ calmodulin-binding motif family protein;CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); calmodulin-binding family protein (TAIR:AT3G58480.1); Has 341 Blast hits to 277 proteins in 58 species: Archae - 0; Bacteria - 26; Metazoa - 0; Fungi - 100; Plants - 209; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G28400.1 | protein_coding | 5:10344024-10348234 | -21.965 | 617 | 665 | 514 | 472 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G28320.1); Has 2580 Blast hits to 2028 proteins in 270 species: Archae - 20; Bacteria - 158; Metazoa - 939; Fungi - 198; Plants - 144; Viruses - 14; Other Eukaryotes - 1107 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G36740.1 | protein_coding | 2:15406622-15409912 | -21.9145 | 233 | 284 | 604 | 538 | sequence-specific DNA binding transcription factors;DNA binding;DNA binding SWC2;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: YL1 nuclear, C-terminal (InterPro:IPR013272), YL1 nuclear (InterPro:IPR008895); Has 4932 Blast hits to 3253 proteins in 360 species: Archae - 2; Bacteria - 230; Metazoa - 1594; Fungi - 576; Plants - 159; Viruses - 97; Other Eukaryotes - 2274 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G01080.2 | protein_coding | 1:44970-47059 | -21.8857 | 239 | 284 | 507 | 456 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G22260.2 | protein_coding | 3:7870826-7873597 | -21.8824 | 3630 | 3685 | 191 | 121 | Cysteine proteinases superfamily protein Cysteine proteinases superfamily protein;FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); Cysteine proteinases superfamily protein (TAIR:AT3G02070.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G29910.1 | protein_coding | 2:12751147-12753241 | -21.8334 | 624 | 664 | 1584 | 1545 | F-box/RNI-like superfamily protein F-box/RNI-like superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Leucine-rich repeat 2 (InterPro:IPR013101); F-box/RNI-like superfamily protein (TAIR:AT2G29930.3); Has 1593 Blast hits to 1569 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1593; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G18550.1 | protein_coding | 4:10224661-10227140 | -21.8154 | 48 | 98 | 45 | 0 | alpha/beta-Hydrolases superfamily protein DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. alpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: triglyceride lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); alpha/beta-Hydrolases superfamily protein (TAIR:AT1G06250.1); Has 1222 Blast hits to 1214 proteins in 260 species: Archae - 0; Bacteria - 234; Metazoa - 8; Fungi - 231; Plants - 573; Viruses - 1; Other Eukaryotes - 175 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT5G46630.2 | protein_coding | 5:18920334-18923551 | -21.7963 | 269 | 309 | 53 | 16 | Clathrin adaptor complexes medium subunit family protein clathrin adaptor complexes medium subunit family protein,CONTAINS Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes Clathrin adaptor complexes medium subunit family protein; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin coat associated protein AP-50 (InterPro:IPR015629), Longin-like (InterPro:IPR011012); Clathrin adaptor complexes medium subunit family protein (TAIR:AT1G60780.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_011416 | AT2G18440.1 | Ch2:7994941-7997239 | AT3G11830.1 | protein_coding | 3:3732628-3736471 | -21.7895 | 989 | 1036 | 39 | 1 | TCP-1/cpn60 chaperonin family protein TCP-1/cpn60 chaperonin family protein;FUNCTIONS IN: unfolded protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); T-complex protein 1 alpha subunit (TAIR:AT3G20050.1); Has 19825 Blast hits to 19758 proteins in 3880 species: Archae - 808; Bacteria - 8913; Metazoa - 2158; Fungi - 1512; Plants - 862; Viruses - 0; Other Eukaryotes - 5572 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT1G36370.1 | protein_coding | 1:13696042-13698739 | -21.7699 | 317 | 361 | 319 | 273 | serine hydroxymethyltransferase 7 Encodes a putative serine hydroxymethyltransferase.serine hydroxymethyltransferase 7 (SHM7);FUNCTIONS IN: pyridoxal phosphate binding, glycine hydroxymethyltransferase activity, catalytic activity; INVOLVED IN: response to cadmium ion, glycine metabolic process, L-serine metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Serine hydroxymethyltransferase, pyridoxal phosphate binding site (InterPro:IPR019798), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Serine hydroxymethyltransferase (InterPro:IPR001085); serine hydroxymethyltransferase 6 (TAIR:AT1G22020.1); Has 11689 Blast hits to 11664 proteins in 2845 species: Archae - 258; Bacteria - 6485; Metazoa - 362; Fungi - 287; Plants - 350; Viruses - 6; Other Eukaryotes - 3941 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G49440.1 | protein_coding | 5:20048239-20049776 | -21.7308 | 51 | 86 | 1203 | 1159 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G52660.1 | protein_coding | 3:19521654-19525009 | -21.7278 | 326 | 359 | 402 | 368 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT4G00830.2); Has 39411 Blast hits to 22154 proteins in 1003 species: Archae - 84; Bacteria - 1991; Metazoa - 19033; Fungi - 3968; Plants - 4828; Viruses - 731; Other Eukaryotes - 8776 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G20680.1 | protein_coding | 5:6997990-7002033 | -21.6666 | 50 | 99 | 773 | 736 | TRICHOME BIREFRINGENCE-LIKE 16 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 16 (TBL16);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 14 (TAIR:AT5G64020.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT4G14160.1 | protein_coding | 4:8167351-8173417 | -21.6407 | 308 | 352 | 154 | 110 | Sec23/Sec24 protein transport family protein Sec23/Sec24 protein transport family protein;FUNCTIONS IN: transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sec23/Sec24, helical domain (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24, trunk domain (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin domain (InterPro:IPR007123); Sec23/Sec24 protein transport family protein (TAIR:AT3G23660.1); Has 1490 Blast hits to 1472 proteins in 242 species: Archae - 0; Bacteria - 0; Metazoa - 529; Fungi - 429; Plants - 324; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G42850.1 | protein_coding | 5:17181412-17182743 | -21.6311 | 236 | 273 | 74 | 35 | Thioredoxin superfamily protein Thioredoxin superfamily protein;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Protein ofunknown function DUF953, thioredoxin-like (InterPro:IPR010357); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G69280.1 | protein_coding | 1:26045158-26048190 | -21.5954 | 236 | 273 | 2271 | 2228 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G03630.1); Has 885 Blast hits to 474 proteins in 40 species: Archae - 0; Bacteria - 4; Metazoa - 731; Fungi - 9; Plants - 68; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). | |
| XLOC_004105 | AT1G09927.1 | Ch1:30041286-30041963 | AT1G03780.3 | protein_coding | 1:947520-951850 | -21.5909 | 547 | 578 | 119 | 87 | targeting protein for XKLP2Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. targeting protein for XKLP2 (TPX2);FUNCTIONS IN: microtubule binding; INVOLVED IN: spindle assembly; LOCATED IN: nucleus; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Cell cycle regulated microtubule associated protein (InterPro:IPR022021), Xklp2 targeting protein (InterPro:IPR009675); TPX2 (targeting protein for Xklp2) protein family (TAIR:AT5G44270.1). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G09150.2 | protein_coding | 4:5828505-5833725 | -21.5892 | 602 | 658 | 1975 | 1922 | T-complex protein 11 T-complex protein 11;FUNCTIONS IN: phosphopantetheine binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862), Phosphopantetheine attachment site (InterPro:IPR006162); T-complex protein 11 (TAIR:AT1G22930.1). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G68670.1 | protein_coding | 1:25781801-25784118 | -21.5817 | 238 | 270 | 620 | 585 | myb-like transcription factor family protein myb-like transcription factor family protein;CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); myb-like transcription factor family protein (TAIR:AT1G25550.1); Has 1631 Blast hits to 1627 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 1600; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G51120.1 | protein_coding | 3:18986026-18992074 | -21.5281 | 1493 | 1533 | 39 | 1 | DNA binding;zinc ion binding;nucleic acid binding;nucleic acid bindingDNA binding;zinc ion binding;nucleic acid binding;nucleic acid binding;FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: histone modification, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Plus-3 domain, subgroup (InterPro:IPR018144), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), GYF (InterPro:IPR003169), SWIB/MDM2 domain (InterPro:IPR003121), Plus-3 (InterPro:IPR004343), SWIB domain (InterPro:IPR019835), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); nucleic acid binding;zinc ion binding;DNA binding (TAIR:AT2G16485.1); Has 2327 Blast hits to 1758 proteins in 258 species: Archae - 0; Bacteria - 308; Metazoa - 909; Fungi - 193; Plants - 493; Viruses - 18; Other Eukaryotes - 406 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G36945.1 | protein_coding | 4:17419918-17422130 | -21.4835 | 635 | 680 | 67 | 24 | PLC-like phosphodiesterases superfamily protein PLC-like phosphodiesterases superfamily protein;FUNCTIONS IN: phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: intracellular signaling pathway, lipid metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphatidylinositol-specific , X domain (InterPro:IPR000909), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946); PLC-like phosphodiesterases superfamily protein (TAIR:AT3G19310.1); Has 486 Blast hits to 483 proteins in 111 species: Archae - 0; Bacteria - 90; Metazoa - 8; Fungi - 169; Plants - 156; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). | |
| XLOC_001952 | AT1G34418.1 | Ch1:12582122-12582721 | AT1G26270.1 | protein_coding | 1:9089469-9092560 | -21.4417 | 130 | 186 | 1993 | 1935 | Phosphatidylinositol 3- and 4-kinase family protein Phosphatidylinositol 3- and 4-kinase family protein;FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403); phosphoinositide 4-kinase gamma 7 (TAIR:AT2G03890.1); Has 671 Blast hits to 650 proteins in 184 species: Archae - 0; Bacteria - 8; Metazoa - 176; Fungi - 103; Plants - 278; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G17070.1 | protein_coding | 5:5613307-5616233 | -21.4179 | 672 | 713 | 714 | 671 | CONTAINS InterPro DOMAIN/s: Protein phosphatase 4 core regulatory subunit R2 (InterPro:IPR015267); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G20680.1 | protein_coding | 5:6997990-7002033 | -21.4112 | 1327 | 1375 | 781 | 734 | TRICHOME BIREFRINGENCE-LIKE 16 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 16 (TBL16);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 14 (TAIR:AT5G64020.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G35900.1 | protein_coding | 2:15069872-15071829 | -21.3998 | 1449 | 1482 | 732 | 700 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 32 Blast hits to 32 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT1G80010.1 | protein_coding | 1:30097336-30100045 | -21.3691 | 127 | 179 | 247 | 190 | FAR1-related sequence 8 FAR1-related sequence 8 (FRS8);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); FAR1-related sequence 6 (TAIR:AT1G52520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT4G27940.1 | protein_coding | 4:13904265-13907405 | -21.3598 | 517 | 546 | 101 | 65 | manganese tracking factor for mitochondrial SOD2 manganese tracking factor for mitochondrial SOD2 (MTM1);FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G19280.1 | protein_coding | 3:6681196-6684029 | -21.3425 | 626 | 655 | 198 | 171 | fucosyltransferase 11Encodes a protein with core α1,3-fucosyltransferase activity. fucosyltransferase 11 (FUT11);FUNCTIONS IN: 4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase activity, transferase activity, transferring glycosyl groups, fucosyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 10 (InterPro:IPR001503); fucosyltransferase 12 (TAIR:AT1G49710.1); Has 1598 Blast hits to 1593 proteins in 204 species: Archae - 4; Bacteria - 180; Metazoa - 1025; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G41740.1 | protein_coding | 2:17410672-17417820 | -21.3156 | 3354 | 3415 | 257 | 202 | villin 2Encodes a protein with high homology to animal villin. villin 2 (VLN2);FUNCTIONS IN: actin binding, protein binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Gelsolin (InterPro:IPR007122), Villin headpiece (InterPro:IPR003128), Gelsolin domain (InterPro:IPR007123); villin 3 (TAIR:AT3G57410.1); Has 3753 Blast hits to 2353 proteins in 268 species: Archae - 0; Bacteria - 52; Metazoa - 2426; Fungi - 285; Plants - 242; Viruses - 2; Other Eukaryotes - 746 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G79940.1 | protein_coding | 1:30069519-30073440 | -21.2949 | 691 | 719 | 2230 | 2199 | DnaJ / Sec63 Brl domains-containing proteinJ domain protein localized in ER membrane. Mutants have defective pollen germination. ATERDJ2A;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, integral to endoplasmic reticulum membrane, endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); DnaJ / Sec63 Brl domains-containing protein (TAIR:AT4G21180.1); Has 25269 Blast hits to 23100 proteins in 3289 species: Archae - 158; Bacteria - 9141; Metazoa - 5761; Fungi - 2418; Plants - 2108; Viruses - 143; Other Eukaryotes - 5540 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G47950.1 | protein_coding | 2:19624022-19624922 | -21.2946 | 19 | 70 | 345 | 305 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: root, flower; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G62990.1); Has 22 Blast hits to 22 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G26290.1 | protein_coding | 3:9632608-9634822 | -21.2494 | 620 | 664 | 93 | 47 | cytochrome P450, family 71, subfamily B, polypeptide 26 putative cytochrome P450 "cytochrome P450, family 71, subfamily B, polypeptide 26" (CYP71B26);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 71, subfamily B, polypeptide 34 (TAIR:AT3G26300.1); Has 33376 Blast hits to 33121 proteins in 1698 species: Archae - 51; Bacteria - 3546; Metazoa - 11995; Fungi - 7038; Plants - 9514; Viruses - 3; Other Eukaryotes - 1229 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G73810.1 | protein_coding | 1:27752342-27755297 | -21.2464 | 1946 | 1992 | 1249 | 1209 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT1G68390.1); Has 580 Blast hits to 580 proteins in 21 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 553; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G07795.1 | protein_coding | 1:2414143-2414967 | -21.2265 | 3462 | 3527 | 144 | 66 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G28725.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT1G68670.1 | protein_coding | 1:25781801-25784118 | -21.1866 | 1401 | 1429 | 170 | 140 | myb-like transcription factor family protein myb-like transcription factor family protein;CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); myb-like transcription factor family protein (TAIR:AT1G25550.1); Has 1631 Blast hits to 1627 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 1600; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G42960.1 | protein_coding | 5:17235092-17236679 | -21.1751 | 2772 | 2805 | 86 | 50 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G45170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT3G27320.1 | protein_coding | 3:10090056-10092791 | -21.1637 | 13 | 46 | 64 | 28 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-3 (InterPro:IPR013094); carboxyesterase 16 (TAIR:AT5G14310.1); Has 7383 Blast hits to 7368 proteins in 1325 species: Archae - 107; Bacteria - 4231; Metazoa - 304; Fungi - 631; Plants - 1324; Viruses - 3; Other Eukaryotes - 783 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G06750.1 | protein_coding | 5:2086266-2088997 | -21.1585 | 60 | 91 | 1320 | 1288 | Protein phosphatase 2C family protein Protein phosphatase 2C family protein;FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT5G66080.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G33970.1 | protein_coding | 4:16278941-16282048 | -21.1269 | 1214 | 1251 | 2097 | 2067 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein;FUNCTIONS IN: structural constituent of cell wall; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; Leucine-rich repeat (LRR) family protein (TAIR:AT2G15880.1); Has 345457 Blast hits to 110650 proteins in 3295 species: Archae - 766; Bacteria - 68103; Metazoa - 108699; Fungi - 41264; Plants - 80873; Viruses - 7608; Other Eukaryotes - 38144 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G04390.1 | protein_coding | 5:1238820-1240517 | -21.1189 | 3669 | 3706 | 173 | 144 | C2H2-type zinc finger family protein C2H2-type zinc finger family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); C2H2-type zinc finger family protein (TAIR:AT3G10470.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT3G09770.1 | protein_coding | 3:2996179-2998255 | -21.0938 | 167 | 231 | 474 | 420 | RING/U-box superfamily protein Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT5G03200.1); Has 9681 Blast hits to 6810 proteins in 512 species: Archae - 8; Bacteria - 442; Metazoa - 3215; Fungi - 970; Plants - 3369; Viruses - 475; Other Eukaryotes - 1202 (source: NCBI BLink). | |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT4G31408.1 | ncRNA | 4:15241687-15242987 | -21.0599 | 1164 | 1189 | 240 | 215 | other RNA | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G74470.1 | protein_coding | 1:27991165-27993445 | -21.0446 | 2203 | 2226 | 38 | 15 | Pyridine nucleotide-disulphide oxidoreductase family protein Encodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate. Pyridine nucleotide-disulphide oxidoreductase family protein;FUNCTIONS IN: geranylgeranyl reductase activity; INVOLVED IN: chlorophyll biosynthetic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Geranylgeranyl reductase (InterPro:IPR010253), Geranylgeranyl reductase, plant/cyanobacteria (InterPro:IPR011774), Geranylgeranyl reductase, plant/prokaryotic (InterPro:IPR011777); Has 4540 Blast hits to 4539 proteins in 1185 species: Archae - 562; Bacteria - 2644; Metazoa - 5; Fungi - 25; Plants - 302; Viruses - 0; Other Eukaryotes - 1002 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G18840.1 | protein_coding | 2:8158106-8160091 | -21.0182 | 973 | 993 | 260 | 240 | Integral membrane Yip1 family protein Integral membrane Yip1 family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); Integral membrane Yip1 family protein (TAIR:AT4G30260.1); Has 825 Blast hits to 825 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 402; Fungi - 189; Plants - 114; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT3G58020.1 | protein_coding | 3:21479380-21481349 | -21.0182 | 46 | 81 | 1022 | 974 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Chaperone DnaJ-domain superfamily protein (TAIR:AT2G42080.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT5G28442.1 | protein_coding | 5:10368347-10369188 | -20.9792 | 411 | 448 | 70 | 30 | Quinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factor (TAIR:AT5G28350.1). | |
| XLOC_026203 | AT5G43725.2 | Ch5:17559541-17560062 | AT4G04890.1 | protein_coding | 4:2476390-2482447 | -20.967 | 445 | 495 | 91 | 36 | protodermal factor 2 Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. protodermal factor 2 (PDF2);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: epidermal cell differentiation, regulation of transcription, DNA-dependent, cotyledon development; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Lipid-binding START (InterPro:IPR002913), Homeodomain-related (InterPro:IPR012287); Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein (TAIR:AT4G21750.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT4G28480.1 | protein_coding | 4:14073008-14075271 | -20.951 | 352 | 396 | 272 | 223 | DNAJ heat shock family proteinDNAJ heat shock family protein;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 28075 Blast hits to 27586 proteins in 3414 species: Archae - 196; Bacteria - 10500; Metazoa - 4718; Fungi - 2638; Plants - 2903; Viruses - 17; Other Eukaryotes - 7103 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT4G36890.1 | protein_coding | 4:17379173-17382028 | -20.9334 | 406 | 447 | 375 | 337 | Nucleotide-diphospho-sugar transferases superfamily proteinThe IRX14 gene encodes a putative family 43 glycosyl transferase that contributes to xylan biosynthesis. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. irregular xylem 14 (IRX14);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); Nucleotide-diphospho-sugar transferases superfamily protein (TAIR:AT5G67230.1); Has 636 Blast hits to 635 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 399; Fungi - 0; Plants - 221; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT5G60170.2 | protein_coding | 5:24227415-24232873 | -20.9206 | 1401 | 1430 | 61 | 30 | RNA binding (RRM/RBD/RNP motifs) family protein RNA binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, domain 1 (InterPro:IPR003954); RNA binding (RRM/RBD/RNP motifs) family protein (TAIR:AT3G45630.1). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G70470.1 | protein_coding | 1:26559359-26560123 | -20.919 | 632 | 674 | 178 | 138 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G23530.1); Has 64 Blast hits to 64 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 7; Fungi - 10; Plants - 43; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G63260.1 | protein_coding | 3:23372878-23375405 | -20.9061 | 131 | 208 | 84 | 29 | Protein kinase superfamily protein protein kinase, similar to mammal mixed-lineage kinase and Raf protein kinase ATMRK1;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G22750.1); Has 128806 Blast hits to 127373 proteins in 4996 species: Archae - 150; Bacteria - 14757; Metazoa - 48688; Fungi - 11823; Plants - 32734; Viruses - 516; Other Eukaryotes - 20138 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT5G61620.1 | protein_coding | 5:24772326-24773507 | -20.9059 | 225 | 260 | 340 | 306 | myb-like transcription factor family protein myb-like transcription factor family protein;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Zinc finger, CCHC-type (InterPro:IPR001878), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); myb-like transcription factor family protein (TAIR:AT5G47390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT5G22840.1 | protein_coding | 5:7630717-7633380 | -20.8988 | 337 | 386 | 1637 | 1590 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G44850.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G76780.1 | protein_coding | 1:28814434-28822256 | -20.8835 | 232 | 290 | 5459 | 5385 | HSP20-like chaperones superfamily proteinHSP20-like chaperones superfamily protein;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); HSP20-like chaperones superfamily protein (TAIR:AT1G76770.1); Has 310212 Blast hits to 103002 proteins in 3336 species: Archae - 2366; Bacteria - 38795; Metazoa - 125626; Fungi - 30439; Plants - 14934; Viruses - 1639; Other Eukaryotes - 96413 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT4G20300.2 | protein_coding | 4:10955311-10959239 | -20.8641 | 1350 | 1403 | 1411 | 1344 | Protein ofunknown function (DUF1639) Protein ofunknown function (DUF1639);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1639 (InterPro:IPR012438); Protein ofunknown function (DUF1639) (TAIR:AT1G55340.1); Has 598 Blast hits to 583 proteins in 86 species: Archae - 0; Bacteria - 10; Metazoa - 190; Fungi - 42; Plants - 277; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT4G27880.1 | protein_coding | 4:13883167-13885063 | -20.8405 | 2201 | 2235 | 101 | 62 | Protein with RING/U-box and TRAF-like domains Protein with RING/U-box and TRAF-like domains;FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: multicellular organismal development, protein ubiquitination, ubiquitin-dependent protein catabolic process; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Seven-in-absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven-in-absentia protein, sina (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); Protein with RING/U-box and TRAF-like domains (TAIR:AT3G61790.1); Has 1768 Blast hits to 1750 proteins in 698 species: Archae - 0; Bacteria - 0; Metazoa - 1225; Fungi - 9; Plants - 484; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G28150.1 | protein_coding | 3:10471842-10473952 | -20.8273 | 584 | 660 | 156 | 98 | TRICHOME BIREFRINGENCE-LIKE 22 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 22 (TBL22);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 19 (TAIR:AT5G15900.1); Has 1337 Blast hits to 1308 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1337; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G18750.1 | protein_coding | 1:6466667-6469984 | -20.8198 | 3602 | 3632 | 1496 | 1469 | AGAMOUS-like 65 Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL65 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. AGAMOUS-like 65 (AGL65);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: pollen development; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100); AGAMOUS-like 30 (TAIR:AT2G03060.2); Has 6713 Blast hits to 6650 proteins in 771 species: Archae - 0; Bacteria - 0; Metazoa - 853; Fungi - 361; Plants - 5148; Viruses - 0; Other Eukaryotes - 351 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G54430.1 | protein_coding | 3:20146626-20148221 | -20.8189 | 631 | 674 | 542 | 505 | SHI-related sequence 6 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. SHI-related sequence 6 (SRS6);CONTAINS InterPro DOMAIN/s: Lateral Root Primordium type 1, C-terminal (InterPro:IPR006511), Zinc finger, Lateral Root Primordium type 1 (InterPro:IPR006510), Protein ofunknown function DUF702 (InterPro:IPR007818); Lateral root primordium (LRP) protein-related (TAIR:AT5G12330.4); Has 173 Blast hits to 173 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G09735.1 | protein_coding | 3:2986398-2987990 | -20.7928 | 233 | 266 | 308 | 274 | S1FA-like DNA-binding protein S1FA-like DNA-binding protein;FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); S1FA-like DNA-binding protein (TAIR:AT2G37120.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT5G49700.1 | protein_coding | 5:20192159-20193800 | -20.769 | 3375 | 3413 | 528 | 483 | Predicted AT-hook DNA-binding family protein Predicted AT-hook DNA-binding family protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); Predicted AT-hook DNA-binding family protein (TAIR:AT1G14490.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G60630.1 | protein_coding | 3:22410240-22412663 | -20.7629 | 3643 | 3691 | 1241 | 1177 | GRAS family transcription factor Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. HAIRY MERISTEM 2 (HAM2);CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT2G45160.1); Has 2330 Blast hits to 2284 proteins in 297 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 2323; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G03470.1 | protein_coding | 2:1045446-1047744 | -20.7448 | 1354 | 1382 | 1149 | 1121 | ELM2 domain-containing proteinELM2 domain-containing protein;FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949); ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3810 Blast hits to 2751 proteins in 251 species: Archae - 13; Bacteria - 211; Metazoa - 978; Fungi - 430; Plants - 279; Viruses - 101; Other Eukaryotes - 1798 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT1G10570.1 | protein_coding | 1:3487386-3491277 | -20.7436 | 100 | 143 | 87 | 37 | Cysteine proteinases superfamily proteinEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. OVERLY TOLERANT TO SALT 2 (OTS2);CONTAINS InterPro DOMAIN/s: Peptidase C48, SUMO/Sentrin/Ubl1 (InterPro:IPR003653); UB-like protease 1D (TAIR:AT1G60220.1); Has 1265 Blast hits to 1250 proteins in 204 species: Archae - 0; Bacteria - 0; Metazoa - 616; Fungi - 251; Plants - 239; Viruses - 3; Other Eukaryotes - 156 (source: NCBI BLink). | |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT5G15080.1 | protein_coding | 5:4886029-4888817 | -20.7414 | 1070 | 1107 | 436 | 401 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G01300.1); Has 114476 Blast hits to 113108 proteins in 3886 species: Archae - 103; Bacteria - 13473; Metazoa - 41986; Fungi - 9512; Plants - 32487; Viruses - 375; Other Eukaryotes - 16540 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G52110.1 | protein_coding | 3:19323750-19325895 | -20.7354 | 46 | 103 | 1071 | 1010 | unknown protein; Has 191 Blast hits to 174 proteins in 54 species: Archae - 0; Bacteria - 7; Metazoa - 45; Fungi - 7; Plants - 40; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G42790.1 | protein_coding | 5:17159044-17161156 | -20.7199 | 237 | 280 | 857 | 811 | proteasome alpha subunit F1encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome). Negatively regulates thiol biosynthesis and arsenic tolerance. proteasome alpha subunit F1 (PAF1);FUNCTIONS IN: peptidase activity, endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: response to arsenic, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex, proteasome complex, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Proteasome, alpha-subunit, conserved site (InterPro:IPR000426), Proteasome, subunit alpha/beta (InterPro:IPR001353); 20S proteasome alpha subunit F2 (TAIR:AT1G47250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G18950.1 | protein_coding | 1:6546177-6552108 | -20.7195 | 298 | 349 | 399 | 359 | DDT domain superfamilyDDT domain superfamily;CONTAINS InterPro DOMAIN/s: DDT domain (InterPro:IPR004022); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G25580.1); Has 20293 Blast hits to 13585 proteins in 823 species: Archae - 41; Bacteria - 1919; Metazoa - 8043; Fungi - 2539; Plants - 1031; Viruses - 220; Other Eukaryotes - 6500 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G19930.1 | protein_coding | 3:6934568-6937197 | -20.6516 | 407 | 448 | 143 | 106 | sugar transporter 4Encodes a sucrose hydrogen symporter that is induced by wounding. sugar transporter 4 (STP4);FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, monosaccharide transmembrane transporter activity, sucrose:hydrogen symporter activity; INVOLVED IN: defense response to fungus, response to wounding, sucrose transport; LOCATED IN: plasma membrane, integral to plasma membrane, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily (InterPro:IPR020846), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Major facilitator superfamily protein (TAIR:AT3G19940.1); Has 29502 Blast hits to 28992 proteins in 2095 species: Archae - 505; Bacteria - 13835; Metazoa - 4159; Fungi - 7125; Plants - 2571; Viruses - 2; Other Eukaryotes - 1305 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT3G55760.1 | protein_coding | 3:20700314-20703130 | -20.6448 | 53 | 94 | 1564 | 1512 | unknown protein; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G42430.2); Has 176 Blast hits to 125 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 19; Fungi - 9; Plants - 81; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G11110.1 | protein_coding | 4:6771605-6777225 | -20.6304 | 971 | 993 | 136 | 114 | SPA1-related 2 Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. SPA1-related 2 (SPA2);FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), Protein kinase, catalytic domain (InterPro:IPR000719), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); SPA (suppressor of phyA-105) protein family (TAIR:AT2G46340.1); Has 34047 Blast hits to 20982 proteins in 883 species: Archae - 38; Bacteria - 5461; Metazoa - 12841; Fungi - 7307; Plants - 4015; Viruses - 10; Other Eukaryotes - 4375 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT1G06620.1 | protein_coding | 1:2025544-2027413 | -20.5928 | 342 | 391 | 292 | 239 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;CONTAINS InterPro DOMAIN/s: Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT3G61400.1); Has 8339 Blast hits to 8299 proteins in 1003 species: Archae - 0; Bacteria - 1128; Metazoa - 122; Fungi - 867; Plants - 4923; Viruses - 0; Other Eukaryotes - 1299 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.4 | Ch3:10392571-10398221 | AT3G01400.1 | protein_coding | 3:151725-153263 | -20.5911 | 443 | 483 | 328 | 293 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT5G58680.1); Has 6122 Blast hits to 3580 proteins in 271 species: Archae - 0; Bacteria - 2; Metazoa - 1843; Fungi - 536; Plants - 3048; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G48370.1 | protein_coding | 1:17874436-17877462 | -20.5717 | 55 | 96 | 209 | 171 | YELLOW STRIPE like 8 Arabidopsis thaliana metal-nicotianamine transporter YSL4 YELLOW STRIPE like 8 (YSL8);FUNCTIONS IN: oligopeptide transporter activity; INVOLVED IN: oligopeptide transport, transmembrane transport; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Oligopeptide transporter OPT superfamily (InterPro:IPR004813); YELLOW STRIPE like 5 (TAIR:AT3G17650.1); Has 1797 Blast hits to 1745 proteins in 565 species: Archae - 19; Bacteria - 910; Metazoa - 0; Fungi - 269; Plants - 459; Viruses - 1; Other Eukaryotes - 139 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G11560.1 | protein_coding | 4:6999869-7003493 | -20.5712 | 42 | 89 | 339 | 299 | bromo-adjacent homology (BAH) domain-containing protein bromo-adjacent homology (BAH) domain-containing protein;FUNCTIONS IN: DNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Bromo adjacent homology (BAH) domain (InterPro:IPR001025), Transcription elongation factor S-II, central domain (InterPro:IPR003618); Bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT2G25120.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT2G01190.1 | protein_coding | 2:114926-117750 | -20.571 | 126 | 183 | 401 | 350 | Octicosapeptide/Phox/Bem1p family proteinOcticosapeptide/Phox/Bem1p family protein; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); Octicosapeptide/Phox/Bem1p family protein (TAIR:AT3G18230.1); Has 5347 Blast hits to 4615 proteins in 344 species: Archae - 4; Bacteria - 100; Metazoa - 2308; Fungi - 1293; Plants - 931; Viruses - 29; Other Eukaryotes - 682 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G01883.1 | protein_coding | 4:813048-815170 | -20.5698 | 623 | 681 | 269 | 205 | Polyketide cyclase / dehydrase and lipid transport protein Polyketide cyclase / dehydrase and lipid transport protein; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Polyketide cyclase/dehydrase and lipid transport superfamily protein (TAIR:AT1G02475.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G25190.1 | protein_coding | 2:10733921-10735795 | -20.556 | 967 | 1002 | 897 | 862 | PPPDE putative thiol peptidase family protein PPPDE putative thiol peptidase family protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G31980.1); Has 848 Blast hits to 846 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 230; Fungi - 77; Plants - 355; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G72700.1 | protein_coding | 1:27365772-27371784 | -20.5073 | 48 | 87 | 48 | 5 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family proteinATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, ATP biosynthetic process, phospholipid transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, phospholipid-translocating, flippase (InterPro:IPR006539), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303); ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G17500.1); Has 13795 Blast hits to 12389 proteins in 1682 species: Archae - 129; Bacteria - 4365; Metazoa - 3646; Fungi - 2158; Plants - 963; Viruses - 3; Other Eukaryotes - 2531 (source: NCBI BLink). | |
| XLOC_004105 | AT1G09927.1 | Ch1:30041286-30041963 | AT1G26330.2 | protein_coding | 1:9107519-9113747 | -20.5068 | 525 | 567 | 46 | 11 | DNA binding DNA binding;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: nucleus; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), FY-rich, C-terminal (InterPro:IPR003889), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT3G49390.1 | protein_coding | 3:18314006-18318041 | -20.4974 | 98 | 141 | 1398 | 1355 | CTC-interacting domain 10 RNA-binding protein, putative, RNA-binding protein RBP37, Arabidopsis thaliana, PIR:T04196.Member of a family of PAB2 domain containing proteins. CTC-interacting domain 10 (CID10);FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ataxin-2, C-terminal (InterPro:IPR009818); CTC-interacting domain 11 (TAIR:AT1G32790.1); Has 1677 Blast hits to 1486 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 724; Fungi - 214; Plants - 535; Viruses - 0; Other Eukaryotes - 204 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT4G22290.1 | protein_coding | 4:11782840-11785937 | -20.4826 | 14 | 34 | 1534 | 1514 | Ubiquitin-specific protease family C19-related proteinUbiquitin-specific protease family C19-related protein; Ubiquitin-specific protease family C19-related protein (TAIR:AT1G78880.1); Has 147 Blast hits to 147 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 137; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G24360.1 | protein_coding | 2:10364451-10366902 | -20.4779 | 232 | 266 | 1654 | 1617 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G31170.3); Has 132546 Blast hits to 130322 proteins in 4939 species: Archae - 142; Bacteria - 14767; Metazoa - 50018; Fungi - 12226; Plants - 34060; Viruses - 645; Other Eukaryotes - 20688 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT4G16670.1 | protein_coding | 4:9385119-9387754 | -20.4381 | 317 | 365 | 189 | 150 | Plant protein ofunknown function (DUF828) with plant pleckstrin homology-like regionCONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein ofunknown function DUF828 (InterPro:IPR008546), Pleckstrin homology (InterPro:IPR001849); Plant protein ofunknown function (DUF828) with plant pleckstrin homology-like region (TAIR:AT4G17350.1); Has 215 Blast hits to 188 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 208; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G19090.1 | protein_coding | 5:6387341-6390179 | -20.4166 | 599 | 633 | 152 | 112 | Heavy metal transport/detoxification superfamily protein Heavy metal transport/detoxification superfamily protein ;FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Heavy metal transport/detoxification superfamily protein (TAIR:AT3G06130.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G34930.1 | protein_coding | 5:13233357-13235763 | -20.411 | 2687 | 2754 | 109 | 55 | arogenate dehydrogenase arogenate dehydrogenase;FUNCTIONS IN: binding, prephenate dehydrogenase (NADP+) activity, catalytic activity; INVOLVED IN: tyrosine biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Prephenate dehydrogenase (InterPro:IPR003099), NAD(P)-binding domain (InterPro:IPR016040); prephenate dehydrogenase family protein (TAIR:AT1G15710.1); Has 1942 Blast hits to 1528 proteins in 619 species: Archae - 162; Bacteria - 1128; Metazoa - 21; Fungi - 62; Plants - 205; Viruses - 0; Other Eukaryotes - 364 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT2G04880.1 | protein_coding | 2:1717833-1720526 | -20.4026 | 0 | 45 | 1583 | 1542 | zinc-dependent activator protein-1 Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.zinc-dependent activator protein-1 (ZAP1);CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657); WRKY family transcription factor family protein (TAIR:AT4G26640.2); Has 5944 Blast hits to 3097 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 5898; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.4 | Ch1:22294362-22297374 | AT2G22540.1 | protein_coding | 2:9579647-9583901 | -20.4025 | 1412 | 1462 | 424 | 375 | K-box region and MADS-box transcription factor family proteinEncodes a nuclear protein that acts as a floral repressor and thatFUNCTIONS within the thermosensory pathway. SVP represses FT expression via direct binding to the vCArG III motif in the FT promoter. SHORT VEGETATIVE PHASE (SVP);CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100), Transcription factor, K-box (InterPro:IPR002487); AGAMOUS-like 24 (TAIR:AT4G24540.1); Has 7469 Blast hits to 7448 proteins in 905 species: Archae - 3; Bacteria - 14; Metazoa - 824; Fungi - 324; Plants - 6168; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.3 | Ch1:22294362-22297374 | AT2G22540.1 | protein_coding | 2:9579647-9583901 | -20.4025 | 989 | 1039 | 424 | 375 | K-box region and MADS-box transcription factor family proteinEncodes a nuclear protein that acts as a floral repressor and thatFUNCTIONS within the thermosensory pathway. SVP represses FT expression via direct binding to the vCArG III motif in the FT promoter. SHORT VEGETATIVE PHASE (SVP);CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100), Transcription factor, K-box (InterPro:IPR002487); AGAMOUS-like 24 (TAIR:AT4G24540.1); Has 7469 Blast hits to 7448 proteins in 905 species: Archae - 3; Bacteria - 14; Metazoa - 824; Fungi - 324; Plants - 6168; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G49215.1 | protein_coding | 5:19953459-19956145 | -20.3396 | 973 | 996 | 86 | 62 | Pectin lyase-like superfamily protein Pectin lyase-like superfamily protein;FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); Pectin lyase-like superfamily protein (TAIR:AT3G06770.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013289 | AT3G01095.1 | Ch3:388198-388460 | AT1G10880.1 | protein_coding | 1:3625623-3627082 | -20.3393 | 148 | 217 | 1872 | 1803 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein; INVOLVED IN: response to salt stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT5G16170.1); Has 696 Blast hits to 692 proteins in 56 species: Archae - 2; Bacteria - 7; Metazoa - 8; Fungi - 7; Plants - 576; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G26030.1 | protein_coding | 3:9516953-9519563 | -20.3295 | 602 | 641 | 67 | 35 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta protein phosphatase 2A regulatory subunit isoform B' delta serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta (ATB' DELTA);FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: nucleolus, protein phosphatase type 2A complex, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT3G26020.2); Has 1183 Blast hits to 1155 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 568; Fungi - 166; Plants - 302; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_004089 | AT1G79529.1 | Ch1:29915662-29916410 | AT1G12900.1 | protein_coding | 1:4392438-4394454 | -20.3102 | 514 | 547 | 1269 | 1240 | glyceraldehyde 3-phosphate dehydrogenase A subunit 2 glyceraldehyde 3-phosphate dehydrogenase A subunit 2 (GAPA-2);FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase activity; INVOLVED IN: oxidation reduction, glycolysis, glucose metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase subfamily (InterPro:IPR000173), Glyceraldehyde 3-phosphate dehydrogenase family (InterPro:IPR020831), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), Glyceraldehyde 3-phosphate dehydrogenase, active site (InterPro:IPR020830), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (InterPro:IPR020829), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain, subgroup (InterPro:IPR020832), Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (InterPro:IPR020828); glyceraldehyde 3-phosphate dehydrogenase A subunit (TAIR:AT3G26650.1); Has 24704 Blast hits to 24695 proteins in 6149 species: Archae - 47; Bacteria - 10700; Metazoa - 2230; Fungi - 2778; Plants - 3753; Viruses - 0; Other Eukaryotes - 5196 (source: NCBI BLink). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT5G42146.1 | protein_coding | 5:16844336-16845015 | -20.2946 | 353 | 401 | 68 | 11 | unknown protein; Has 98 Blast hits to 98 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G00950.1 | protein_coding | 4:405623-407142 | -20.2841 | 1366 | 1396 | 726 | 695 | Protein ofunknown function (DUF688) maternal effect embryo arrest 47 (MEE47);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF688 (InterPro:IPR007789); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_017691 | AT3G04775.1 | Ch3:8979070-8979756 | AT3G05130.1 | protein_coding | 3:1433128-1435526 | -20.2237 | 85 | 112 | 699 | 657 | Prefoldin chaperone subunit family protein (TAIR:AT5G27330.1); Has 171032 Blast hits to 82560 proteins in 3364 species: Archae - 2835; Bacteria - 33550; Metazoa - 71995; Fungi - 13365; Plants - 9598; Viruses - 592; Other Eukaryotes - 39097 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT1G53625.1 | protein_coding | 1:20014379-20015038 | -20.2132 | 1322 | 1370 | 390 | 343 | unknown protein; Has 29996 Blast hits to 6987 proteins in 655 species: Archae - 23; Bacteria - 6686; Metazoa - 10521; Fungi - 1178; Plants - 7439; Viruses - 681; Other Eukaryotes - 3468 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G03140.1 | protein_coding | 1:754261-756303 | -20.2056 | 51 | 94 | 669 | 607 | splicing factor Prp18 family protein splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosomal complex; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G54590.1); Has 624 Blast hits to 613 proteins in 206 species: Archae - 0; Bacteria - 5; Metazoa - 235; Fungi - 175; Plants - 58; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT4G33690.1 | protein_coding | 4:16174756-16176328 | -20.2048 | 353 | 382 | 850 | 811 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 543 Blast hits to 512 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 281; Fungi - 54; Plants - 72; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G63140.1 | protein_coding | 3:23326867-23328789 | -20.1974 | 405 | 451 | 262 | 218 | chloroplast stem-loop binding protein of 41 kDaEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. chloroplast stem-loop binding protein of 41 kDa (CSP41A);FUNCTIONS IN: mRNA binding, poly(U) RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040); chloroplast RNA binding (TAIR:AT1G09340.1); Has 1047 Blast hits to 1047 proteins in 372 species: Archae - 70; Bacteria - 649; Metazoa - 6; Fungi - 5; Plants - 106; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G21450.3 | protein_coding | 4:11425933-11428435 | -20.1655 | 973 | 995 | 334 | 312 | PapD-like superfamily protein PapD-like superfamily protein;FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_processunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535); PapD-like superfamily protein (TAIR:AT4G05060.1). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G31980.1 | protein_coding | 4:15464642-15469204 | -20.1654 | 48 | 92 | 560 | 509 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF247, plant (InterPro:IPR004158), Protein ofunknown function DUF862, eukaryotic (InterPro:IPR008580); Plant protein ofunknown function (DUF247) (TAIR:AT5G11290.1); Has 1967 Blast hits to 1844 proteins in 183 species: Archae - 0; Bacteria - 6; Metazoa - 223; Fungi - 83; Plants - 1477; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G20920.1 | protein_coding | 5:7094649-7097145 | -20.1641 | 254 | 283 | 418 | 391 | eukaryotic translation initiation factor 2 beta subunit protein synthesis initiation factor eIF2 beta eukaryotic translation initiation factor 2 beta subunit (EIF2 BETA);FUNCTIONS IN: protein binding, translation initiation factor activity; INVOLVED IN: translational initiation, embryo development ending in seed dormancy; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Translation initiation factor IF2/IF5, N-terminal (InterPro:IPR016189), Translation initiation factor IF2/IF5, zinc-binding (InterPro:IPR016190), Translation initiation factor IF2/IF5 (InterPro:IPR002735); Translation initiation factor IF2/IF5 (TAIR:AT3G07920.1); Has 1325 Blast hits to 1322 proteins in 359 species: Archae - 272; Bacteria - 0; Metazoa - 350; Fungi - 278; Plants - 186; Viruses - 4; Other Eukaryotes - 235 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G26600.1 | protein_coding | 2:11316346-11318520 | -20.1466 | 971 | 996 | 376 | 346 | Glycosyl hydrolase superfamily proteinGlycosyl hydrolase superfamily protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); Glycosyl hydrolase superfamily protein (TAIR:AT3G15800.1); Has 2133 Blast hits to 2119 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 2120; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_002446 | AT1G07737.1 | Ch1:19052139-19052358 | AT3G58050.1 | protein_coding | 3:21492145-21497317 | -20.1256 | 184 | 218 | 1635 | 1600 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G41960.1); Has 13384 Blast hits to 8116 proteins in 546 species: Archae - 41; Bacteria - 766; Metazoa - 5596; Fungi - 1431; Plants - 589; Viruses - 46; Other Eukaryotes - 4915 (source: NCBI BLink). | |
| XLOC_008744 | AT2G14878.1 | Ch2:6392167-6393042 | AT2G44180.1 | protein_coding | 2:18269211-18271941 | -20.1111 | 331 | 362 | 1035 | 1005 | methionine aminopeptidase 2A Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. methionine aminopeptidase 2A (MAP2A);FUNCTIONS IN: metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: N-terminal protein amino acid modification; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24A, methionine aminopeptidase, subfamily 2 (InterPro:IPR002468), Peptidase M24A, methionine aminopeptidase, subfamily 2, binding site (InterPro:IPR018349), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); methionine aminopeptidase 2B (TAIR:AT3G59990.4); Has 6503 Blast hits to 6494 proteins in 2220 species: Archae - 231; Bacteria - 4255; Metazoa - 425; Fungi - 336; Plants - 181; Viruses - 0; Other Eukaryotes - 1075 (source: NCBI BLink). | |
| XLOC_011026 | AT2G07042.1 | Ch2:2919953-2922249 | AT5G67190.1 | protein_coding | 5:26808876-26810116 | -20.1072 | 419 | 457 | 473 | 428 | DREB and EAR motif protein 2 Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The proteinCONTAINS one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. DREB and EAR motif protein 2 (DEAR2);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: sepal, male gametophyte, carpel; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); cooperatively regulated by ethylene and jasmonate 1 (TAIR:AT3G50260.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G64020.1 | protein_coding | 5:25620246-25622646 | -20.096 | 959 | 993 | 402 | 371 | TRICHOME BIREFRINGENCE-LIKE 14 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 14 (TBL14); INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 15 (TAIR:AT2G37720.1); Has 1334 Blast hits to 1314 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1334; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT3G42170.1 | protein_coding | 3:14320943-14324069 | -20.0934 | 1006 | 1046 | 112 | 67 | BED zinc finger ;hAT family dimerisation domain transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. BED zinc finger ;hAT family dimerisation domain;CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656); BED zinc finger ;hAT family dimerisation domain (TAIR:AT1G18560.1); Has 1233 Blast hits to 1128 proteins in 97 species: Archae - 0; Bacteria - 4; Metazoa - 232; Fungi - 219; Plants - 755; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). | |
| XLOC_022116 | AT4G06701.5 | Ch4:3939266-3940749 | AT4G34480.1 | protein_coding | 4:16480887-16484231 | -20.078 | 61 | 94 | 794 | 761 | O-Glycosyl hydrolases family 17 protein O-Glycosyl hydrolases family 17 protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); O-Glycosyl hydrolases family 17 protein (TAIR:AT2G16230.1); Has 576 Blast hits to 566 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 570; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G44740.1 | protein_coding | 2:18441828-18443405 | -20.0654 | 2940 | 2973 | 619 | 590 | cyclin p4;1 cyclin p4;1 (CYCP4;1);CONTAINS InterPro DOMAIN/s: Negative regulatory factor PREG (InterPro:IPR012389), Cyclin-like (InterPro:IPR011028), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); CYCLIN P4;2 (TAIR:AT5G61650.1); Has 1474 Blast hits to 1416 proteins in 218 species: Archae - 0; Bacteria - 18; Metazoa - 247; Fungi - 710; Plants - 236; Viruses - 0; Other Eukaryotes - 263 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G43590.1 | protein_coding | 3:15509527-15512574 | -20.0594 | 232 | 257 | 1387 | 1362 | zinc knuckle (CCHC-type) family protein zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); Zinc knuckle (CCHC-type) family protein (TAIR:AT3G43490.1); Has 22952 Blast hits to 17782 proteins in 462 species: Archae - 2; Bacteria - 65; Metazoa - 3265; Fungi - 1419; Plants - 1360; Viruses - 15440; Other Eukaryotes - 1401 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G11110.1 | protein_coding | 4:6771605-6777225 | -20.0575 | 146 | 183 | 138 | 102 | SPA1-related 2 Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. SPA1-related 2 (SPA2);FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), Protein kinase, catalytic domain (InterPro:IPR000719), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); SPA (suppressor of phyA-105) protein family (TAIR:AT2G46340.1); Has 34047 Blast hits to 20982 proteins in 883 species: Archae - 38; Bacteria - 5461; Metazoa - 12841; Fungi - 7307; Plants - 4015; Viruses - 10; Other Eukaryotes - 4375 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.1 | Ch1:19496461-19497686 | AT3G19990.1 | protein_coding | 3:6965595-6967321 | -20.0423 | 63 | 89 | 1137 | 1102 | unknown protein; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 118 Blast hits to 118 proteins in 41 species: Archae - 0; Bacteria - 42; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G80660.1 | protein_coding | 1:30315964-30320197 | -20.0241 | 153 | 177 | 2643 | 2613 | H(+)-ATPase 9 H(+)-ATPase 9 (HA9);FUNCTIONS IN: hydrogen-exporting ATPase activity, phosphorylative mechanism; INVOLVED IN: proton transport; LOCATED IN: plasma membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, H+ transporting proton pump (InterPro:IPR000695), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type, plasma-membrane proton-efflux (InterPro:IPR006534), ATPase, P-type phosphorylation site (InterPro:IPR018303); H(+)-ATPase 8 (TAIR:AT3G42640.1); Has 36928 Blast hits to 32596 proteins in 3160 species: Archae - 699; Bacteria - 23609; Metazoa - 3886; Fungi - 2415; Plants - 1876; Viruses - 3; Other Eukaryotes - 4440 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G10180.1 | protein_coding | 1:3338185-3341628 | -20.0163 | 230 | 265 | 2275 | 2237 | exocyst complex component 84B (TAIR:AT5G49830.1); Has 132 Blast hits to 132 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_028934 | AT5G24735.1 | Ch5:8468331-8469262 | AT3G58530.1 | protein_coding | 3:21645547-21648368 | -19.9947 | 498 | 535 | 285 | 250 | RNI-like superfamily protein RNI-like superfamily protein;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); RNI-like superfamily protein (TAIR:AT5G23340.1); Has 9313 Blast hits to 3891 proteins in 246 species: Archae - 0; Bacteria - 470; Metazoa - 3686; Fungi - 1044; Plants - 3046; Viruses - 9; Other Eukaryotes - 1058 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.4 | Ch3:10392571-10398221 | AT1G78880.1 | protein_coding | 1:29652633-29655949 | -19.9818 | 840 | 897 | 251 | 207 | Ubiquitin-specific protease family C19-related proteinUbiquitin-specific protease family C19-related protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: guard cell, cultured cell; Ubiquitin-specific protease family C19-related protein (TAIR:AT1G16860.1); Has 277 Blast hits to 242 proteins in 57 species: Archae - 0; Bacteria - 14; Metazoa - 37; Fungi - 44; Plants - 151; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G59990.1 | protein_coding | 1:22090226-22093385 | -19.9751 | 44 | 70 | 1133 | 1105 | DEA(D/H)-box RNA helicase family protein DEA(D/H)-box RNA helicase family protein;FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT2G40700.1); Has 57869 Blast hits to 34290 proteins in 2955 species: Archae - 517; Bacteria - 30307; Metazoa - 8550; Fungi - 6961; Plants - 3872; Viruses - 6; Other Eukaryotes - 7656 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G29200.1 | protein_coding | 3:11163839-11166458 | -19.9701 | 1965 | 2006 | 1068 | 1010 | chorismate mutase 1L-ascorbate peroxidase chorismate mutase 1 (CM1);CONTAINS InterPro DOMAIN/s: Chorismate mutase, type II (InterPro:IPR020822), Chorismate mutase, AroQ class, eukaryotic type (InterPro:IPR008238); chorismate mutase 3 (TAIR:AT1G69370.1); Has 278 Blast hits to 278 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 142; Plants - 118; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G24330.1 | protein_coding | 1:8631206-8635055 | -19.9668 | 3668 | 3707 | 1939 | 1890 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT1G67530.2); Has 3064 Blast hits to 2955 proteins in 242 species: Archae - 0; Bacteria - 60; Metazoa - 394; Fungi - 149; Plants - 2167; Viruses - 3; Other Eukaryotes - 291 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G29000.1 | protein_coding | 4:14293513-14297066 | -19.9537 | 145 | 170 | 159 | 134 | Tesmin/TSO1-like CXC domain-containing proteinTesmin/TSO1-like CXC domain-containing protein;CONTAINS InterPro DOMAIN/s: Tesmin/TSO1-like, CXC (InterPro:IPR005172); Tesmin/TSO1-like CXC domain-containing protein (TAIR:AT2G20110.1); Has 1016 Blast hits to 666 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 285; Fungi - 4; Plants - 322; Viruses - 0; Other Eukaryotes - 405 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G53480.1 | protein_coding | 5:21713245-21717878 | -19.9483 | 2779 | 2805 | 45 | 20 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, chloroplast, nuclear pore, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT3G08947.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_008343 | AT2G04405.1 | Ch2:849921-850780 | AT3G19650.1 | protein_coding | 3:6823316-6825350 | -19.9398 | 322 | 351 | 732 | 702 | cyclin-relatedcyclin-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 5668 Blast hits to 3895 proteins in 309 species: Archae - 0; Bacteria - 250; Metazoa - 3167; Fungi - 631; Plants - 477; Viruses - 7; Other Eukaryotes - 1136 (source: NCBI BLink). | |
| XLOC_010840 | AT2G04285.1 | Ch2:763851-764640 | AT5G08470.1 | protein_coding | 5:2735911-2743065 | -19.9353 | 123 | 141 | 137 | 119 | peroxisome 1 an AAA-ATPase that is the probable Arabidopsis orthologue of one of the AAA-ATPases involved in peroxisome biogenesis in yeasts and mammals. peroxisome 1 (PEX1);FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, binding, nucleotide binding, ATP binding; INVOLVED IN: protein import into peroxisome matrix, fatty acid beta-oxidation, response to stress; LOCATED IN: peroxisome; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), Aspartate decarboxylase-like fold (InterPro:IPR009010), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peroxisome biogenesis factor 1, N-terminal (InterPro:IPR015342); ATPase, AAA-type, CDC48 protein (TAIR:AT3G53230.1); Has 45022 Blast hits to 26157 proteins in 3042 species: Archae - 1897; Bacteria - 15808; Metazoa - 7500; Fungi - 5597; Plants - 4311; Viruses - 29; Other Eukaryotes - 9880 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G15351.1 | protein_coding | 3:5175948-5177721 | -19.9228 | 651 | 705 | 195 | 159 | unknown protein; Has 50 Blast hits to 50 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT3G07220.1 | protein_coding | 3:2297886-2299572 | -19.9117 | 116 | 153 | 707 | 673 | SMAD/FHA domain-containing protein SMAD/FHA domain-containing protein ;CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (FHA) domain (InterPro:IPR000253); SMAD/FHA domain-containing protein (TAIR:AT3G07260.1); Has 459 Blast hits to 458 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 202; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G64905.1 | protein_coding | 5:25939562-25940080 | -19.8891 | 42 | 81 | 271 | 237 | elicitor peptide 3 precursor elicitor peptide 3 precursor (PROPEP3); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G20650.1 | protein_coding | 3:7220733-7224090 | -19.8656 | 783 | 819 | 1225 | 1195 | mRNA capping enzyme family protein mRNA capping enzyme family protein;FUNCTIONS IN: catalytic activity; INVOLVED IN: mRNA capping; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: mRNA (guanine-N(7))-methyltransferase (InterPro:IPR016899), mRNA capping enzyme, large subunit (InterPro:IPR004971); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G52210.1); Has 916 Blast hits to 903 proteins in 291 species: Archae - 0; Bacteria - 22; Metazoa - 149; Fungi - 179; Plants - 106; Viruses - 144; Other Eukaryotes - 316 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G12450.1 | protein_coding | 4:7385695-7386931 | -19.8608 | 80 | 114 | 829 | 795 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G22560.1); Has 380 Blast hits to 380 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 4; Plants - 374; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT2G43210.1 | protein_coding | 2:17960648-17963769 | -19.8449 | 256 | 275 | 1009 | 990 | Ubiquitin-like superfamily protein Ubiquitin-like superfamily protein;CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1416 Blast hits to 1005 proteins in 245 species: Archae - 0; Bacteria - 142; Metazoa - 386; Fungi - 259; Plants - 165; Viruses - 17; Other Eukaryotes - 447 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G61240.1 | protein_coding | 3:22666147-22669757 | -19.8427 | 670 | 699 | 137 | 102 | DEA(D/H)-box RNA helicase family protein DEA(D/H)-box RNA helicase family protein;FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); DEA(D/H)-box RNA helicase family protein (TAIR:AT2G45810.1); Has 53038 Blast hits to 46572 proteins in 3157 species: Archae - 705; Bacteria - 22269; Metazoa - 8742; Fungi - 5746; Plants - 2904; Viruses - 84; Other Eukaryotes - 12588 (source: NCBI BLink). | |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT2G19790.1 | protein_coding | 2:8527175-8528685 | -19.8426 | 40 | 86 | 68 | 27 | SNARE-like superfamily proteinSNARE-like superfamily protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, transport, protein transport; LOCATED IN: clathrin vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Adaptor protein complex, sigma subunit (InterPro:IPR016635), Longin-like (InterPro:IPR011012); SNARE-like superfamily protein (TAIR:AT1G47830.1); Has 1921 Blast hits to 1920 proteins in 249 species: Archae - 0; Bacteria - 0; Metazoa - 856; Fungi - 405; Plants - 316; Viruses - 0; Other Eukaryotes - 344 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G12250.1 | protein_coding | 5:3960938-3963624 | -19.8404 | 1354 | 1402 | 1474 | 1426 | beta-6 tubulin Encodes a beta-tubulin. Expression of TUB6 has been shown to decrease in response to cold treatment. beta-6 tubulin (TUB6);FUNCTIONS IN: structural constituent of cytoskeleton; INVOLVED IN: microtubule-based process, response to salt stress, response to cold; LOCATED IN: microtubule cytoskeleton, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Beta tubulin (InterPro:IPR002453), Tubulin (InterPro:IPR000217), Tubulin/FtsZ, GTPase domain (InterPro:IPR003008), Tubulin/FtsZ, N-terminal (InterPro:IPR019746), Tubulin/FtsZ, C-terminal (InterPro:IPR008280), Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin, conserved site (InterPro:IPR017975), Tubulin/FtsZ, 2-layer sandwich domain (InterPro:IPR018316); tubulin beta chain 3 (TAIR:AT5G62700.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT5G22060.1 | protein_coding | 5:7303506-7305870 | -19.8399 | 337 | 364 | 395 | 368 | DNAJ homologue 2 Co-chaperonin similar to E. coli DnaJ DNAJ homologue 2 (J2);FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to salt stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, cysteine-rich domain (InterPro:IPR001305), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); DNAJ homologue 3 (TAIR:AT3G44110.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G28740.1 | protein_coding | 3:10788698-10790553 | -19.8295 | 2600 | 2629 | 89 | 55 | Cytochrome P450 superfamily proteinEncodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. CYP81D1;FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: response to cyclopentenone, defense response to insect; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 81, subfamily D, polypeptide 7 (TAIR:AT2G23190.1); Has 36095 Blast hits to 35936 proteins in 1857 species: Archae - 61; Bacteria - 5661; Metazoa - 11857; Fungi - 7468; Plants - 9503; Viruses - 3; Other Eukaryotes - 1542 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G45830.1 | protein_coding | 3:16840652-16845580 | -19.8208 | 666 | 712 | 2244 | 2195 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G02290.1); Has 499 Blast hits to 438 proteins in 100 species: Archae - 0; Bacteria - 7; Metazoa - 236; Fungi - 15; Plants - 108; Viruses - 2; Other Eukaryotes - 131 (source: NCBI BLink). | |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT1G73200.1 | protein_coding | 1:27523043-27526818 | -19.8189 | 598 | 666 | 2424 | 2364 | Putative integral membrane protein conserved region (DUF2404) Putative integral membrane protein conserved region (DUF2404);FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2404, transmembrane (InterPro:IPR019411), Pleckstrin homology (InterPro:IPR001849); Putative integral membrane protein conserved region (DUF2404) (TAIR:AT1G17820.1); Has 453 Blast hits to 336 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 247; Plants - 53; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G21900.1 | protein_coding | 5:7238174-7240535 | -19.7983 | 48 | 94 | 376 | 329 | RNI-like superfamily protein RNI-like superfamily protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G06040.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G08500.1 | protein_coding | 4:5403671-5407320 | -19.7906 | 2780 | 2805 | 76 | 38 | MAPK/ERK kinase kinase 1Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. MAPK/ERK kinase kinase 1 (MEKK1);FUNCTIONS IN: protein binding, kinase binding, DNA binding, MAP kinase kinase kinase activity, kinase activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); mitogen-activated protein kinase kinase kinase 9 (TAIR:AT4G08480.1); Has 132336 Blast hits to 130259 proteins in 4567 species: Archae - 142; Bacteria - 14700; Metazoa - 49430; Fungi - 12971; Plants - 32949; Viruses - 685; Other Eukaryotes - 21459 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G30260.1 | protein_coding | 2:12905345-12907665 | -19.7828 | 236 | 281 | 433 | 385 | U2 small nuclear ribonucleoprotein B Encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is stillunknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. U2 small nuclear ribonucleoprotein B (U2B'');FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: cis assembly of pre-catalytic spliceosome; LOCATED IN: nucleoplasm, Cajal body, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G06960.1); Has 1885 Blast hits to 1858 proteins in 260 species: Archae - 0; Bacteria - 2; Metazoa - 926; Fungi - 414; Plants - 327; Viruses - 1; Other Eukaryotes - 215 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G34790.1 | protein_coding | 1:12763902-12765686 | -19.7746 | 1947 | 2007 | 300 | 248 | C2H2 and C2HC zinc fingers superfamily protein Encodes a zinc finger protein; involved in photomorphogenesis, flavonoid biosynthesis, flower and seed development.transparent testa 1 (TT1);CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); WIP domain protein 5 (TAIR:AT1G51220.1); Has 15538 Blast hits to 10276 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 14379; Fungi - 110; Plants - 685; Viruses - 0; Other Eukaryotes - 364 (source: NCBI BLink). | |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT5G64390.3 | protein_coding | 5:25743344-25748575 | -19.7487 | 565 | 624 | 491 | 432 | RNA-binding KH domain-containing proteinEncodes a K homology (KH) domain-containing, putative RNA binding protein that interacts with HUA1, a CCCH zinc finger RNA binding protein in the nucleus. HEN4 acts redundantly with HUA1 and HUA2 in the specification of floral organ identity in the third whorl. HUA ENHANCER 4 (HEN4);CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); RNA-binding KH domain-containing protein (TAIR:AT5G09560.1). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G69526.2 | protein_coding | 1:26131294-26133313 | -19.7475 | 264 | 288 | 356 | 330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT1G69523.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G56120.1 | protein_coding | 3:20823146-20826543 | -19.7426 | 593 | 646 | 63 | 17 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function Met10 (InterPro:IPR003402); Met-10+ like family protein (TAIR:AT4G27340.1); Has 1391 Blast hits to 1232 proteins in 427 species: Archae - 416; Bacteria - 202; Metazoa - 266; Fungi - 150; Plants - 114; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G63500.2 | protein_coding | 3:23446230-23450284 | -19.7351 | 958 | 980 | 3486 | 3459 | Protein ofunknown function (DUF1423)Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. Protein ofunknown function (DUF1423);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1423, plant (InterPro:IPR004082); Protein ofunknown function (DUF1423) (TAIR:AT1G14740.1); Has 3195 Blast hits to 2635 proteins in 392 species: Archae - 10; Bacteria - 381; Metazoa - 1310; Fungi - 308; Plants - 351; Viruses - 11; Other Eukaryotes - 824 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT4G14340.1 | protein_coding | 4:8248160-8251998 | -19.7095 | 168 | 226 | 47 | 0 | casein kinase I Phosphorylates serine or threonine residues that are near and C-terminal to acidic side chains on a variety of target proteins casein kinase I (CKI1);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); casein kinase I-like 10 (TAIR:AT3G23340.1); Has 58467 Blast hits to 58136 proteins in 2224 species: Archae - 39; Bacteria - 9706; Metazoa - 21949; Fungi - 6340; Plants - 9653; Viruses - 309; Other Eukaryotes - 10471 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G17450.1 | protein_coding | 3:5972580-5976211 | -19.7085 | 237 | 278 | 2851 | 2810 | hAT dimerisation domain-containing protein hAT dimerisation domain-containing protein;FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein ofunknown function DUF659 (InterPro:IPR007021); hAT transposon superfamily (TAIR:AT4G15020.2); Has 1280 Blast hits to 918 proteins in 67 species: Archae - 0; Bacteria - 8; Metazoa - 57; Fungi - 19; Plants - 1102; Viruses - 13; Other Eukaryotes - 81 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT4G32260.1 | protein_coding | 4:15573553-15574737 | -19.6973 | 541 | 560 | 902 | 883 | ATPase, F0 complex, subunit B/B', bacterial/chloroplast ATPase, F0 complex, subunit B/B', bacterial/chloroplast;FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit B/B', bacterial/chloroplast (InterPro:IPR002146); Has 2587 Blast hits to 2581 proteins in 935 species: Archae - 6; Bacteria - 1820; Metazoa - 10; Fungi - 8; Plants - 73; Viruses - 1; Other Eukaryotes - 669 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT2G27230.1 | protein_coding | 2:11650358-11654143 | -19.6897 | 32 | 72 | 417 | 385 | transcription factor-related Encodes a nuclear-localized transcriptional activator with weak sequence similarity to basic helix-loop-helix(bHLH)-domain proteins. It promotes the production of stele cells in root meristems and is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots. LONESOME HIGHWAY (LHW);CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092); Serine/threonine-protein kinase WNK (With No Lysine)-related (TAIR:AT1G64625.3); Has 448 Blast hits to 377 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 446; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G07220.1 | protein_coding | 5:2265233-2267012 | -19.6883 | 146 | 169 | 116 | 93 | BCL-2-associated athanogene 3 A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. BCL-2-associated athanogene 3 (BAG3); INVOLVED IN: regulation of apoptosis, apoptosis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Apoptosis regulator, Bcl-2 protein, BAG (InterPro:IPR003103), Ubiquitin supergroup (InterPro:IPR019955); BCL-2-associated athanogene 2 (TAIR:AT5G62100.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028301 | AT5G02095.1 | Ch5:4341236-4341690 | AT5G13010.1 | protein_coding | 5:4122400-4129005 | -19.66 | 68 | 105 | 3973 | 3921 | RNA helicase family protein embryo defective 3011 (EMB3011);FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: embryo development ending in seed dormancy; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Helicase-associated domain (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Domain ofunknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT2G01460.1 | protein_coding | 2:205775-211963 | -19.6582 | 2325 | 2356 | 97 | 66 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, kinase activity, nucleotide binding, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), ATPase, AAA+ type, core (InterPro:IPR003593), Uridine kinase (InterPro:IPR000764); Phosphoribulokinase / Uridine kinase family (TAIR:AT1G26190.1); Has 3953 Blast hits to 3156 proteins in 1342 species: Archae - 38; Bacteria - 3073; Metazoa - 244; Fungi - 122; Plants - 227; Viruses - 4; Other Eukaryotes - 245 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G45240.1 | protein_coding | 3:16570478-16573762 | -19.6535 | 51 | 100 | 929 | 892 | geminivirus rep interacting kinase 1 Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. geminivirus rep interacting kinase 1 (GRIK1);CONTAINS InterPro DOMAIN/s: Calcium/calmodulin-dependent protein kinase kinase (InterPro:IPR020657), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); geminivirus rep interacting kinase 2 (TAIR:AT5G60550.1); Has 117743 Blast hits to 115793 proteins in 4740 species: Archae - 114; Bacteria - 14389; Metazoa - 44129; Fungi - 12221; Plants - 26959; Viruses - 496; Other Eukaryotes - 19435 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G65920.1 | protein_coding | 1:24525102-24529362 | -19.6357 | 973 | 993 | 78 | 58 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain;FUNCTIONS IN: zinc ion binding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation, RCC1 (InterPro:IPR000408), Disease resistance/zinc finger/chromosome condensation-like region (InterPro:IPR013591), Pleckstrin homology (InterPro:IPR001849), Zinc finger, FYVE-type (InterPro:IPR000306), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Zinc finger, FYVE-related (InterPro:IPR017455), Pleckstrin homology-type (InterPro:IPR011993), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain (TAIR:AT5G42140.1); Has 20784 Blast hits to 8293 proteins in 486 species: Archae - 65; Bacteria - 2335; Metazoa - 8187; Fungi - 1149; Plants - 2727; Viruses - 3; Other Eukaryotes - 6318 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G34470.1 | protein_coding | 1:12604161-12607033 | -19.6175 | 2126 | 2169 | 312 | 279 | Protein ofunknown function (DUF803) Protein ofunknown function (DUF803);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF803 (InterPro:IPR008521); Protein ofunknown function (DUF803) (TAIR:AT4G09640.1); Has 1275 Blast hits to 1251 proteins in 224 species: Archae - 0; Bacteria - 101; Metazoa - 420; Fungi - 374; Plants - 269; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). | |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT2G27170.1 | protein_coding | 2:11609073-11617496 | -19.6112 | 117 | 149 | 1577 | 1534 | Structural maintenance of chromosomes (SMC) family protein Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment.TITAN7 (TTN7);FUNCTIONS IN: ATP binding; INVOLVED IN: sister chromatid cohesion, chromosome segregation; LOCATED IN: cohesin complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SMCs flexible hinge (InterPro:IPR010935), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); structural maintenance of chromosomes 2 (TAIR:AT5G62410.1); Has 158776 Blast hits to 77347 proteins in 3496 species: Archae - 2059; Bacteria - 28403; Metazoa - 67946; Fungi - 11949; Plants - 6773; Viruses - 706; Other Eukaryotes - 40940 (source: NCBI BLink). | |
| XLOC_021964 | AT4G03038.1 | Ch4:1340115-1341289 | AT4G03050.2 | protein_coding | 4:1343845-1346436 | -19.5785 | 441 | 481 | 1158 | 1118 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein Transcriptional silent in leaf tissues of ecotype Col. The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis. AOP3;FUNCTIONS IN: oxidoreductase activity, iron ion binding; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT4G03070.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G21170.1 | protein_coding | 2:9070734-9074470 | -19.5696 | 3673 | 3708 | 287 | 252 | triosephosphate isomerase Encodes a plastidic triose phosphate isomerase. Mutants with reduced pdTPI levels have difficulty transitioning from heterotrophic to autotrophic growth. The related phenotypes, such as chlorosis in light-grown seedlings may result from an accumulation of dihydroxyacetone phosphate (DHAP) and methylglyoxal (MG) in these mutants. Both splice variants appear to be expressed, but the At2g21170.2 variant appears to have a much narrower expression range limited to roots. triosephosphate isomerase (TIM);FUNCTIONS IN: triose-phosphate isomerase activity; INVOLVED IN: in 7 processes; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Triosephosphate isomerase, active site (InterPro:IPR020861), Aldolase-type TIM barrel (InterPro:IPR013785), Triosephosphate isomerase (InterPro:IPR000652); triosephosphate isomerase (TAIR:AT3G55440.1); Has 11587 Blast hits to 11585 proteins in 3635 species: Archae - 138; Bacteria - 6210; Metazoa - 1207; Fungi - 243; Plants - 472; Viruses - 0; Other Eukaryotes - 3317 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G70895.1 | protein_coding | 1:26727555-26729374 | -19.5655 | 670 | 698 | 160 | 124 | CLAVATA3/ESR-RELATED 17 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. CLAVATA3/ESR-RELATED 17 (CLE17); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT2G30470.1 | protein_coding | 2:12980428-12985277 | -19.5266 | 28 | 62 | 2813 | 2774 | high-level expression of sugar-inducible gene 2 HSI2 is a member of a novel family of B3 domain proteins with a sequence similar to the ERF-associated amphiphilic repression (EAR) motif. ItFUNCTIONS as an active repressor of the Spo minimal promoter (derived from a gene for sweet potato sporamin A1) through the EAR motif. ItCONTAINS a plant-specific B3 DNA-binding domain. The Arabidopsis genomeCONTAINS 42 genes with B3 domains which could be classified into three families that are represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. high-level expression of sugar-inducible gene 2 (HSI2);CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340), Zinc finger, CW-type (InterPro:IPR011124); HSI2-like 1 (TAIR:AT4G32010.1); Has 1263 Blast hits to 1242 proteins in 97 species: Archae - 0; Bacteria - 5; Metazoa - 31; Fungi - 0; Plants - 1168; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). | |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT4G31351.1 | protein_coding | 4:15217257-15217884 | -19.519 | 123 | 158 | 197 | 162 | This gene encodes a small protein and has either evidence of transcription or purifying selection.unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G31354.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT2G32310.1 | protein_coding | 2:13724394-13726374 | -19.5144 | 1675 | 1704 | 851 | 822 | CCT motif family protein CCT motif family protein;CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); B-box type zinc finger protein with CCT domain (TAIR:AT3G21880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G24360.1 | protein_coding | 2:10364451-10366902 | -19.4945 | 1446 | 1477 | 80 | 49 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G31170.3); Has 132546 Blast hits to 130322 proteins in 4939 species: Archae - 142; Bacteria - 14767; Metazoa - 50018; Fungi - 12226; Plants - 34060; Viruses - 645; Other Eukaryotes - 20688 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G03495.1 | protein_coding | 5:873293-875251 | -19.4919 | 53 | 95 | 1015 | 975 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT5G03480.1); Has 197 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_013032 | AT2G45023.1 | Ch2:18570156-18572173 | AT3G02065.2 | protein_coding | 3:358916-360889 | -19.4911 | 267 | 295 | 1354 | 1325 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT2G42520.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G53590.1 | protein_coding | 5:21771811-21772794 | -19.4709 | 3640 | 3704 | 127 | 67 | SAUR-like auxin-responsive protein familySAUR-like auxin-responsive protein family ;CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); SAUR-like auxin-responsive protein family (TAIR:AT4G00880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G37480.1 | protein_coding | 2:15737842-15739848 | -19.4691 | 971 | 995 | 32 | 8 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G53670.2); Has 186 Blast hits to 186 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 14; Fungi - 7; Plants - 154; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | |
| XLOC_013613 | AT3G02025.1 | Ch3:2424354-2424597 | AT5G37350.1 | protein_coding | 5:14792819-14796045 | -19.4453 | 85 | 145 | 1552 | 1466 | Serine/threonine-protein kinase Rio1 Serine/threonine-protein kinase Rio1;FUNCTIONS IN: protein serine/threonine kinase activity, catalytic activity, ATP binding;CONTAINS InterPro DOMAIN/s: RIO-like kinase (InterPro:IPR018934), Serine/threonine-protein kinase Rio1 (InterPro:IPR017407), RIO kinase (InterPro:IPR000687), RIO kinase, conserved site (InterPro:IPR018935), Protein kinase-like domain (InterPro:IPR011009); Serine/threonine-protein kinase Rio1 (TAIR:AT2G24990.1); Has 12159 Blast hits to 6760 proteins in 774 species: Archae - 403; Bacteria - 825; Metazoa - 4615; Fungi - 1188; Plants - 588; Viruses - 131; Other Eukaryotes - 4409 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G08510.1 | protein_coding | 1:2691062-2694547 | -19.4384 | 2173 | 2228 | 247 | 176 | fatty acyl-ACP thioesterases B Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. fatty acyl-ACP thioesterases B (FATB);CONTAINS InterPro DOMAIN/s: Acyl-ACP-thioesterase, N-terminal domain (InterPro:IPR021113), Acyl-ACP thioesterase (InterPro:IPR002864); fatA acyl-ACP thioesterase (TAIR:AT3G25110.1); Has 1275 Blast hits to 1274 proteins in 533 species: Archae - 0; Bacteria - 944; Metazoa - 0; Fungi - 0; Plants - 322; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G64310.1 | protein_coding | 1:23866053-23867711 | -19.438 | 680 | 726 | 1632 | 1570 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT4G18750.1); Has 36015 Blast hits to 13020 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 49; Plants - 35536; Viruses - 0; Other Eukaryotes - 363 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT1G30480.1 | protein_coding | 1:10790022-10792725 | -19.4372 | 28 | 62 | 762 | 726 | D111/G-patch domain-containing protein recombination and DNA-damage resistance protein (DRT111) DNA-DAMAGE-REPAIR/TOLERATION PROTEIN 111 (DRT111);FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: DNA repair; LOCATED IN: chloroplast, nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), D111/G-patch (InterPro:IPR000467), Splicing factor, SPF45 (InterPro:IPR016967); Has 6802 Blast hits to 5609 proteins in 466 species: Archae - 14; Bacteria - 357; Metazoa - 3361; Fungi - 1024; Plants - 621; Viruses - 38; Other Eukaryotes - 1387 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G43520.1 | protein_coding | 3:15405984-15407949 | -19.4314 | 298 | 352 | 438 | 379 | Transmembrane proteins 14C Transmembrane proteins 14C; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Transmembrane proteins 14C (TAIR:AT2G26240.1); Has 541 Blast hits to 527 proteins in 134 species: Archae - 4; Bacteria - 94; Metazoa - 236; Fungi - 13; Plants - 153; Viruses - 7; Other Eukaryotes - 34 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G32340.1 | protein_coding | 2:13731969-13734534 | -19.4226 | 802 | 833 | 208 | 176 | TraB family protein TraB family protein;CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); TraB family protein (TAIR:AT1G05270.1); Has 770 Blast hits to 747 proteins in 261 species: Archae - 151; Bacteria - 256; Metazoa - 126; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G28480.1 | protein_coding | 4:14073008-14075271 | -19.3691 | 3590 | 3654 | 766 | 711 | DNAJ heat shock family proteinDNAJ heat shock family protein;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 28075 Blast hits to 27586 proteins in 3414 species: Archae - 196; Bacteria - 10500; Metazoa - 4718; Fungi - 2638; Plants - 2903; Viruses - 17; Other Eukaryotes - 7103 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT3G45540.1 | protein_coding | 3:16706312-16707649 | -19.3628 | 175 | 195 | 946 | 926 | RING/U-box protein with C6HC-type zinc finger RING/U-box protein with C6HC-type zinc finger;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841); RING/U-box protein with C6HC-type zinc finger (TAIR:AT3G45580.1); Has 2900 Blast hits to 2879 proteins in 213 species: Archae - 0; Bacteria - 2; Metazoa - 1213; Fungi - 549; Plants - 696; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G54390.1 | protein_coding | 5:22085998-22088094 | -19.3589 | 55 | 84 | 55 | 16 | HAL2-like Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. It does not also act as inositol polyphosphate 1-phosphatases, which other members of the HAL2-like family do. It is proposed that AHL acts in concert with sulphotransferases to prevent both the toxicity of PAP on RNA processing enzymes as well as the product inhibition of PAP on sulphate conjugation. HAL2-like (HL);FUNCTIONS IN: 3'(2'),5'-bisphosphate nucleotidase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: sulfur metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Inositol monophosphatase, conserved site (InterPro:IPR020550), Inositol monophosphatase (InterPro:IPR000760), 3(2),5 -bisphosphate nucleotidase HAL2 (InterPro:IPR006239), Inositol monophosphatase, metal-binding site (InterPro:IPR020583); Inositol monophosphatase family protein (TAIR:AT5G63980.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_021635 | AT4G09605.1 | Ch4:17706331-17707283 | AT3G06010.1 | protein_coding | 3:1802141-1807530 | -19.3515 | 480 | 512 | 3345 | 3311 | Homeotic gene regulator Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress. ATCHR12;FUNCTIONS IN: helicase activity, DNA binding, nucleic acid binding, ATP binding; INVOLVED IN: response to water deprivation, response to salt stress, response to heat; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); Homeotic gene regulator (TAIR:AT5G19310.1); Has 23556 Blast hits to 19403 proteins in 2220 species: Archae - 141; Bacteria - 6122; Metazoa - 5759; Fungi - 4503; Plants - 1859; Viruses - 268; Other Eukaryotes - 4904 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G51820.1 | protein_coding | 5:21063298-21068327 | -19.3451 | 601 | 637 | 59 | 34 | phosphoglucomutase Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. phosphoglucomutase (PGM);FUNCTIONS IN: phosphoglucomutase activity; INVOLVED IN: response to cold, starch biosynthetic process, detection of gravity, carbohydrate metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); Phosphoglucomutase/phosphomannomutase family protein (TAIR:AT1G70730.3); Has 12307 Blast hits to 12296 proteins in 2800 species: Archae - 231; Bacteria - 9586; Metazoa - 483; Fungi - 211; Plants - 168; Viruses - 0; Other Eukaryotes - 1628 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G39560.1 | protein_coding | 4:18382259-18383885 | -19.3383 | 51 | 72 | 96 | 75 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT5G49000.2); Has 3492 Blast hits to 2791 proteins in 179 species: Archae - 4; Bacteria - 195; Metazoa - 1983; Fungi - 9; Plants - 1156; Viruses - 39; Other Eukaryotes - 106 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G46030.1 | protein_coding | 5:18670051-18671461 | -19.3053 | 777 | 804 | 459 | 434 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G07670.1 | protein_coding | 1:2370020-2374607 | -19.3034 | 40 | 96 | 53 | 0 | endomembrane-type CA-ATPase 4 endomembrane-type CA-ATPase 4 (ECA4);FUNCTIONS IN: calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: guard cell, callus, cultured cell;CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type, calcium-transporting (InterPro:IPR005782), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068); ER-type Ca2+-ATPase 1 (TAIR:AT1G07810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.2 | Ch1:5222729-5224055 | AT1G17665.1 | protein_coding | 1:6072153-6074525 | -19.2946 | 29 | 80 | 133 | 72 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; Has 149 Blast hits to 146 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 21; Fungi - 5; Plants - 30; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). | |
| XLOC_001952 | AT1G34418.1 | Ch1:12582122-12582721 | AT4G33300.1 | protein_coding | 4:16050456-16056526 | -19.2874 | 55 | 108 | 963 | 914 | ADR1-like 1Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. ADR1-like 1 (ADR1-L1);FUNCTIONS IN: ATP binding; INVOLVED IN: apoptosis, defense response; LOCATED IN: apoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Powdery mildew resistance protein, RPW8 domain (InterPro:IPR008808), Disease resistance protein (InterPro:IPR000767); ADR1-like 2 (TAIR:AT5G04720.1); Has 24553 Blast hits to 16464 proteins in 567 species: Archae - 18; Bacteria - 1305; Metazoa - 2144; Fungi - 50; Plants - 20420; Viruses - 0; Other Eukaryotes - 616 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.3 | Ch5:16534231-16535279 | AT4G14990.1 | protein_coding | 4:8565622-8569871 | -19.2607 | 240 | 269 | 926 | 901 | Topoisomerase II-associated protein PAT1 Topoisomerase II-associated protein PAT1; Topoisomerase II-associated protein PAT1 (TAIR:AT3G22270.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G16710.1 | protein_coding | 4:9398403-9399876 | -19.2584 | 45 | 84 | 235 | 179 | glycosyltransferase family protein 28 glycosyltransferase family protein 28;FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 641 Blast hits to 636 proteins in 314 species: Archae - 10; Bacteria - 242; Metazoa - 125; Fungi - 122; Plants - 50; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). | |
| XLOC_008571 | AT2G05215.1 | Ch2:3334410-3335689 | AT2G33310.2 | protein_coding | 2:14113025-14116089 | -19.2528 | 1027 | 1068 | 96 | 56 | auxin-induced protein 13 Auxin induced gene, IAA13 (IAA13). auxin-induced protein 13 (IAA13);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to auxin stimulus, response to cyclopentenone; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Aux/IAA-ARF-dimerisation (InterPro:IPR011525), AUX/IAA protein (InterPro:IPR003311); AUX/IAA transcriptional regulator family protein (TAIR:AT1G04550.2); Has 2413 Blast hits to 2412 proteins in 81 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2412; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G11100.1 | protein_coding | 3:3476187-3477900 | -19.2472 | 525 | 559 | 995 | 960 | sequence-specific DNA binding transcription factors sequence-specific DNA binding transcription factors;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); sequence-specific DNA binding transcription factors (TAIR:AT5G05550.1); Has 692 Blast hits to 654 proteins in 102 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 72; Plants - 388; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT4G38600.1 | protein_coding | 4:18040623-18049700 | -19.2285 | 269 | 309 | 3008 | 2973 | HEAT repeat ;HECT-domain (ubiquitin-transferase)Encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. KAKTUS (KAK);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: trichome branching, DNA endoreduplication; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024), HECT (InterPro:IPR000569); ubiquitin-protein ligase 4 (TAIR:AT5G02880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT1G21700.1 | protein_coding | 1:7620001-7624166 | -19.2283 | 335 | 361 | 264 | 237 | SWITCH/sucrose nonfermenting 3C a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). SWITCH/sucrose nonfermenting 3C (SWI3C);FUNCTIONS IN: DNA binding; INVOLVED IN: chromatin remodeling; LOCATED IN: SWI/SNF complex, chromatin remodeling complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), SWIRM (InterPro:IPR007526), SANT, eukarya (InterPro:IPR017884); DNA-binding family protein (TAIR:AT4G34430.3); Has 4703 Blast hits to 3623 proteins in 273 species: Archae - 0; Bacteria - 43; Metazoa - 1892; Fungi - 779; Plants - 380; Viruses - 2; Other Eukaryotes - 1607 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G10180.1 | protein_coding | 1:3338185-3341628 | -19.2227 | 54 | 92 | 2275 | 2243 | exocyst complex component 84B (TAIR:AT5G49830.1); Has 132 Blast hits to 132 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.2 | Ch1:19496461-19497686 | AT1G03590.1 | protein_coding | 1:894238-897718 | -19.2216 | 19 | 47 | 1678 | 1647 | Protein phosphatase 2C family protein Protein phosphatase 2C family protein;FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT4G03415.2); Has 5799 Blast hits to 5797 proteins in 294 species: Archae - 0; Bacteria - 4; Metazoa - 1418; Fungi - 691; Plants - 2505; Viruses - 5; Other Eukaryotes - 1176 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G04140.2 | protein_coding | 5:1129785-1138488 | -19.2071 | 1096 | 1116 | 192 | 172 | glutamate synthase 1 Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. glutamate synthase 1 (GLU1);FUNCTIONS IN: protein binding, glutamate synthase (ferredoxin) activity; INVOLVED IN: response to light stimulus, photorespiration; LOCATED IN: apoplast, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Glutamine amidotransferase, class-II (InterPro:IPR000583), Aldolase-type TIM barrel (InterPro:IPR013785), Glutamate synthase, alpha subunit, C-terminal (InterPro:IPR002489), Glutamate synthase, central-N (InterPro:IPR006982), Glutamate synthase, central-C (InterPro:IPR002932), Glutamine amidotransferase, type II (InterPro:IPR017932); glutamate synthase 2 (TAIR:AT2G41220.1); Has 17415 Blast hits to 17302 proteins in 2024 species: Archae - 267; Bacteria - 5686; Metazoa - 111; Fungi - 160; Plants - 179; Viruses - 0; Other Eukaryotes - 11012 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G08580.1 | protein_coding | 4:5461398-5463907 | -19.2049 | 50 | 94 | 1020 | 956 | microfibrillar-associated protein-relatedmicrofibrillar-associated protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); microfibrillar-associated protein-related (TAIR:AT5G17900.1); Has 41823 Blast hits to 26074 proteins in 1611 species: Archae - 271; Bacteria - 4310; Metazoa - 18112; Fungi - 3731; Plants - 1727; Viruses - 240; Other Eukaryotes - 13432 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G20815.1 | protein_coding | 2:8959255-8962149 | -19.1973 | 631 | 674 | 98 | 59 | Family ofunknown function (DUF566) Family ofunknown function (DUF566) ;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF566 (InterPro:IPR007573); Family ofunknown function (DUF566) (TAIR:AT2G20616.1); Has 226 Blast hits to 219 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 17; Fungi - 0; Plants - 190; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G18620.1 | protein_coding | 3:6408261-6411064 | -19.1799 | 70 | 96 | 1594 | 1569 | DHHC-type zinc finger family protein DHHC-type zinc finger family protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); Ankyrin repeat family protein with DHHC zinc finger domain (TAIR:AT2G14255.1); Has 4961 Blast hits to 4959 proteins in 248 species: Archae - 0; Bacteria - 0; Metazoa - 2163; Fungi - 692; Plants - 838; Viruses - 0; Other Eukaryotes - 1268 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G35870.1 | protein_coding | 5:14020779-14021700 | -19.1468 | 3660 | 3697 | 244 | 200 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G04480.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G21190.1 | protein_coding | 3:7432193-7434743 | -19.1343 | 629 | 663 | 91 | 43 | O-fucosyltransferase family protein O-fucosyltransferase family protein;CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); O-fucosyltransferase family protein (TAIR:AT1G51630.1); Has 760 Blast hits to 758 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 760; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT5G35450.1 | protein_coding | 5:13666524-13671200 | -19.1293 | 5 | 26 | 1680 | 1659 | Disease resistance protein (CC-NBS-LRR class) family Disease resistance protein (CC-NBS-LRR class) family;FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance protein (InterPro:IPR000767); Disease resistance protein (CC-NBS-LRR class) family (TAIR:AT5G43470.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_025116 | AT5G19221.1 | Ch5:6463964-6466349 | AT1G13970.1 | protein_coding | 1:4779351-4782546 | -19.1251 | 107 | 157 | 144 | 98 | Protein ofunknown function (DUF1336) Protein ofunknown function (DUF1336);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1336 (InterPro:IPR009769); Protein ofunknown function (DUF1336) (TAIR:AT3G29180.2); Has 292 Blast hits to 292 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 248; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G70640.1 | protein_coding | 1:26636110-26637876 | -19.1222 | 3382 | 3432 | 424 | 377 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); Octicosapeptide/Phox/Bem1p family protein (TAIR:AT3G26510.4); Has 386 Blast hits to 386 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G09760.1 | protein_coding | 3:2992654-2995694 | -19.1083 | 1449 | 1473 | 511 | 487 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, RING-CH-type (InterPro:IPR011016); RING/U-box superfamily protein (TAIR:AT5G03180.2); Has 1083 Blast hits to 1078 proteins in 125 species: Archae - 0; Bacteria - 2; Metazoa - 334; Fungi - 71; Plants - 602; Viruses - 25; Other Eukaryotes - 49 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G15180.1 | protein_coding | 1:5224294-5226778 | -19.1007 | 3373 | 3413 | 311 | 273 | MATE efflux family protein MATE efflux family protein;FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); MATE efflux family protein (TAIR:AT1G15170.1); Has 7522 Blast hits to 7471 proteins in 1793 species: Archae - 118; Bacteria - 4822; Metazoa - 149; Fungi - 328; Plants - 1330; Viruses - 0; Other Eukaryotes - 775 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G37370.1 | protein_coding | 5:14812570-14816628 | -19.0956 | 236 | 282 | 1139 | 1091 | PRP38 family protein Encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt. ATSRL1;CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 24000 Blast hits to 13040 proteins in 580 species: Archae - 8; Bacteria - 803; Metazoa - 13736; Fungi - 3156; Plants - 2052; Viruses - 103; Other Eukaryotes - 4142 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G29350.1 | protein_coding | 4:14449888-14451394 | -19.0941 | 85 | 133 | 97 | 50 | profilin 2 Encodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression. profilin 2 (PFN2);FUNCTIONS IN: actin binding, protein binding; INVOLVED IN: actin polymerization or depolymerization, cytoskeleton organization; LOCATED IN: chloroplast, plasma membrane, actin cytoskeleton, cytoplasm; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Profilin/allergen (InterPro:IPR002097), Profilin, plant (InterPro:IPR005455); profilin 1 (TAIR:AT2G19760.1); Has 925 Blast hits to 924 proteins in 248 species: Archae - 0; Bacteria - 2; Metazoa - 138; Fungi - 123; Plants - 584; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT3G11540.1 | protein_coding | 3:3631887-3638100 | -19.0938 | 55 | 92 | 2260 | 2223 | Tetratricopeptide repeat (TPR)-like superfamily protein Encodes a N-acetyl glucosamine transferase that may glycosylate other molecules involved in GA signaling. CONTAINS a tetratricopeptide repeat region, and a novel carboxy-terminal region. SPY acts as both a repressor of GA responses and as a positive regulation of cytokinin signalling. SPY may be involved in reducing ROS accumulation in response to stress. SPINDLY (SPY);CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734), Sel1-like (InterPro:IPR006597); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT3G04240.1); Has 77055 Blast hits to 28756 proteins in 2442 species: Archae - 2374; Bacteria - 35241; Metazoa - 12084; Fungi - 2779; Plants - 2385; Viruses - 3; Other Eukaryotes - 22189 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G14950.1 | protein_coding | 5:4837071-4842067 | -19.0874 | 2603 | 2630 | 367 | 341 | golgi alpha-mannosidase II Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans.golgi alpha-mannosidase II (GMII);CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase/deacetylase, beta/alpha-barrel (InterPro:IPR011330), Glycoside hydrolase, family 38, central domain (InterPro:IPR015341), Glycoside hydrolase, family 38, core (InterPro:IPR000602), Glycosyl hydrolases 38, C-terminal (InterPro:IPR011682); Glycosyl hydrolase family 38 protein (TAIR:AT5G66150.1); Has 2033 Blast hits to 1987 proteins in 497 species: Archae - 20; Bacteria - 870; Metazoa - 708; Fungi - 131; Plants - 147; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G06910.1 | protein_coding | 5:2140400-2142679 | -19.0783 | 231 | 252 | 789 | 768 | J-domain protein 6 DnaJ homologue,CONTAINS J domain which is common in all known DnaJ proteins but missing G/F domain. J-domain protein 6 (ATJ6);FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); Chaperone DnaJ-domain superfamily protein (TAIR:AT3G12170.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G02475.1 | protein_coding | 1:513699-515422 | -19.0611 | 516 | 537 | 190 | 169 | Polyketide cyclase/dehydrase and lipid transport superfamily protein Polyketide cyclase/dehydrase and lipid transport superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Polyketide cyclase / dehydrase and lipid transport protein (TAIR:AT4G01883.1); Has 515 Blast hits to 515 proteins in 169 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT4G08320.2 | protein_coding | 4:5252640-5255200 | -19.0594 | 3670 | 3695 | 40 | 10 | Tetratricopeptide repeat (TPR)-like superfamily protein Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. Tetratricopeptide repeat (TPR)-like superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); protein phosphatase 5.2 (TAIR:AT2G42810.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT3G60630.1 | protein_coding | 3:22410240-22412663 | -19.053 | 932 | 991 | 1202 | 1151 | GRAS family transcription factor Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. HAIRY MERISTEM 2 (HAM2);CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT2G45160.1); Has 2330 Blast hits to 2284 proteins in 297 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 2323; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G01400.1 | protein_coding | 3:151725-153263 | -19.0468 | 616 | 662 | 1276 | 1232 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT5G58680.1); Has 6122 Blast hits to 3580 proteins in 271 species: Archae - 0; Bacteria - 2; Metazoa - 1843; Fungi - 536; Plants - 3048; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). | |
| XLOC_009092 | AT2G21187.1 | Ch2:9076289-9077494 | AT3G05990.1 | protein_coding | 3:1796839-1800082 | -19.0447 | 490 | 515 | 211 | 175 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); Leucine-rich repeat (LRR) family protein (TAIR:AT3G19230.1); Has 48781 Blast hits to 12236 proteins in 453 species: Archae - 4; Bacteria - 457; Metazoa - 323; Fungi - 23; Plants - 45747; Viruses - 0; Other Eukaryotes - 2227 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT1G10610.1 | protein_coding | 1:3506186-3509006 | -19.0127 | 27 | 54 | 277 | 251 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G16910.1); Has 1439 Blast hits to 1421 proteins in 116 species: Archae - 0; Bacteria - 21; Metazoa - 63; Fungi - 6; Plants - 1338; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G13740.1 | protein_coding | 1:4713433-4715407 | -18.9986 | 1237 | 1291 | 675 | 616 | ABI five binding protein 2 Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. ABI five binding protein 2 (AFP2);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1675 (InterPro:IPR012463); ABI five binding protein (TAIR:AT1G69260.1); Has 207 Blast hits to 201 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 6; Plants - 185; Viruses - 3; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT4G18650.1 | protein_coding | 4:10263969-10265439 | -18.9978 | 1235 | 1264 | 535 | 497 | transcription factor-related A maternally expressed imprinted gene. transcription factor-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G14880.2); Has 523 Blast hits to 523 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G20350.1 | protein_coding | 5:6876441-6881506 | -18.997 | 672 | 699 | 31 | 4 | Ankyrin repeat family protein with DHHC zinc finger domain Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. TIP GROWTH DEFECTIVE 1 (TIP1);FUNCTIONS IN: acyl binding, S-acyltransferase activity; INVOLVED IN: response to salt stress, cell tip growth; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Ankyrin repeat family protein with DHHC zinc finger domain (TAIR:AT2G14255.1); Has 74376 Blast hits to 32836 proteins in 1312 species: Archae - 100; Bacteria - 6632; Metazoa - 35576; Fungi - 7192; Plants - 4422; Viruses - 788; Other Eukaryotes - 19666 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G61210.1 | protein_coding | 5:24623248-24625631 | -18.9963 | 676 | 698 | 200 | 178 | soluble N-ethylmaleimide-sensitive factor adaptor protein 33 membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation soluble N-ethylmaleimide-sensitive factor adaptor protein 33 (SNAP33);FUNCTIONS IN: protein binding, SNAP receptor activity; INVOLVED IN: vesicle-mediated transport, response to other organism, cellular membrane fusion, response to mechanical stimulus, cytokinesis by cell plate formation; LOCATED IN: integral to membrane of membrane fraction, plasma membrane, chloroplast, cell plate; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SNAP-25 (InterPro:IPR000928), Target SNARE coiled-coil domain (InterPro:IPR000727); soluble N-ethylmaleimide-sensitive factor adaptor protein 30 (TAIR:AT1G13890.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G08610.1 | protein_coding | 3:2615426-2616934 | -18.9879 | 236 | 267 | 35 | 0 | unknown protein; Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT2G24650.1 | protein_coding | 2:10483253-10487773 | -18.9877 | 473 | 521 | 199 | 147 | DNA binding;DNA binding;sequence-specific DNA binding transcription factors DNA binding;DNA binding;sequence-specific DNA binding transcription factors;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent;CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); transcriptional factor B3 family protein (TAIR:AT2G24680.1); Has 1264 Blast hits to 283 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1262; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001952 | AT1G34418.1 | Ch1:12582122-12582721 | AT1G73940.1 | protein_coding | 1:27798237-27799695 | -18.9811 | 121 | 178 | 79 | 26 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G49410.2); Has 54 Blast hits to 54 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G63460.1 | protein_coding | 3:23430623-23437374 | -18.9666 | 232 | 266 | 1776 | 1736 | transducin family protein / WD-40 repeat family protein transducin family protein / WD-40 repeat family protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT1G18830.1); Has 36264 Blast hits to 25632 proteins in 1258 species: Archae - 42; Bacteria - 5004; Metazoa - 13161; Fungi - 7258; Plants - 4512; Viruses - 551; Other Eukaryotes - 5736 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT3G52460.1 | protein_coding | 3:19446637-19448002 | -18.9204 | 63 | 95 | 716 | 686 | hydroxyproline-rich glycoprotein family protein hydroxyproline-rich glycoprotein family protein; Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (TAIR:AT2G27260.1); Has 13276 Blast hits to 8377 proteins in 712 species: Archae - 22; Bacteria - 1322; Metazoa - 3676; Fungi - 1758; Plants - 4244; Viruses - 417; Other Eukaryotes - 1837 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT4G31350.1 | protein_coding | 4:15212429-15216029 | -18.917 | 29 | 62 | 65 | 31 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT2G19160.1); Has 585 Blast hits to 585 proteins in 21 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 553; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). | |
| XLOC_016958 | AT3G02505.1 | Ch3:3960120-3960327 | AT1G53300.1 | protein_coding | 1:19879405-19882895 | -18.9076 | 111 | 154 | 684 | 631 | tetratricopetide-repeat thioredoxin-like 1 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. tetratricopetide-repeat thioredoxin-like 1 (TTL1);FUNCTIONS IN: binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Tetratricopeptide TPR-1 (InterPro:IPR001440), Thioredoxin fold (InterPro:IPR012335), Tetratricopeptide-like helical (InterPro:IPR011990), Thioredoxin domain (InterPro:IPR013766), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734), Thioredoxin-like fold (InterPro:IPR012336); tetratricopetide-repeat thioredoxin-like 2 (TAIR:AT3G14950.1); Has 32097 Blast hits to 15852 proteins in 1300 species: Archae - 552; Bacteria - 6287; Metazoa - 8110; Fungi - 3609; Plants - 2668; Viruses - 128; Other Eukaryotes - 10743 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G16090.1 | protein_coding | 3:5456093-5459006 | -18.9028 | 53 | 78 | 366 | 341 | RING/U-box superfamily protein Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT1G65040.2); Has 7341 Blast hits to 7321 proteins in 267 species: Archae - 0; Bacteria - 4; Metazoa - 2254; Fungi - 727; Plants - 3286; Viruses - 21; Other Eukaryotes - 1049 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT4G31290.1 | protein_coding | 4:15185775-15188484 | -18.8997 | 60 | 80 | 272 | 252 | ChaC-like family protein ChaC-like family protein;CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); ChaC-like family protein (TAIR:AT5G26220.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G56320.1 | protein_coding | 3:20885894-20890102 | -18.8887 | 597 | 647 | 379 | 341 | PAP/OAS1 substrate-binding domain superfamily PAP/OAS1 substrate-binding domain superfamily;FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Nucleotidyl transferase domain (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); Nucleotidyltransferase family protein (TAIR:AT2G40520.4); Has 391 Blast hits to 365 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 102; Plants - 177; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G19170.1 | protein_coding | 2:8313671-8318596 | -18.8867 | 970 | 996 | 134 | 108 | subtilisin-like serine protease 3 Encodes a novel subtilisin-like serine protease. subtilisin-like serine protease 3 (SLP3);FUNCTIONS IN: serine-type peptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: middle lamella-containing extracellular matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8A, DUF1034 C-terminal (InterPro:IPR010435), Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); PA-domain containing subtilase family protein (TAIR:AT4G30020.1); Has 7824 Blast hits to 6803 proteins in 1147 species: Archae - 185; Bacteria - 4676; Metazoa - 73; Fungi - 358; Plants - 1850; Viruses - 0; Other Eukaryotes - 682 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G25500.1 | protein_coding | 3:9251093-9255083 | -18.8583 | 1447 | 1480 | 3287 | 3251 | formin homology 1 Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. formin homology 1 (AFH1);FUNCTIONS IN: actin binding, protein binding, actin filament binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Actin-binding FH2/DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); Actin-binding FH2 (formin homology 2) family protein (TAIR:AT2G43800.1); Has 17339 Blast hits to 10806 proteins in 665 species: Archae - 8; Bacteria - 1434; Metazoa - 6069; Fungi - 2556; Plants - 3390; Viruses - 718; Other Eukaryotes - 3164 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT2G43710.2 | protein_coding | 2:18119873-18122889 | -18.8555 | 26 | 50 | 523 | 499 | Plant stearoyl-acyl-carrier-protein desaturase family proteinEncodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. SSI2;FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, stearoyl-CoA 9-desaturase activity; INVOLVED IN: in 10 processes; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067), Stearoyl-ACP desaturase, conserved site (InterPro:IPR005803); Plant stearoyl-acyl-carrier-protein desaturase family protein (TAIR:AT3G02630.1); Has 946 Blast hits to 938 proteins in 221 species: Archae - 0; Bacteria - 436; Metazoa - 2; Fungi - 0; Plants - 450; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). | |
| XLOC_005592 | AT1G05927.1 | Ch1:8835419-8836850 | AT5G40810.1 | protein_coding | 5:16339863-16342927 | -18.8511 | 257 | 278 | 75 | 53 | Cytochrome C1 family Cytochrome C1 family;FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c1, transmembrane anchor, C-terminal (InterPro:IPR021157), Cytochrome c domain (InterPro:IPR009056); Cytochrome C1 family (TAIR:AT3G27240.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G45260.1 | protein_coding | 3:16596358-16598811 | -18.8311 | 1447 | 1475 | 1771 | 1743 | C2H2-like zinc finger protein C2H2-like zinc finger protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, double-stranded RNA binding (InterPro:IPR022755); C2H2 and C2HC zinc fingers superfamily protein (TAIR:AT5G60470.1); Has 54288 Blast hits to 20581 proteins in 284 species: Archae - 0; Bacteria - 7; Metazoa - 49362; Fungi - 343; Plants - 724; Viruses - 2; Other Eukaryotes - 3850 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G15140.1 | protein_coding | 3:5099426-5101880 | -18.8301 | 404 | 451 | 277 | 226 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein Polynucleotidyl transferase, ribonuclease H-like superfamily protein;FUNCTIONS IN: exonuclease activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Exonuclease, RNase T/DNA polymerase III (InterPro:IPR013520); Has 576 Blast hits to 576 proteins in 123 species: Archae - 0; Bacteria - 44; Metazoa - 336; Fungi - 16; Plants - 80; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT3G16090.1 | protein_coding | 3:5456093-5459006 | -18.8171 | 61 | 80 | 89 | 70 | RING/U-box superfamily protein Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT1G65040.2); Has 7341 Blast hits to 7321 proteins in 267 species: Archae - 0; Bacteria - 4; Metazoa - 2254; Fungi - 727; Plants - 3286; Viruses - 21; Other Eukaryotes - 1049 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G17620.1 | protein_coding | 4:9821874-9825039 | -18.8159 | 54 | 91 | 434 | 400 | glycine-rich protein glycine-rich protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G35770.1 | protein_coding | 2:15034037-15036556 | -18.814 | 3667 | 3723 | 1422 | 1371 | serine carboxypeptidase-like 28 serine carboxypeptidase-like 28 (scpl28);FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root;CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); serine carboxypeptidase-like 27 (TAIR:AT3G07990.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G50240.1 | protein_coding | 3:18623254-18628914 | -18.8106 | 632 | 678 | 150 | 113 | ATP binding microtubule motor family protein Encodes a kinesin-related protein. KICP-02;FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Kinesin, motor region, conserved site (InterPro:IPR019821), Kinesin, motor domain (InterPro:IPR001752); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT5G47820.2); Has 66961 Blast hits to 44643 proteins in 2038 species: Archae - 551; Bacteria - 6888; Metazoa - 33106; Fungi - 5668; Plants - 4311; Viruses - 105; Other Eukaryotes - 16332 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G19160.1 | protein_coding | 2:8309533-8314008 | -18.7948 | 612 | 659 | 39 | 1 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT4G30060.1); Has 601 Blast hits to 601 proteins in 26 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 557; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G10550.1 | protein_coding | 3:3292890-3298621 | -18.7835 | 3668 | 3699 | 68 | 33 | Myotubularin-like phosphatases II superfamily Has 3'-phosphatase activity against both phosphatidylinositol-3,5-bisphosphate (PtdIns3,5P2) and Phosphatidylinositol-3-phosphate (PtdIns3P). The in vitro activity was higher with PtdIns3,5P2 than with PtdIns3P.Myotubularin-like phosphatases II superfamily;FUNCTIONS IN: phosphatidylinositol-3-phosphatase activity, phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity; INVOLVED IN: dephosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Myotubularin phosphatase (InterPro:IPR017906), GRAM (InterPro:IPR004182), Myotubularin-related (InterPro:IPR010569); Myotubularin-like phosphatases II superfamily (TAIR:AT5G04540.1); Has 1697 Blast hits to 1550 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 1273; Fungi - 128; Plants - 40; Viruses - 0; Other Eukaryotes - 256 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT3G11420.1 | protein_coding | 3:3591251-3594589 | -18.7779 | 2490 | 2516 | 661 | 637 | Protein ofunknown function (DUF604) Protein ofunknown function (DUF604);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF604 (InterPro:IPR006740); Protein ofunknown function (DUF604) (TAIR:AT2G37730.1); Has 709 Blast hits to 698 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 200; Plants - 281; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT3G27690.1 | protein_coding | 3:10255906-10257489 | -18.7624 | 2271 | 2300 | 44 | 8 | photosystem II light harvesting complex gene 2.3Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. photosystem II light harvesting complex gene 2.3 (LHCB2.3);FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to red light, response to far red light, photosynthesis; LOCATED IN: light-harvesting complex, thylakoid, chloroplast thylakoid membrane, chloroplast envelope; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); photosystem II light harvesting complex gene 2.1 (TAIR:AT2G05100.1); Has 2373 Blast hits to 2310 proteins in 222 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 2058; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT3G19990.1 | protein_coding | 3:6965595-6967321 | -18.7579 | 54 | 82 | 1147 | 1122 | unknown protein; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 118 Blast hits to 118 proteins in 41 species: Archae - 0; Bacteria - 42; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G21110.1 | protein_coding | 4:11267069-11269019 | -18.7547 | 761 | 807 | 106 | 49 | G10 family protein G10 family protein; INVOLVED IN: biological_processunknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: G10 protein (InterPro:IPR001748), BUD31/G10-related, conserved site (InterPro:IPR018230); Has 466 Blast hits to 466 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 189; Fungi - 126; Plants - 80; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT5G27540.1 | protein_coding | 5:9722416-9727454 | -18.753 | 271 | 291 | 142 | 122 | MIRO-related GTP-ase 1 Encodes a protein with similarity to GTPases that is localized to the mitochondrion. Involved in embryogenesis, pollen tube growth and required for mitochondrial development. MIRO-related GTP-ase 1 (MIRO1);FUNCTIONS IN: GTP binding; INVOLVED IN: pollen tube growth, mitochondrion organization, embryo development, embryo development ending in seed dormancy; LOCATED IN: mitochondrion; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF hand associated, type-1 (InterPro:IPR013566), Mitochondrial Rho-like (InterPro:IPR013684), EF hand associated, type-2 (InterPro:IPR013567), Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Small GTPase (InterPro:IPR020851), Mitochondrial Rho GTPase (InterPro:IPR021181), MIRO (InterPro:IPR020860); MIRO-related GTP-ase 2 (TAIR:AT3G63150.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G07042.1 | ncRNA | 2:2919953-2922249 | -18.7526 | 2115 | 2151 | 744 | 706 | other RNA | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT3G07780.1 | protein_coding | 3:2484454-2487126 | -18.7488 | 398 | 442 | 1377 | 1327 | Protein ofunknown function (DUF1423)Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. OBERON1 (OBE1);FUNCTIONS IN: zinc ion binding; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1423, plant (InterPro:IPR004082), Zinc finger, PHD-type (InterPro:IPR001965); Protein ofunknown function (DUF1423) (TAIR:AT5G48160.2); Has 8996 Blast hits to 6188 proteins in 768 species: Archae - 88; Bacteria - 1159; Metazoa - 3345; Fungi - 619; Plants - 512; Viruses - 79; Other Eukaryotes - 3194 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G29640.1 | protein_coding | 2:12671206-12673334 | -18.7264 | 620 | 646 | 1046 | 1023 | JOSEPHIN-like protein JOSEPHIN-like protein (JOSL);CONTAINS InterPro DOMAIN/s: Machado-Joseph disease protein MJD (InterPro:IPR006155); josephin protein-related (TAIR:AT1G07300.1); Has 526 Blast hits to 526 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 0; Plants - 101; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT2G37060.1 | protein_coding | 2:15575996-15577916 | -18.7151 | 1968 | 2006 | 484 | 446 | nuclear factor Y, subunit B8 "nuclear factor Y, subunit B8" (NF-YB8);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); nuclear factor Y, subunit B10 (TAIR:AT3G53340.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_005592 | AT1G05927.1 | Ch1:8835419-8836850 | AT4G14220.1 | protein_coding | 4:8195881-8198586 | -18.7076 | 259 | 279 | 225 | 205 | RING-H2 group F1A encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. RING-H2 group F1A (RHF1A);FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: regulation of cell cycle, proteasomal protein catabolic process, megagametogenesis, microgametogenesis; LOCATED IN: membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING-H2 group F2A (TAIR:AT5G22000.3); Has 5179 Blast hits to 4938 proteins in 253 species: Archae - 0; Bacteria - 16; Metazoa - 1752; Fungi - 320; Plants - 2058; Viruses - 9; Other Eukaryotes - 1024 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G64310.1 | protein_coding | 1:23866053-23867711 | -18.7034 | 1968 | 1986 | 1535 | 1517 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT4G18750.1); Has 36015 Blast hits to 13020 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 49; Plants - 35536; Viruses - 0; Other Eukaryotes - 363 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G54100.1 | protein_coding | 3:20033951-20038200 | -18.6913 | 2274 | 2315 | 52 | 13 | O-fucosyltransferase family protein O-fucosyltransferase family protein;CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); O-fucosyltransferase family protein (TAIR:AT2G37980.1); Has 847 Blast hits to 824 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 847; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G44750.2 | protein_coding | 2:18451426-18452875 | -18.6709 | 1584 | 1600 | 288 | 272 | thiamin pyrophosphokinase 2Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. thiamin pyrophosphokinase 2 (TPK2);CONTAINS InterPro DOMAIN/s: Thiamin pyrophosphokinase, vitamin B1-binding domain (InterPro:IPR007373), Thiamin pyrophosphokinase, eukaryotic (InterPro:IPR016966), Thiamin pyrophosphokinase (InterPro:IPR006282), Thiamin pyrophosphokinase, catalytic domain (InterPro:IPR007371); thiamin pyrophosphokinase1 (TAIR:AT1G02880.3); Has 1352 Blast hits to 1350 proteins in 558 species: Archae - 0; Bacteria - 721; Metazoa - 134; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT3G52500.1 | protein_coding | 3:19465264-19467455 | -18.6704 | 791 | 841 | 1540 | 1484 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cell wall, membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); Eukaryotic aspartyl protease family protein (TAIR:AT5G45120.1); Has 2297 Blast hits to 2281 proteins in 180 species: Archae - 0; Bacteria - 0; Metazoa - 245; Fungi - 122; Plants - 1871; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G52830.1 | protein_coding | 5:21410769-21412526 | -18.6644 | 251 | 291 | 1084 | 1043 | WRKY DNA-binding protein 27Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. WRKY DNA-binding protein 27 (WRKY27);CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657); WRKY family transcription factor (TAIR:AT4G01250.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT3G19340.1 | protein_coding | 3:6701273-6704312 | -18.664 | 388 | 411 | 113 | 90 | Protein ofunknown function (DUF3754) LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3754 (InterPro:IPR022227); aminopeptidases (TAIR:AT5G13940.1); Has 308 Blast hits to 303 proteins in 113 species: Archae - 0; Bacteria - 164; Metazoa - 10; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G09310.1 | protein_coding | 3:2860402-2861359 | -18.6601 | 230 | 254 | 540 | 516 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF37 (InterPro:IPR002696); Has 5781 Blast hits to 5781 proteins in 1903 species: Archae - 0; Bacteria - 3956; Metazoa - 2; Fungi - 0; Plants - 42; Viruses - 3; Other Eukaryotes - 1778 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT3G60240.4 | protein_coding | 3:22261648-22268496 | -18.6291 | 0 | 42 | 3845 | 3767 | eukaryotic translation initiation factor 4Gprotein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. eukaryotic translation initiation factor 4G (EIF4G);FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: response to virus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891), Armadillo-type fold (InterPro:IPR016024), MIF4G-like, type 3 (InterPro:IPR003890), MIF4-like, type 1/2/3 (InterPro:IPR016021); MIF4G domain-containing protein / MA3 domain-containing protein (TAIR:AT5G57870.1); Has 9538 Blast hits to 7052 proteins in 555 species: Archae - 16; Bacteria - 1070; Metazoa - 4140; Fungi - 1856; Plants - 683; Viruses - 80; Other Eukaryotes - 1693 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G04940.1 | protein_coding | 2:1735963-1740568 | -18.6206 | 1204 | 1255 | 200 | 138 | scramblase-related scramblase-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Scramblase (InterPro:IPR005552); Has 427 Blast hits to 416 proteins in 142 species: Archae - 0; Bacteria - 29; Metazoa - 228; Fungi - 113; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
| XLOC_004253 | AT1G04117.1 | Ch1:494008-495548 | AT1G54500.1 | protein_coding | 1:20356954-20357879 | -18.6185 | 666 | 710 | 281 | 235 | Rubredoxin-like superfamily protein Rubredoxin-like superfamily protein;FUNCTIONS IN: electron carrier activity, metal ion binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Rubredoxin, iron-binding site (InterPro:IPR018527), Rubredoxin-type Fe(Cys)4 protein (InterPro:IPR004039); Has 3108 Blast hits to 3080 proteins in 1023 species: Archae - 186; Bacteria - 2587; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G30200.2 | protein_coding | 4:14786532-14790501 | -18.613 | 1055 | 1107 | 61 | 10 | vernalization5/VIN3-likeEncodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. vernalization5/VIN3-like (VEL1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1423, plant (InterPro:IPR004082), Fibronectin, type III-like fold (InterPro:IPR008957), Fibronectin, type III (InterPro:IPR003961); Fibronectin type III domain-containing protein (TAIR:AT5G57380.1); Has 283 Blast hits to 258 proteins in 40 species: Archae - 0; Bacteria - 10; Metazoa - 3; Fungi - 23; Plants - 240; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT2G13370.1 | protein_coding | 2:5544054-5556560 | -18.6084 | 791 | 809 | 4904 | 4886 | chromatin remodeling 5chromatin remodeling 5 (CHR5);FUNCTIONS IN: chromatin binding, helicase activity, DNA binding, nucleic acid binding, ATP binding; INVOLVED IN: chromatin assembly or disassembly; LOCATED IN: chromatin, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Chromo domain (InterPro:IPR000953), SNF2-related (InterPro:IPR000330), Homeodomain-like (InterPro:IPR009057), DEAD-like helicase, N-terminal (InterPro:IPR014001), Chromo domain-like (InterPro:IPR016197), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); chromatin remodeling factor CHD3 (PICKLE) (TAIR:AT2G25170.1); Has 38529 Blast hits to 28045 proteins in 2467 species: Archae - 189; Bacteria - 9973; Metazoa - 8887; Fungi - 6205; Plants - 2508; Viruses - 447; Other Eukaryotes - 10320 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT5G58220.1 | protein_coding | 5:23554386-23556001 | -18.592 | 799 | 840 | 977 | 936 | transthyretin-like protein Encodes a transthyretin-like S-allantoin synthase protein that catalyzes two steps in the allantoin biosynthesis pathway by acting as a hydroxyisourate hydrolase and a 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) decarboxylase. Two alternatively spliced versions of the transcript give rise to a longer peroxisomally-targeted protein (AT5G58220.1 (called TTL1-)) and a slightly shorter cytoplasmic protein (AT5G58220.3 (called TTL2-)). Both have roughly equivalent enzymatic activity in vitro, but, allantoin biosynthesis is believed to occur in the peroxisome suggesting that the cytosolic form may participate in a different process. transthyretin-like protein (TTL);FUNCTIONS IN: 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase activity, hydroxyisourate hydrolase activity; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling pathway, protein homotetramerization, allantoin biosynthetic process; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), Oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT4G34040.1 | protein_coding | 4:16304215-16308801 | -18.5521 | 167 | 227 | 113 | 75 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G15530.3); Has 8873 Blast hits to 7809 proteins in 315 species: Archae - 0; Bacteria - 89; Metazoa - 2441; Fungi - 580; Plants - 3871; Viruses - 41; Other Eukaryotes - 1851 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G42520.1 | protein_coding | 2:17704741-17709060 | -18.5286 | 1510 | 1547 | 2001 | 1968 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); DEA(D/H)-box RNA helicase family protein (TAIR:AT3G58510.3); Has 140248 Blast hits to 67514 proteins in 3679 species: Archae - 1004; Bacteria - 58923; Metazoa - 37605; Fungi - 9665; Plants - 13202; Viruses - 1099; Other Eukaryotes - 18750 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT5G24500.1 | protein_coding | 5:8367302-8368937 | -18.5285 | 60 | 78 | 588 | 570 | unknown protein; Has 133 Blast hits to 129 proteins in 40 species: Archae - 2; Bacteria - 0; Metazoa - 60; Fungi - 5; Plants - 29; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G26470.1 | protein_coding | 4:13370951-13372460 | -18.5273 | 46 | 93 | 826 | 789 | Calcium-binding EF-hand family proteinCalcium-binding EF-hand family protein;FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytoplasm; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand-like domain (InterPro:IPR011992); Calcium-binding EF-hand family protein (TAIR:AT3G24110.1); Has 9300 Blast hits to 7546 proteins in 1004 species: Archae - 0; Bacteria - 25; Metazoa - 3748; Fungi - 1101; Plants - 3090; Viruses - 0; Other Eukaryotes - 1336 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G58290.1 | protein_coding | 1:21623700-21626402 | -18.5272 | 673 | 692 | 234 | 215 | Glutamyl-tRNA reductase family protein Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. HEMA1;FUNCTIONS IN: glutamyl-tRNA reductase activity; INVOLVED IN: chlorophyll biosynthetic process, heme biosynthetic process, response to light stimulus, porphyrin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Quinate/shikimate 5-dehydrogenase/glutamyl-tRNA reductase (InterPro:IPR006151), Tetrapyrrole biosynthesis, glutamyl-tRNA reductase, conserved site (InterPro:IPR018214), Tetrapyrrole biosynthesis, glutamyl-tRNA reductase, C-terminal (InterPro:IPR015896), NAD(P)-binding domain (InterPro:IPR016040), Tetrapyrrole biosynthesis, glutamyl-tRNA reductase (InterPro:IPR000343), Tetrapyrrole biosynthesis, glutamyl-tRNA reductase, N-terminal (InterPro:IPR015895); Glutamyl-tRNA reductase family protein (TAIR:AT1G09940.1); Has 5070 Blast hits to 5064 proteins in 1817 species: Archae - 226; Bacteria - 3676; Metazoa - 1; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 940 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G05840.2 | protein_coding | 3:1739777-1743163 | -18.5211 | 2717 | 2746 | 1513 | 1488 | Protein kinase superfamily protein encodes a SHAGGY-like kinase involved in meristem organization. ATSK12;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity; INVOLVED IN: meristem structural organization, gynoecium development, phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); shaggy-related kinase 11 (TAIR:AT5G26751.1); Has 106116 Blast hits to 104748 proteins in 3681 species: Archae - 81; Bacteria - 10864; Metazoa - 38225; Fungi - 11828; Plants - 26475; Viruses - 386; Other Eukaryotes - 18257 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT3G52270.1 | protein_coding | 3:19386983-19388944 | -18.5174 | 339 | 362 | 669 | 643 | Transcription initiation factor IIF, beta subunitTranscription initiation factor IIF, beta subunit;FUNCTIONS IN: RNA polymerase II transcription factor activity, catalytic activity, ATP binding; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, F mature embryo stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196); Transcription initiation factor IIF, beta subunit (TAIR:AT1G75510.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT3G16170.1 | protein_coding | 3:5475855-5480349 | -18.5168 | 16 | 42 | 1636 | 1610 | AMP-dependent synthetase and ligase family protein AMP-dependent synthetase and ligase family protein;FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: metabolic process; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); AMP-dependent synthetase and ligase family protein (TAIR:AT3G48990.1); Has 81919 Blast hits to 74550 proteins in 3809 species: Archae - 1169; Bacteria - 53765; Metazoa - 3235; Fungi - 4485; Plants - 2227; Viruses - 1; Other Eukaryotes - 17037 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.1 | Ch1:3895179-3896917 | AT5G62050.1 | protein_coding | 5:24923465-24927314 | -18.5162 | 10 | 26 | 95 | 79 | homolog of yeast oxidase assembly 1 (OXA1) essential factor for protein sorting and assembly into membranes homolog of yeast oxidase assembly 1 (OXA1) (OXA1);FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein import into mitochondrial inner membrane, protein complex assembly; LOCATED IN: mitochondrion, mitochondrial inner membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Membrane insertion protein, OxaA/YidC (InterPro:IPR001708), Membrane insertion protein, OxaA/YidC, core (InterPro:IPR020001); inner membrane protein OXA1-like (TAIR:AT2G46470.1); Has 6982 Blast hits to 6979 proteins in 2374 species: Archae - 0; Bacteria - 4991; Metazoa - 235; Fungi - 246; Plants - 190; Viruses - 0; Other Eukaryotes - 1320 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT1G74250.1 | protein_coding | 1:27920241-27922722 | -18.5093 | 734 | 761 | 786 | 758 | DNAJ heat shock N-terminal domain-containing protein DNAJ heat shock N-terminal domain-containing protein;FUNCTIONS IN: heat shock protein binding, zinc ion binding, nucleic acid binding; INVOLVED IN: protein folding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Zinc finger, U1-type (InterPro:IPR003604), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, double-stranded RNA binding (InterPro:IPR022755), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); DnaJ domain ;Myb-like DNA-binding domain (TAIR:AT3G11450.1); Has 93426 Blast hits to 65819 proteins in 3757 species: Archae - 599; Bacteria - 15939; Metazoa - 31666; Fungi - 9634; Plants - 4994; Viruses - 419; Other Eukaryotes - 30175 (source: NCBI BLink). | |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT1G68300.1 | protein_coding | 1:25598331-25599350 | -18.5074 | 0 | 24 | 684 | 660 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT3G11930.4); Has 7821 Blast hits to 7529 proteins in 1691 species: Archae - 688; Bacteria - 6019; Metazoa - 129; Fungi - 89; Plants - 708; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G14660.1 | protein_coding | 3:4924777-4927607 | -18.5073 | 2730 | 2760 | 172 | 146 | cytochrome P450, family 72, subfamily A, polypeptide 13 putative cytochrome P450 "cytochrome P450, family 72, subfamily A, polypeptide 13" (CYP72A13);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 72, subfamily A, polypeptide 15 (TAIR:AT3G14690.1); Has 31786 Blast hits to 31657 proteins in 1619 species: Archae - 67; Bacteria - 4951; Metazoa - 11303; Fungi - 6022; Plants - 7953; Viruses - 3; Other Eukaryotes - 1487 (source: NCBI BLink). | |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT1G62840.1 | protein_coding | 1:23271416-23272578 | -18.5024 | 790 | 813 | 399 | 375 | Protein ofunknown function (DUF1442) Protein ofunknown function (DUF1442);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1442 (InterPro:IPR009902); Protein ofunknown function (DUF1442) (TAIR:AT1G12320.1); Has 98 Blast hits to 97 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G41950.1 | protein_coding | 5:16785680-16789676 | -18.4985 | 1445 | 1468 | 43 | 20 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: protein import into mitochondrial outer membrane; LOCATED IN: mitochondrial outer membrane translocase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Plant specific mitochondrial import receptor subunit TOM20 (InterPro:IPR010547); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G61240.1 | protein_coding | 3:22666147-22669757 | -18.4863 | 418 | 451 | 147 | 115 | DEA(D/H)-box RNA helicase family protein DEA(D/H)-box RNA helicase family protein;FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); DEA(D/H)-box RNA helicase family protein (TAIR:AT2G45810.1); Has 53038 Blast hits to 46572 proteins in 3157 species: Archae - 705; Bacteria - 22269; Metazoa - 8742; Fungi - 5746; Plants - 2904; Viruses - 84; Other Eukaryotes - 12588 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G26690.1 | protein_coding | 1:9224059-9225792 | -18.484 | 2604 | 2629 | 42 | 19 | emp24/gp25L/p24 family/GOLD family protein emp24/gp25L/p24 family/GOLD family protein;FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); emp24/gp25L/p24 family/GOLD family protein (TAIR:AT1G69460.1); Has 1567 Blast hits to 1565 proteins in 238 species: Archae - 0; Bacteria - 0; Metazoa - 690; Fungi - 472; Plants - 246; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). | |
| XLOC_004253 | AT1G04117.1 | Ch1:494008-495548 | AT1G54780.1 | protein_coding | 1:20439383-20441159 | -18.4812 | 672 | 715 | 224 | 170 | thylakoid lumen 18.3 kDa proteinEncodes a thylakoid lumen protein regulating photosystem II repair cycle. Has acid phosphatase activity. TLP18.3;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: photosystem II repair; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF477 (InterPro:IPR007621); Has 209 Blast hits to 209 proteins in 92 species: Archae - 0; Bacteria - 130; Metazoa - 2; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G63370.1 | protein_coding | 3:23401963-23405991 | -18.4628 | 2549 | 2580 | 2977 | 2948 | Tetratricopeptide repeat (TPR)-like superfamily protein Encodes a chloroplast RNA editing factor. ORGANELLE TRANSCRIPT PROCESSING 86 (OTP86);CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21300.1); Has 48148 Blast hits to 13528 proteins in 241 species: Archae - 0; Bacteria - 4; Metazoa - 44; Fungi - 62; Plants - 47536; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.1 | Ch1:3895179-3896917 | AT3G51120.1 | protein_coding | 3:18986026-18992074 | -18.4601 | 4 | 26 | 3576 | 3555 | DNA binding;zinc ion binding;nucleic acid binding;nucleic acid bindingDNA binding;zinc ion binding;nucleic acid binding;nucleic acid binding;FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: histone modification, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Plus-3 domain, subgroup (InterPro:IPR018144), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), GYF (InterPro:IPR003169), SWIB/MDM2 domain (InterPro:IPR003121), Plus-3 (InterPro:IPR004343), SWIB domain (InterPro:IPR019835), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); nucleic acid binding;zinc ion binding;DNA binding (TAIR:AT2G16485.1); Has 2327 Blast hits to 1758 proteins in 258 species: Archae - 0; Bacteria - 308; Metazoa - 909; Fungi - 193; Plants - 493; Viruses - 18; Other Eukaryotes - 406 (source: NCBI BLink). | |
| XLOC_010840 | AT2G04285.1 | Ch2:763851-764640 | AT2G02730.1 | protein_coding | 2:764547-767500 | -18.4563 | 0 | 23 | 1509 | 1486 | Protein ofunknown function (DUF1664) Protein ofunknown function (DUF1664);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1664 (InterPro:IPR012458); Protein ofunknown function (DUF1664) (TAIR:AT1G27000.1); Has 150 Blast hits to 150 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT2G28305.1 | protein_coding | 2:12081023-12084678 | -18.4546 | 584 | 616 | 1013 | 982 | Putative lysine decarboxylase family protein LONELY GUY 1 (LOG1);CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); lysine decarboxylase family protein (TAIR:AT2G37210.1); Has 5303 Blast hits to 5301 proteins in 1556 species: Archae - 26; Bacteria - 3660; Metazoa - 10; Fungi - 132; Plants - 396; Viruses - 0; Other Eukaryotes - 1079 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G63140.1 | protein_coding | 3:23326867-23328789 | -18.4475 | 672 | 693 | 244 | 223 | chloroplast stem-loop binding protein of 41 kDaEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. chloroplast stem-loop binding protein of 41 kDa (CSP41A);FUNCTIONS IN: mRNA binding, poly(U) RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040); chloroplast RNA binding (TAIR:AT1G09340.1); Has 1047 Blast hits to 1047 proteins in 372 species: Archae - 70; Bacteria - 649; Metazoa - 6; Fungi - 5; Plants - 106; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). | |
| XLOC_029693 | AT5G43403.1 | Ch5:17430539-17431765 | AT1G03280.1 | protein_coding | 1:802970-807066 | -18.4452 | 595 | 623 | 1567 | 1541 | Transcription factor TFIIE, alpha subunitTranscription factor TFIIE, alpha subunit;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: endomembrane system, transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor TFIIE, alpha subunit (InterPro:IPR002853), Transcription factor TFE/TFIIEalpha, HTH domain (InterPro:IPR017919); Transcription factor TFIIE, alpha subunit (TAIR:AT4G20340.1); Has 759 Blast hits to 706 proteins in 191 species: Archae - 5; Bacteria - 10; Metazoa - 313; Fungi - 190; Plants - 108; Viruses - 11; Other Eukaryotes - 122 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT2G05940.1 | protein_coding | 2:2287238-2289636 | -18.43 | 395 | 418 | 1310 | 1287 | Protein kinase superfamily protein Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G35580.1); Has 113425 Blast hits to 112177 proteins in 3510 species: Archae - 99; Bacteria - 13130; Metazoa - 41743; Fungi - 9248; Plants - 32526; Viruses - 361; Other Eukaryotes - 16318 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G48420.1 | protein_coding | 3:17929581-17931713 | -18.4258 | 1444 | 1486 | 171 | 128 | Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinHaloacid dehalogenase-like hydrolase (HAD) superfamily protein;FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT4G39970.1); Has 12560 Blast hits to 12559 proteins in 2179 species: Archae - 78; Bacteria - 10284; Metazoa - 135; Fungi - 145; Plants - 385; Viruses - 3; Other Eukaryotes - 1530 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G27340.1 | protein_coding | 1:9495344-9498085 | -18.4255 | 973 | 995 | 331 | 300 | Galactose oxidase/kelch repeat superfamily protein Encodes a putative F-box protein that is involved in the regulation of leaf morphology. Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT5G15710.1); Has 1110 Blast hits to 1104 proteins in 52 species: Archae - 0; Bacteria - 1; Metazoa - 2; Fungi - 0; Plants - 1106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT3G07220.1 | protein_coding | 3:2297886-2299572 | -18.4162 | 14 | 34 | 694 | 674 | SMAD/FHA domain-containing protein SMAD/FHA domain-containing protein ;CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (FHA) domain (InterPro:IPR000253); SMAD/FHA domain-containing protein (TAIR:AT3G07260.1); Has 459 Blast hits to 458 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 202; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT4G21700.1 | protein_coding | 4:11529956-11532878 | -18.4148 | 428 | 451 | 95 | 72 | Protein ofunknown function (DUF2921) Protein ofunknown function (DUF2921); INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2921 (InterPro:IPR021319); Protein ofunknown function (DUF2921) (TAIR:AT1G52780.1); Has 127 Blast hits to 111 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT3G20970.1 | protein_coding | 3:7348157-7350341 | -18.4137 | 260 | 303 | 226 | 161 | NFU domain protein 4 Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion. NFU domain protein 4 (NFU4);CONTAINS InterPro DOMAIN/s: NIF system FeS cluster assembly, NifU, C-terminal (InterPro:IPR001075), HIRA-interacting protein 5 (InterPro:IPR017065), NIF system FeS cluster assembly, NifU-like scaffold, N-terminal (InterPro:IPR014824); NFU domain protein 5 (TAIR:AT1G51390.1); Has 6036 Blast hits to 5990 proteins in 1590 species: Archae - 18; Bacteria - 3114; Metazoa - 168; Fungi - 162; Plants - 179; Viruses - 3; Other Eukaryotes - 2392 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT4G30460.1 | protein_coding | 4:14888931-14889855 | -18.4102 | 319 | 364 | 546 | 499 | glycine-rich protein glycine-rich protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 195201 Blast hits to 50354 proteins in 2481 species: Archae - 397; Bacteria - 59837; Metazoa - 58170; Fungi - 13503; Plants - 16798; Viruses - 2787; Other Eukaryotes - 43709 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G49670.2 | protein_coding | 1:18380804-18386146 | -18.4082 | 536 | 560 | 2129 | 2105 | ARP protein (REF) molecular function has not been defined. Was shown involved in oxidative stress tolerance. NQR;FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: response to oxidative stress, metabolic process; LOCATED IN: mitochondrion, peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Alcohol dehydrogenase, C-terminal (InterPro:IPR013149), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198), GroES-like (InterPro:IPR011032), Polyketide synthase, enoylreductase (InterPro:IPR020843), NAD(P)-binding domain (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); Zinc-binding dehydrogenase family protein (TAIR:AT5G37980.1). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G18420.2 | protein_coding | 5:6105283-6109501 | -18.4065 | 153 | 184 | 1406 | 1381 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2363 (InterPro:IPR019312); Has 233 Blast hits to 233 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 2; Plants - 59; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). | |
| XLOC_028934 | AT5G24735.1 | Ch5:8468331-8469262 | AT1G71340.1 | protein_coding | 1:26885170-26888364 | -18.4057 | 41 | 66 | 125 | 100 | PLC-like phosphodiesterases superfamily protein Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. PLC-like phosphodiesterases superfamily protein;FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); Has 6308 Blast hits to 6301 proteins in 1557 species: Archae - 95; Bacteria - 5357; Metazoa - 60; Fungi - 20; Plants - 36; Viruses - 13; Other Eukaryotes - 727 (source: NCBI BLink). | |
| XLOC_028301 | AT5G02095.1 | Ch5:4341236-4341690 | AT1G76940.1 | protein_coding | 1:28902318-28904420 | -18.3987 | 70 | 99 | 494 | 468 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); nucleotide binding;nucleic acid binding (TAIR:AT1G21320.2); Has 631 Blast hits to 628 proteins in 151 species: Archae - 0; Bacteria - 4; Metazoa - 278; Fungi - 177; Plants - 131; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G19190.1 | protein_coding | 4:10493200-10496168 | -18.3905 | 3609 | 3647 | 247 | 206 | zinc knuckle (CCHC-type) family protein zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: CBF1-interacting co-repressor CIR, N-terminal (InterPro:IPR019339), Zinc finger, CCHC-type (InterPro:IPR001878); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G77145.1 | protein_coding | 1:28989838-28991454 | -18.3896 | 57 | 94 | 218 | 185 | Protein ofunknown function (DUF506) Protein ofunknown function (DUF506) ;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF506, plant (InterPro:IPR006502); Protein ofunknown function (DUF506) (TAIR:AT1G77160.1); Has 392 Blast hits to 390 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 390; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G01990.1 | protein_coding | 3:330099-333132 | -18.3864 | 40 | 69 | 1338 | 1309 | ACT domain repeat 6Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. ACT domain repeat 6 (ACR6);FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: stem, carpel, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); ACT domain repeat 4 (TAIR:AT1G69040.1); Has 3173 Blast hits to 1993 proteins in 619 species: Archae - 0; Bacteria - 2121; Metazoa - 0; Fungi - 0; Plants - 561; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G26810.1 | protein_coding | 3:9867652-9870782 | -18.3862 | 3559 | 3592 | 130 | 100 | auxin signaling F-box 2 auxin signaling F-box 2 (AFB2);FUNCTIONS IN: ubiquitin-protein ligase activity, auxin binding; INVOLVED IN: stamen development, pollen maturation, response to molecule of bacterial origin; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); auxin signaling F-box 3 (TAIR:AT1G12820.1); Has 2856 Blast hits to 1854 proteins in 175 species: Archae - 0; Bacteria - 10; Metazoa - 953; Fungi - 156; Plants - 1568; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G56930.1 | protein_coding | 5:23027658-23030639 | -18.3791 | 2289 | 2333 | 1850 | 1802 | CCCH-type zinc finger family protein embryo defective 1789 (emb1789);FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryo development ending in seed dormancy;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 4013 Blast hits to 1845 proteins in 273 species: Archae - 0; Bacteria - 114; Metazoa - 1017; Fungi - 647; Plants - 283; Viruses - 3; Other Eukaryotes - 1949 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G17420.1 | protein_coding | 3:5959174-5962289 | -18.3787 | 238 | 266 | 1594 | 1564 | glyoxysomal protein kinase 1 serine/threonine protein kinase-like protein glyoxysomal protein kinase 1 (GPK1);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G18500.2); Has 118798 Blast hits to 117415 proteins in 4321 species: Archae - 113; Bacteria - 14283; Metazoa - 43704; Fungi - 9736; Plants - 32880; Viruses - 449; Other Eukaryotes - 17633 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.3 | Ch1:9726607-9730185 | AT2G17430.1 | protein_coding | 2:7568018-7570912 | -18.3778 | 2623 | 2646 | 164 | 141 | Seven transmembrane MLO family protein A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genomeCONTAINS 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). MILDEW RESISTANCE LOCUS O 7 (MLO7);FUNCTIONS IN: calmodulin binding; INVOLVED IN: cell death, defense response; LOCATED IN: integral to membrane, plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: seedling growth, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Mlo-related protein (InterPro:IPR004326); Seven transmembrane MLO family protein (TAIR:AT5G65970.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT1G66725.1 | miRNA | 1:24884066-24884396 | -18.3694 | 47 | 77 | 66 | 28 | MIR163; miRNAEncodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G31300.2 | protein_coding | 4:15188744-15191217 | -18.3504 | 604 | 646 | 101 | 52 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily proteinEncodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. PBA1;FUNCTIONS IN: peptidase activity, endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: response to zinc ion, response to salt stress, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex, proteasome complex, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), Proteasome, subunit alpha/beta (InterPro:IPR001353); 20S proteasome beta subunit PBB2 (TAIR:AT5G40580.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_014170 | AT3G17185.1 | Ch3:5861491-5862437 | AT1G52240.1 | protein_coding | 1:19455495-19458069 | -18.3475 | 34 | 56 | 219 | 197 | RHO guanyl-nucleotide exchange factor 11Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily .RHO guanyl-nucleotide exchange factor 11 (ROPGEF11);CONTAINS InterPro DOMAIN/s: Rop nucleotide exchanger, PRONE (InterPro:IPR005512), Dynein light chain, type 1/2 (InterPro:IPR001372); RHO guanyl-nucleotide exchange factor 13 (TAIR:AT3G16130.1); Has 1099 Blast hits to 1098 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 490; Fungi - 40; Plants - 487; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G36050.1 | protein_coding | 1:13450089-13453683 | -18.3368 | 46 | 93 | 1444 | 1391 | Endoplasmic reticulum vesicle transporter proteinEndoplasmic reticulum vesicle transporter protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1692 (InterPro:IPR012936); Endoplasmic reticulum vesicle transporter protein (TAIR:AT1G22200.1); Has 1210 Blast hits to 1080 proteins in 199 species: Archae - 0; Bacteria - 0; Metazoa - 398; Fungi - 262; Plants - 277; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). | |
| XLOC_011469 | AT2G07225.1 | Ch2:8447744-8448283 | AT3G46260.1 | protein_coding | 3:16998163-16999992 | -18.3332 | 65 | 99 | 817 | 789 | protein kinase-relatedprotein kinase-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; receptor protein kinase-related (TAIR:AT3G46270.1); Has 605 Blast hits to 600 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 605; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT1G60450.1 | protein_coding | 1:22271131-22273367 | -18.3224 | 1339 | 1369 | 113 | 85 | galactinol synthase 7predicted to encode a galactinol synthase. galactinol synthase 7 (GolS7);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); galactinol synthase 4 (TAIR:AT1G60470.1); Has 1127 Blast hits to 1126 proteins in 260 species: Archae - 0; Bacteria - 80; Metazoa - 260; Fungi - 247; Plants - 417; Viruses - 63; Other Eukaryotes - 60 (source: NCBI BLink). | |
| XLOC_014170 | AT3G17185.1 | Ch3:5861491-5862437 | AT2G27402.1 | protein_coding | 2:11722770-11724400 | -18.3215 | 4 | 53 | 90 | 21 | plastid transcriptionally active 18 (TAIR:AT2G32180.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G26730.1 | protein_coding | 3:9823524-9827547 | -18.3139 | 154 | 175 | 205 | 176 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841); Has 5292 Blast hits to 2238 proteins in 281 species: Archae - 3; Bacteria - 121; Metazoa - 1602; Fungi - 487; Plants - 437; Viruses - 6; Other Eukaryotes - 2636 (source: NCBI BLink). | |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT2G42700.2 | protein_coding | 2:17778130-17782188 | -18.313 | 797 | 817 | 2199 | 2179 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: vesicle-mediated transport, vesicle docking involved in exocytosis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G39220.1 | protein_coding | 2:16374881-16377168 | -18.3115 | 77 | 116 | 1663 | 1625 | PATATIN-like protein 6PATATIN-like protein 6 (PLP6);FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Patatin (InterPro:IPR002641); patatin-like protein 6 (TAIR:AT3G54950.1); Has 1294 Blast hits to 1292 proteins in 232 species: Archae - 0; Bacteria - 327; Metazoa - 139; Fungi - 43; Plants - 635; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). | |
| XLOC_020972 | AT4G07665.1 | Ch4:13413395-13413697 | AT2G43970.1 | protein_coding | 2:18205235-18208218 | -18.3102 | 12 | 39 | 1913 | 1875 | RNA-binding protein RNA-binding protein;FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344); RNA-binding protein (TAIR:AT3G19090.1); Has 5436 Blast hits to 4197 proteins in 373 species: Archae - 4; Bacteria - 353; Metazoa - 1802; Fungi - 477; Plants - 426; Viruses - 18; Other Eukaryotes - 2356 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT4G17640.1 | protein_coding | 4:9825145-9827357 | -18.2904 | 338 | 360 | 267 | 247 | casein kinase II beta chain 2 Encodes casein kinase II beta (regulatory) subunit.casein kinase II beta chain 2 (CKB2);FUNCTIONS IN: protein kinase regulator activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: protein kinase CK2 complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Casein kinase II, regulatory subunit, alpha-helical (InterPro:IPR016149), Casein kinase II, regulatory subunit, beta-sheet (InterPro:IPR016150), Casein kinase II, regulatory subunit (InterPro:IPR000704); casein kinase II beta chain 1 (TAIR:AT5G47080.1); Has 1087 Blast hits to 1085 proteins in 223 species: Archae - 0; Bacteria - 0; Metazoa - 424; Fungi - 286; Plants - 156; Viruses - 0; Other Eukaryotes - 221 (source: NCBI BLink). | |
| XLOC_026203 | AT5G43725.2 | Ch5:17559541-17560062 | AT5G66950.1 | protein_coding | 5:26732795-26736175 | -18.289 | 494 | 519 | 2468 | 2443 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); Pyridoxal phosphate (PLP)-dependent transferases superfamily protein (TAIR:AT2G23520.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G43220.1 | protein_coding | 3:15196812-15203139 | -18.2803 | 2948 | 2976 | 41 | 11 | Phosphoinositide phosphatase family protein Phosphoinositide phosphatase family protein;CONTAINS InterPro DOMAIN/s: Synaptojanin, N-terminal (InterPro:IPR002013); Phosphoinositide phosphatase family protein (TAIR:AT5G20840.1); Has 2131 Blast hits to 1660 proteins in 229 species: Archae - 0; Bacteria - 0; Metazoa - 800; Fungi - 658; Plants - 325; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G66558.1 | lncRNA | 5:26563964-26566847 | -18.2776 | 13 | 58 | 2444 | 2395 | other RNA Potential natural antisense gene, locus overlaps with AT5G66560 | |
| XLOC_019365 | AT3G63445.6 | Ch3:23422590-23425169 | AT3G05990.1 | protein_coding | 3:1796839-1800082 | -18.2637 | 29 | 72 | 193 | 157 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); Leucine-rich repeat (LRR) family protein (TAIR:AT3G19230.1); Has 48781 Blast hits to 12236 proteins in 453 species: Archae - 4; Bacteria - 457; Metazoa - 323; Fungi - 23; Plants - 45747; Viruses - 0; Other Eukaryotes - 2227 (source: NCBI BLink). | |
| XLOC_009708 | AT2G31585.2 | Ch2:13446002-13446729 | AT4G32530.2 | protein_coding | 4:15693114-15695283 | -18.2632 | 2 | 47 | 162 | 119 | ATPase, F0/V0 complex, subunit C protein ATPase, F0/V0 complex, subunit C protein;FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); ATPase, F0/V0 complex, subunit C protein (TAIR:AT2G25610.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G26030.1 | protein_coding | 3:9516953-9519563 | -18.2624 | 671 | 693 | 63 | 41 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta protein phosphatase 2A regulatory subunit isoform B' delta serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta (ATB' DELTA);FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: nucleolus, protein phosphatase type 2A complex, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT3G26020.2); Has 1183 Blast hits to 1155 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 568; Fungi - 166; Plants - 302; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G03740.1 | protein_coding | 3:936878-941670 | -18.2387 | 101 | 135 | 1304 | 1270 | BTB-POZ and MATH domain 4 Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). BTB-POZ and MATH domain 4 (BPM4);CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BTB-POZ and MATH domain 5 (TAIR:AT5G21010.1); Has 5789 Blast hits to 5682 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 3860; Fungi - 138; Plants - 1466; Viruses - 48; Other Eukaryotes - 277 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.3 | Ch5:16534231-16535279 | AT4G34390.1 | protein_coding | 4:16441086-16445017 | -18.2383 | 323 | 367 | 81 | 35 | extra-large GTP-binding protein 2extra-large GTP-binding protein 2 (XLG2);FUNCTIONS IN: guanyl nucleotide binding, signal transducer activity; INVOLVED IN: in 7 processes; LOCATED IN: nucleus; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Guanine nucleotide binding protein (G-protein), alpha subunit (InterPro:IPR001019), G protein alpha subunit, helical insertion (InterPro:IPR011025); extra-large G-protein 1 (TAIR:AT2G23460.1); Has 3202 Blast hits to 3201 proteins in 381 species: Archae - 0; Bacteria - 2; Metazoa - 2082; Fungi - 561; Plants - 350; Viruses - 0; Other Eukaryotes - 207 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT4G35150.1 | protein_coding | 4:16726948-16728531 | -18.2366 | 3523 | 3570 | 206 | 165 | O-methyltransferase family protein O-methyltransferase family protein;FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol;CONTAINS InterPro DOMAIN/s: Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); O-methyltransferase family protein (TAIR:AT4G35160.1); Has 3235 Blast hits to 3226 proteins in 556 species: Archae - 1; Bacteria - 875; Metazoa - 109; Fungi - 661; Plants - 1500; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G12680.1 | protein_coding | 3:4025076-4029140 | -18.2361 | 661 | 693 | 1467 | 1432 | floral homeotic protein (HUA1) Member of the floral homeotic AGAMOUS pathway. ENHANCER OF AG-4 1 (HUA1);CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT2G47850.3); Has 2136 Blast hits to 795 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 325; Fungi - 89; Plants - 1572; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT3G51640.1 | protein_coding | 3:19153734-19157394 | -18.1982 | 39 | 84 | 1433 | 1386 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G51650.1); Has 26208 Blast hits to 14155 proteins in 1229 species: Archae - 43; Bacteria - 3230; Metazoa - 9456; Fungi - 2551; Plants - 1160; Viruses - 177; Other Eukaryotes - 9591 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G25790.1 | protein_coding | 5:8977057-8979296 | -18.1938 | 1345 | 1366 | 22 | 1 | Tesmin/TSO1-like CXC domain-containing proteinTesmin/TSO1-like CXC domain-containing protein;CONTAINS InterPro DOMAIN/s: Tesmin/TSO1-like, CXC (InterPro:IPR005172); Tesmin/TSO1-like CXC domain-containing protein (TAIR:AT4G29000.1); Has 1028 Blast hits to 690 proteins in 92 species: Archae - 0; Bacteria - 3; Metazoa - 316; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 383 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT2G31650.1 | protein_coding | 2:13455272-13462431 | -18.1912 | 180 | 212 | 429 | 387 | homologue of trithorax Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Involved in trimethylating histone H3-lysine 4. Involved in the formation, placement, and identity of flower organs. Role in regulation of homeotic genes.FUNCTIONS as a receptor of phosphatidylinositol 5-phosphate. Localizes to cytoplasm, plasma membrane and nuclei, shifting to nuclei in the presence of PI5P. homologue of trithorax (ATX1);CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), FY-rich, C-terminal (InterPro:IPR003889), Post-SET domain (InterPro:IPR003616), FY-rich, N-terminal (InterPro:IPR003888), Protein kinase C-like, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Lamin-B receptor of TUDOR domain (InterPro:IPR019023), FY-rich, C-terminal subgroup (InterPro:IPR018516), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), PWWP (InterPro:IPR000313), FY-rich, N-terminal subgroup (InterPro:IPR018518), Zinc finger, PHD-finger (InterPro:IPR019787); trithorax-like protein 2 (TAIR:AT1G05830.2); Has 7192 Blast hits to 6948 proteins in 474 species: Archae - 2; Bacteria - 393; Metazoa - 3480; Fungi - 840; Plants - 1251; Viruses - 0; Other Eukaryotes - 1226 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G17530.1 | protein_coding | 2:7626325-7629149 | -18.1889 | 1325 | 1366 | 837 | 795 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G35500.1); Has 35193 Blast hits to 29796 proteins in 1150 species: Archae - 6; Bacteria - 2278; Metazoa - 14147; Fungi - 6480; Plants - 5417; Viruses - 63; Other Eukaryotes - 6802 (source: NCBI BLink). | |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT4G23050.2 | protein_coding | 4:12079859-12084362 | -18.1866 | 1052 | 1083 | 267 | 231 | PAS domain-containing protein tyrosine kinase family protein PAS domain-containing protein tyrosine kinase family protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity, signal transducer activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), Protein kinase, ATP binding site (InterPro:IPR017441), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719); PAS domain-containing protein tyrosine kinase family protein (TAIR:AT5G49470.3); Has 125163 Blast hits to 123569 proteins in 4990 species: Archae - 182; Bacteria - 13357; Metazoa - 47772; Fungi - 11074; Plants - 33184; Viruses - 511; Other Eukaryotes - 19083 (source: NCBI BLink). | |
| XLOC_006987 | AT1G60525.3 | Ch1:22299435-22301441 | AT1G48960.1 | protein_coding | 1:18112458-18113733 | -18.1812 | 612 | 676 | 131 | 70 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT2G03720.1); Has 185 Blast hits to 185 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013289 | AT3G01095.1 | Ch3:388198-388460 | AT1G29570.1 | protein_coding | 1:10335910-10337854 | -18.1782 | 161 | 204 | 616 | 575 | Zinc finger C-x8-C-x5-C-x3-H type family protein Zinc finger C-x8-C-x5-C-x3-H type family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT1G29560.1); Has 39749 Blast hits to 19330 proteins in 1306 species: Archae - 56; Bacteria - 4885; Metazoa - 16078; Fungi - 3100; Plants - 2094; Viruses - 196; Other Eukaryotes - 13340 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G55880.1 | protein_coding | 1:20898793-20901247 | -18.1761 | 238 | 272 | 166 | 130 | Pyridoxal-5'-phosphate-dependent enzyme family proteinPyridoxal-5'-phosphate-dependent enzyme family protein;FUNCTIONS IN: lyase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: cysteine biosynthetic process from serine, metabolic process, cellular amino acid metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Cysteine synthase/cystathionine beta-synthase P-phosphate-binding site (InterPro:IPR001216), Pyridoxal phosphate-dependent enzyme, beta subunit (InterPro:IPR001926); L-cysteine desulfhydrase 1 (TAIR:AT5G28030.1); Has 17388 Blast hits to 17372 proteins in 2648 species: Archae - 443; Bacteria - 11523; Metazoa - 365; Fungi - 537; Plants - 503; Viruses - 2; Other Eukaryotes - 4015 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G01580.1 | protein_coding | 1:208995-213082 | -18.1751 | 2613 | 2632 | 916 | 897 | ferric reduction oxidase 2 Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1.ferric reduction oxidase 2 (FRO2);CONTAINS InterPro DOMAIN/s: Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Ferric reductase, NAD binding (InterPro:IPR013121), FAD-binding 8 (InterPro:IPR013112), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Ferric reductase-like transmembrane component, N-terminal (InterPro:IPR013130); ferric reduction oxidase 1 (TAIR:AT1G01590.1); Has 2711 Blast hits to 2707 proteins in 388 species: Archae - 5; Bacteria - 307; Metazoa - 560; Fungi - 1180; Plants - 483; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G63057.1 | protein_coding | 1:23379665-23383179 | -18.1562 | 3556 | 3572 | 194 | 178 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G63055.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT5G48620.1 | protein_coding | 5:19716104-19721477 | -18.1488 | 26 | 62 | 3193 | 3151 | Disease resistance protein (CC-NBS-LRR class) family Disease resistance protein (CC-NBS-LRR class) family;FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance protein (InterPro:IPR000767); Disease resistance protein (CC-NBS-LRR class) family (TAIR:AT5G43470.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT1G74860.1 | protein_coding | 1:28123301-28126076 | -18.1394 | 1351 | 1387 | 1194 | 1151 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G19010.1); Has 210 Blast hits to 193 proteins in 61 species: Archae - 0; Bacteria - 9; Metazoa - 75; Fungi - 18; Plants - 58; Viruses - 1; Other Eukaryotes - 49 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT3G45850.1 | protein_coding | 3:16855500-16861529 | -18.1374 | 45 | 82 | 78 | 46 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Kinesin, motor region, conserved site (InterPro:IPR019821), Kinesin, motor domain (InterPro:IPR001752); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT2G28620.1); Has 65646 Blast hits to 44270 proteins in 2280 species: Archae - 809; Bacteria - 9619; Metazoa - 29444; Fungi - 5953; Plants - 4409; Viruses - 140; Other Eukaryotes - 15272 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G29990.1 | protein_coding | 2:12793320-12796085 | -18.1333 | 604 | 648 | 358 | 319 | alternative NAD(P)H dehydrogenase 2 alternative NAD(P)H dehydrogenase 2 (NDA2);FUNCTIONS IN: NADH dehydrogenase activity, oxidoreductase activity, FAD binding; INVOLVED IN: oxidation reduction; LOCATED IN: intrinsic to mitochondrial inner membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); alternative NAD(P)H dehydrogenase 1 (TAIR:AT1G07180.1); Has 11797 Blast hits to 11597 proteins in 2273 species: Archae - 301; Bacteria - 9312; Metazoa - 49; Fungi - 695; Plants - 411; Viruses - 0; Other Eukaryotes - 1029 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G50910.1 | protein_coding | 3:18919327-18922301 | -18.1323 | 236 | 275 | 1522 | 1481 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G66480.1); Has 76 Blast hits to 75 proteins in 28 species: Archae - 0; Bacteria - 10; Metazoa - 7; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G62330.1 | protein_coding | 3:23062639-23065796 | -18.1301 | 75 | 99 | 1109 | 1085 | Zinc knuckle (CCHC-type) family protein Zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); Has 1256 Blast hits to 1123 proteins in 138 species: Archae - 0; Bacteria - 13; Metazoa - 788; Fungi - 82; Plants - 113; Viruses - 7; Other Eukaryotes - 253 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G73240.1 | protein_coding | 1:27542147-27544920 | -18.1301 | 673 | 698 | 350 | 327 | CONTAINS InterPro DOMAIN/s: Nucleoporin protein Ndc1-Nup (InterPro:IPR019049); Has 36 Blast hits to 36 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G43160.3 | protein_coding | 2:17947800-17953669 | -18.123 | 633 | 673 | 158 | 122 | ENTH/VHS family protein ENTH/VHS family protein;FUNCTIONS IN: binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Epsin, N-terminal (InterPro:IPR001026), Epsin-like, N-terminal (InterPro:IPR013809), ENTH/VHS (InterPro:IPR008942); ENTH/VHS family protein (TAIR:AT3G59290.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G51720.1 | protein_coding | 3:19184926-19186660 | -18.1207 | 42 | 79 | 1272 | 1238 | Plant protein ofunknown function (DUF827) Plant protein ofunknown function (DUF827);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF827, plant (InterPro:IPR008545); Plant protein ofunknown function (DUF827) (TAIR:AT2G38370.1); Has 6489 Blast hits to 5290 proteins in 766 species: Archae - 144; Bacteria - 987; Metazoa - 2963; Fungi - 406; Plants - 677; Viruses - 9; Other Eukaryotes - 1303 (source: NCBI BLink). | |
| XLOC_017691 | AT3G04775.1 | Ch3:8979070-8979756 | AT2G24120.1 | protein_coding | 2:10248851-10254641 | -18.1184 | 569 | 614 | 295 | 257 | DNA/RNA polymerases superfamily protein SCABRA 3 (SCA3);FUNCTIONS IN: DNA-directed RNA polymerase activity, protein binding, DNA binding; INVOLVED IN: transcription; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); male gametophyte defective 3 (TAIR:AT1G68990.1); Has 1315 Blast hits to 1296 proteins in 334 species: Archae - 0; Bacteria - 38; Metazoa - 134; Fungi - 224; Plants - 204; Viruses - 139; Other Eukaryotes - 576 (source: NCBI BLink). | |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G43590.1 | protein_coding | 3:15509527-15512574 | -18.1175 | 1078 | 1105 | 524 | 499 | zinc knuckle (CCHC-type) family protein zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); Zinc knuckle (CCHC-type) family protein (TAIR:AT3G43490.1); Has 22952 Blast hits to 17782 proteins in 462 species: Archae - 2; Bacteria - 65; Metazoa - 3265; Fungi - 1419; Plants - 1360; Viruses - 15440; Other Eukaryotes - 1401 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT1G31460.1 | protein_coding | 1:11261443-11263364 | -18.1058 | 773 | 805 | 939 | 906 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G23270.1); Has 1251 Blast hits to 756 proteins in 185 species: Archae - 0; Bacteria - 295; Metazoa - 374; Fungi - 176; Plants - 58; Viruses - 17; Other Eukaryotes - 331 (source: NCBI BLink). | |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT2G15730.1 | protein_coding | 2:6849452-6852214 | -18.0994 | 1013 | 1041 | 228 | 200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein; P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT4G34420.1); Has 149 Blast hits to 147 proteins in 26 species: Archae - 0; Bacteria - 31; Metazoa - 0; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT1G51980.1 | protein_coding | 1:19323055-19326918 | -18.096 | 756 | 798 | 112 | 56 | Insulinase (Peptidase family M16) proteinInsulinase (Peptidase family M16) protein;FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); mitochondrial processing peptidase alpha subunit (TAIR:AT3G16480.1); Has 6114 Blast hits to 5997 proteins in 1482 species: Archae - 10; Bacteria - 3458; Metazoa - 684; Fungi - 568; Plants - 250; Viruses - 3; Other Eukaryotes - 1141 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G30880.1 | protein_coding | 2:13142665-13146060 | -18.0928 | 672 | 693 | 57 | 36 | Pleckstrin homology (PH) domain-containing protein Pleckstrin homology (PH) domain-containing protein;FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: plant-type cell wall; EXPRESSED IN: stem;CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); Has 8327 Blast hits to 6951 proteins in 819 species: Archae - 67; Bacteria - 1101; Metazoa - 4180; Fungi - 797; Plants - 557; Viruses - 16; Other Eukaryotes - 1609 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G06450.1 | protein_coding | 1:1965840-1967219 | -18.0905 | 1960 | 1985 | 462 | 434 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein Polynucleotidyl transferase, ribonuclease H-like superfamily protein;FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, ribonuclease H fold (InterPro:IPR012337); Polynucleotidyl transferase, ribonuclease H-like superfamily protein (TAIR:AT3G44240.1); Has 884 Blast hits to 883 proteins in 223 species: Archae - 0; Bacteria - 0; Metazoa - 252; Fungi - 148; Plants - 363; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G28610.2 | protein_coding | 1:10053443-10055881 | -18.0901 | 2196 | 2216 | 1354 | 1334 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT2G27360.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G61920.1 | protein_coding | 1:22888452-22889037 | -18.0835 | 1103 | 1149 | 153 | 111 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT1G80950.1 | protein_coding | 1:30412149-30415264 | -18.0794 | 15 | 46 | 517 | 485 | Phospholipid/glycerol acyltransferase family protein Phospholipid/glycerol acyltransferase family protein;FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); calcineurin B subunit-related (TAIR:AT2G45670.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G67890.1 | protein_coding | 1:25457033-25462847 | -18.079 | 2201 | 2217 | 2718 | 2702 | PAS domain-containing protein tyrosine kinase family protein PAS domain-containing protein tyrosine kinase family protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Serine/threonine-protein kinase domain (InterPro:IPR002290), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); PAS domain-containing protein tyrosine kinase family protein (TAIR:AT5G49470.3); Has 128751 Blast hits to 126912 proteins in 4876 species: Archae - 309; Bacteria - 16105; Metazoa - 47584; Fungi - 11405; Plants - 33369; Viruses - 523; Other Eukaryotes - 19456 (source: NCBI BLink). | |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT1G22882.1 | protein_coding | 1:8098392-8101464 | -18.0748 | 124 | 151 | 1971 | 1933 | Galactose-binding proteinGalactose-binding protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion;CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919), Galactose-binding domain-like (InterPro:IPR008979); Galactose-binding protein (TAIR:AT1G71360.1); Has 2190 Blast hits to 1928 proteins in 337 species: Archae - 60; Bacteria - 185; Metazoa - 803; Fungi - 277; Plants - 164; Viruses - 19; Other Eukaryotes - 682 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.1 | Ch1:7908568-7909708 | AT1G72390.1 | protein_coding | 1:27245082-27251672 | -18.0684 | 489 | 511 | 3705 | 3683 | CONTAINS InterPro DOMAIN/s: Spt20 family (InterPro:IPR021950); Has 8778 Blast hits to 7244 proteins in 477 species: Archae - 6; Bacteria - 326; Metazoa - 4198; Fungi - 1506; Plants - 923; Viruses - 22; Other Eukaryotes - 1797 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G22240.1 | protein_coding | 3:7863606-7864895 | -18.0582 | 1479 | 1510 | 120 | 90 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G22235.2); Has 177 Blast hits to 177 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 177; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT4G17570.2 | protein_coding | 4:9783782-9787528 | -18.0523 | 1211 | 1256 | 42 | 9 | GATA transcription factor 26 Encodes a member of the GATA factor family of zinc finger transcription factors. GATA transcription factor 26 (GATA26);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, GATA-type (InterPro:IPR000679); GATA transcription factor 27 (TAIR:AT5G47140.1). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G08500.1 | protein_coding | 4:5403671-5407320 | -18.0453 | 2684 | 2711 | 76 | 38 | MAPK/ERK kinase kinase 1Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. MAPK/ERK kinase kinase 1 (MEKK1);FUNCTIONS IN: protein binding, kinase binding, DNA binding, MAP kinase kinase kinase activity, kinase activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); mitogen-activated protein kinase kinase kinase 9 (TAIR:AT4G08480.1); Has 132336 Blast hits to 130259 proteins in 4567 species: Archae - 142; Bacteria - 14700; Metazoa - 49430; Fungi - 12971; Plants - 32949; Viruses - 685; Other Eukaryotes - 21459 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G04940.1 | protein_coding | 5:1454131-1457141 | -18.0436 | 522 | 549 | 52 | 15 | SU(VAR)3-9 homolog 1 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SU(VAR)3-9 homolog 1 (SUVH1);CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214), SRA-YDG (InterPro:IPR003105), Pre-SET zinc-binding sub-group (InterPro:IPR003606), Post-SET domain (InterPro:IPR003616), Pre-SET domain (InterPro:IPR007728); SU(VAR)3-9 homolog 3 (TAIR:AT1G73100.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G22450.1 | protein_coding | 5:7436905-7443463 | -18.0325 | 50 | 73 | 2408 | 2385 | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G19390.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_021635 | AT4G09605.1 | Ch4:17706331-17707283 | AT3G20660.1 | protein_coding | 3:7225037-7228797 | -18.0295 | 454 | 515 | 1670 | 1615 | organic cation/carnitine transporter4 organic cation/carnitine transporter4 (4-Oct);FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: chloroplast thylakoid membrane, membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily (InterPro:IPR020846), General substrate transporter (InterPro:IPR005828), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); pseudogene (TAIR:AT1G73220.1); Has 27723 Blast hits to 27519 proteins in 2032 species: Archae - 544; Bacteria - 15020; Metazoa - 4940; Fungi - 4480; Plants - 1745; Viruses - 0; Other Eukaryotes - 994 (source: NCBI BLink). | |
| XLOC_008692 | AT2G13665.2 | Ch2:5692090-5693030 | AT3G25210.1 | protein_coding | 3:9180244-9181955 | -18.0241 | 555 | 586 | 150 | 112 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G27800.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT1G79350.1 | protein_coding | 1:29844621-29853466 | -18.0221 | 1026 | 1063 | 722 | 679 | RING/FYVE/PHD zinc finger superfamily protein embryo defective 1135 (EMB1135);FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent, embryo development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); Has 4247 Blast hits to 3784 proteins in 326 species: Archae - 2; Bacteria - 520; Metazoa - 2572; Fungi - 347; Plants - 469; Viruses - 36; Other Eukaryotes - 301 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G77850.1 | protein_coding | 1:29272074-29275507 | -17.9977 | 971 | 996 | 68 | 39 | auxin response factor 17 Posttranscriptionally regulated by miR160 and is essential for proper development.Regulates early auxin response genes. auxin response factor 17 (ARF17);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: anatomical structure morphogenesis, auxin mediated signaling pathway, adventitious root development, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340), Auxin response factor (InterPro:IPR010525); auxin response factor 16 (TAIR:AT4G30080.1); Has 1238 Blast hits to 1221 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1226; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G64630.1 | protein_coding | 1:24019490-24022310 | -17.9928 | 971 | 995 | 394 | 370 | with no lysine (K) kinase 10 with no lysine (K) kinase 10 (WNK10);FUNCTIONS IN: kinase activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); with no lysine (K) kinase 8 (TAIR:AT5G41990.1); Has 106075 Blast hits to 105172 proteins in 3001 species: Archae - 77; Bacteria - 10484; Metazoa - 38155; Fungi - 10128; Plants - 29410; Viruses - 406; Other Eukaryotes - 17415 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G71500.1 | protein_coding | 1:26935982-26937607 | -17.9915 | 3394 | 3434 | 173 | 122 | Rieske (2Fe-2S) domain-containing proteinRieske (2Fe-2S) domain-containing protein;FUNCTIONS IN: oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941); Has 295 Blast hits to 295 proteins in 102 species: Archae - 0; Bacteria - 166; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G74500.1 | protein_coding | 1:27997919-27998821 | -17.9915 | 3542 | 3580 | 57 | 11 | activation-tagged BRI1(brassinosteroid-insensitive 1)-suppressor 1 Encodes a basic helix?loop?helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane. activation-tagged BRI1(brassinosteroid-insensitive 1)-suppressor 1 (BS1);CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BANQUO 3 (TAIR:AT3G47710.1); Has 97 Blast hits to 97 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013289 | AT3G01095.1 | Ch3:388198-388460 | AT1G57800.1 | protein_coding | 1:21408623-21412283 | -17.9905 | 148 | 177 | 1843 | 1814 | zinc finger (C3HC4-type RING finger) family proteinpredicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene.VARIANT IN METHYLATION 5 (VIM5);FUNCTIONS IN: zinc ion binding; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: SRA-YDG (InterPro:IPR003105), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G57820.1); Has 5254 Blast hits to 5127 proteins in 1563 species: Archae - 0; Bacteria - 14; Metazoa - 4362; Fungi - 258; Plants - 447; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). | |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT5G58130.1 | protein_coding | 5:23521049-23523818 | -17.985 | 499 | 548 | 2178 | 2111 | RNA-binding (RRM/RBD/RNP motifs) family protein Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation. REPRESSOR OF SILENCING 3 (ROS3);CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 14321 Blast hits to 7664 proteins in 903 species: Archae - 313; Bacteria - 6242; Metazoa - 2615; Fungi - 1429; Plants - 503; Viruses - 131; Other Eukaryotes - 3088 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT3G02810.1 | protein_coding | 3:608437-611139 | -17.9741 | 154 | 183 | 1720 | 1680 | Protein kinase superfamily protein Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G16500.1); Has 153092 Blast hits to 133237 proteins in 4793 species: Archae - 164; Bacteria - 24814; Metazoa - 52285; Fungi - 12626; Plants - 34968; Viruses - 826; Other Eukaryotes - 27409 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G41680.1 | protein_coding | 2:17376155-17379059 | -17.9673 | 673 | 694 | 259 | 238 | NADPH-dependent thioredoxin reductase C Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. NADPH-dependent thioredoxin reductase C (NTRC);FUNCTIONS IN: thioredoxin-disulfide reductase activity; INVOLVED IN: hydrogen peroxide catabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pyridine nucleotide-disulphide oxidoreductase, class-II (InterPro:IPR000103), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Thioredoxin fold (InterPro:IPR012335), Thioredoxin reductase (InterPro:IPR005982), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Pyridine nucleotide-disulphide oxidoreductase, class-II, active site (InterPro:IPR008255), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); NADPH-dependent thioredoxin reductase A (TAIR:AT2G17420.1); Has 36111 Blast hits to 36072 proteins in 3191 species: Archae - 926; Bacteria - 24476; Metazoa - 1051; Fungi - 742; Plants - 985; Viruses - 7; Other Eukaryotes - 7924 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT5G08000.1 | protein_coding | 5:2563366-2565547 | -17.9667 | 3120 | 3142 | 56 | 35 | glucan endo-1,3-beta-glucosidase-like protein 3 Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. "glucan endo-1,3-beta-glucosidase-like protein 3" (E13L3);FUNCTIONS IN: callose binding, polysaccharide binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasmodesma, anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); plasmodesmata callose-binding protein 1 (TAIR:AT5G61130.1); Has 1582 Blast hits to 1532 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 10; Fungi - 147; Plants - 1404; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT2G29480.1 | protein_coding | 2:12630198-12631321 | -17.9661 | 2201 | 2228 | 84 | 56 | glutathione S-transferase tau 2 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). glutathione S-transferase tau 2 (GSTU2);CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); glutathione S-transferase TAU 1 (TAIR:AT2G29490.1); Has 8866 Blast hits to 8848 proteins in 1276 species: Archae - 0; Bacteria - 4843; Metazoa - 860; Fungi - 165; Plants - 2104; Viruses - 0; Other Eukaryotes - 894 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G54100.1 | protein_coding | 3:20033951-20038200 | -17.9605 | 2683 | 2745 | 54 | 5 | O-fucosyltransferase family protein O-fucosyltransferase family protein;CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); O-fucosyltransferase family protein (TAIR:AT2G37980.1); Has 847 Blast hits to 824 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 847; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_025053 | AT5G18255.1 | Ch5:6035619-6037641 | AT5G18636.1 | protein_coding | 5:6211111-6212372 | -17.9542 | 327 | 355 | 1016 | 988 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G25200.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G43930.4 | protein_coding | 5:17676795-17681100 | -17.9453 | 3666 | 3696 | 2813 | 2786 | Transducin family protein / WD-40 repeat family protein Transducin family protein / WD-40 repeat family protein;FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Transducin family protein / WD-40 repeat family protein (TAIR:AT1G04140.1). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G07721.1 | protein_coding | 2:3434312-3435279 | -17.9313 | 671 | 698 | 67 | 39 | unknown protein; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G29640.1 | protein_coding | 2:12671206-12673334 | -17.9312 | 228 | 252 | 914 | 890 | JOSEPHIN-like protein JOSEPHIN-like protein (JOSL);CONTAINS InterPro DOMAIN/s: Machado-Joseph disease protein MJD (InterPro:IPR006155); josephin protein-related (TAIR:AT1G07300.1); Has 526 Blast hits to 526 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 0; Plants - 101; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT1G49580.1 | protein_coding | 1:18351324-18354634 | -17.9073 | 2737 | 2760 | 81 | 58 | Calcium-dependent protein kinase (CDPK) family proteinCalcium-dependent protein kinase (CDPK) family protein;FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), EF-hand-like domain (InterPro:IPR011992), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); Protein kinase superfamily protein (TAIR:AT3G19100.1); Has 118201 Blast hits to 116445 proteins in 3162 species: Archae - 162; Bacteria - 14319; Metazoa - 43815; Fungi - 12645; Plants - 25821; Viruses - 463; Other Eukaryotes - 20976 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT1G78420.1 | protein_coding | 1:29504532-29507680 | -17.904 | 2292 | 2317 | 54 | 29 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT1G17145.1); Has 267 Blast hits to 267 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 154; Plants - 74; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT1G21250.1 | protein_coding | 1:7439171-7442113 | -17.898 | 26 | 52 | 229 | 200 | cell wall-associated kinasecell wall-associated kinase, may function as a signaling receptor of extracellular matrix component such as oligogalacturonides. cell wall-associated kinase (WAK1);FUNCTIONS IN: kinase activity; INVOLVED IN: cell surface receptor linked signaling pathway, response to virus, defense response to fungus, response to salicylic acid stimulus; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: EGF-like calcium-binding (InterPro:IPR001881), EGF-like, type 3 (InterPro:IPR000742), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-type aspartate/asparagine hydroxylation site (InterPro:IPR000152), EGF calcium-binding (InterPro:IPR013091), EGF-like (InterPro:IPR006210); wall associated kinase 3 (TAIR:AT1G21240.1); Has 130372 Blast hits to 120319 proteins in 4569 species: Archae - 123; Bacteria - 13482; Metazoa - 56283; Fungi - 9380; Plants - 33196; Viruses - 438; Other Eukaryotes - 17470 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT1G23850.1 | protein_coding | 1:8425724-8427235 | -17.8958 | 711 | 745 | 316 | 281 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G23840.1); Has 47 Blast hits to 40 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT5G63135.1 | protein_coding | 5:25324754-25326479 | -17.8875 | 108 | 146 | 48 | 10 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G42000.1 | protein_coding | 5:16799218-16801102 | -17.8869 | 2261 | 2308 | 211 | 175 | ORMDL family protein ORMDL family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); ORMDL family protein (TAIR:AT1G01230.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT1G80380.2 | protein_coding | 1:30217116-30220595 | -17.8855 | 2558 | 2584 | 329 | 301 | P-loop containing nucleoside triphosphate hydrolases superfamily proteinEncodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: glycerate kinase activity; INVOLVED IN: photorespiration; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083); Has 1396 Blast hits to 1392 proteins in 215 species: Archae - 0; Bacteria - 214; Metazoa - 0; Fungi - 146; Plants - 53; Viruses - 0; Other Eukaryotes - 983 (source: NCBI BLink). | |
| XLOC_009437 | AT2G26692.1 | Ch2:11350517-11351293 | AT3G12230.1 | protein_coding | 3:3899364-3901879 | -17.8834 | 293 | 322 | 966 | 939 | serine carboxypeptidase-like 14 serine carboxypeptidase-like 14 (scpl14);FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); serine carboxypeptidase-like 15 (TAIR:AT3G12240.1); Has 3660 Blast hits to 3566 proteins in 378 species: Archae - 0; Bacteria - 216; Metazoa - 635; Fungi - 834; Plants - 1566; Viruses - 0; Other Eukaryotes - 409 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT5G60820.1 | protein_coding | 5:24469561-24471208 | -17.8765 | 3 | 35 | 617 | 577 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT5G08139.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G77170.1 | protein_coding | 1:28998038-28999600 | -17.8765 | 236 | 293 | 1369 | 1308 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21065.1); Has 36578 Blast hits to 13720 proteins in 224 species: Archae - 0; Bacteria - 18; Metazoa - 87; Fungi - 88; Plants - 35844; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT1G73965.1 | protein_coding | 1:27815627-27816468 | -17.8738 | 1008 | 1025 | 93 | 76 | CLAVATA3/ESR-RELATED 13 Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. CLAVATA3/ESR-RELATED 13 (CLE13); CLAVATA3/ESR-RELATED 12 (TAIR:AT1G68795.1); Has 69 Blast hits to 69 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT3G03740.1 | protein_coding | 3:936878-941670 | -17.8683 | 2 | 26 | 1303 | 1280 | BTB-POZ and MATH domain 4 Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). BTB-POZ and MATH domain 4 (BPM4);CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BTB-POZ and MATH domain 5 (TAIR:AT5G21010.1); Has 5789 Blast hits to 5682 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 3860; Fungi - 138; Plants - 1466; Viruses - 48; Other Eukaryotes - 277 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.3 | Ch3:23422590-23425169 | AT1G52342.1 | protein_coding | 1:19491767-19493122 | -17.8606 | 39 | 81 | 321 | 287 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT3G28570.1 | protein_coding | 3:10710405-10712028 | -17.8569 | 14 | 58 | 378 | 341 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT3G28610.1); Has 20517 Blast hits to 19409 proteins in 2851 species: Archae - 1288; Bacteria - 6773; Metazoa - 3258; Fungi - 2817; Plants - 2531; Viruses - 34; Other Eukaryotes - 3816 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT5G62030.1 | protein_coding | 5:24918479-24920955 | -17.8402 | 276 | 293 | 255 | 238 | diphthamide synthesis DPH2 family proteindiphthamide synthesis DPH2 family protein;CONTAINS InterPro DOMAIN/s: Diphthamide synthesis, DHP1 (InterPro:IPR016435), Diphthamide synthesis, DPH1/DHP2 (InterPro:IPR002728); diphthamide synthesis DPH2 family protein (TAIR:AT3G59630.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G62090.1 | protein_coding | 5:24934962-24939239 | -17.8381 | 13 | 37 | 57 | 33 | SEUSS-like 2 SEUSS-like 2 (SLK2); SEUSS-like 1 (TAIR:AT4G25520.1); Has 38958 Blast hits to 16422 proteins in 905 species: Archae - 6; Bacteria - 1880; Metazoa - 14538; Fungi - 4050; Plants - 2632; Viruses - 363; Other Eukaryotes - 15489 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G40475.1 | protein_coding | 2:16906899-16908152 | -17.8357 | 971 | 997 | 686 | 657 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G56260.2); Has 477 Blast hits to 219 proteins in 41 species: Archae - 0; Bacteria - 4; Metazoa - 91; Fungi - 61; Plants - 144; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G34340.1 | protein_coding | 4:16426483-16428013 | -17.8284 | 1869 | 1910 | 902 | 853 | TBP-associated factor 8 TBP-associated factor 8 (TAF8);FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565), Transcription factor TFIID, subunit 8, C-terminal (InterPro:IPR019473); Bromodomain transcription factor (TAIR:AT5G15570.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G09360.1 | protein_coding | 3:2873412-2878591 | -17.8151 | 45 | 85 | 2010 | 1978 | Cyclin/Brf1-like TBP-binding protein Cyclin/Brf1-like TBP-binding protein;FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription regulator activity, transcription activator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, positive regulation of transcription, regulation of transcription, DNA-dependent, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Brf1-like TBP-binding (InterPro:IPR011665), Cyclin (InterPro:IPR006670); Cyclin/Brf1-like TBP-binding protein (TAIR:AT2G45100.1); Has 20615 Blast hits to 13314 proteins in 1023 species: Archae - 483; Bacteria - 1191; Metazoa - 7169; Fungi - 2226; Plants - 882; Viruses - 261; Other Eukaryotes - 8403 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G12770.1 | protein_coding | 4:7506330-7511626 | -17.8044 | 1854 | 1903 | 1797 | 1735 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: biological_processunknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Chaperone DnaJ-domain superfamily protein (TAIR:AT4G12780.1); Has 79558 Blast hits to 47178 proteins in 2717 species: Archae - 253; Bacteria - 22646; Metazoa - 24220; Fungi - 7704; Plants - 5305; Viruses - 398; Other Eukaryotes - 19032 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.3 | Ch3:23422590-23425169 | AT1G43770.2 | protein_coding | 1:16548417-16551909 | -17.8019 | 758 | 816 | 1727 | 1681 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT5G16680.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.2 | Ch1:9726607-9730185 | AT1G44160.1 | protein_coding | 1:16794820-16796450 | -17.7956 | 2595 | 2616 | 194 | 173 | HSP40/DnaJ peptide-binding protein HSP40/DnaJ peptide-binding protein;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ (InterPro:IPR003095); HSP40/DnaJ peptide-binding protein (TAIR:AT1G11040.1); Has 12682 Blast hits to 12678 proteins in 3092 species: Archae - 108; Bacteria - 7085; Metazoa - 1071; Fungi - 625; Plants - 733; Viruses - 2; Other Eukaryotes - 3058 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G39710.1 | protein_coding | 4:18426492-18428578 | -17.7819 | 138 | 171 | 144 | 115 | FK506-binding protein 16-2 FK506-binding protein 16-2 (FKBP16-2);FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); FK506-binding protein 13 (TAIR:AT5G45680.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT4G17950.1 | protein_coding | 4:9966720-9969232 | -17.7773 | 28 | 62 | 91 | 52 | AT hook motif DNA-binding family protein AT hook motif DNA-binding family protein;FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); AT hook motif DNA-binding family protein (TAIR:AT5G46640.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G20390.1 | protein_coding | 4:11006815-11008076 | -17.7753 | 1227 | 1291 | 639 | 590 | Uncharacterised protein family (UPF0497) Uncharacterised protein family (UPF0497);CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); Uncharacterised protein family (UPF0497) (TAIR:AT5G44550.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G19900.1 | protein_coding | 4:10789091-10791618 | -17.7715 | 24 | 66 | 1000 | 936 | alpha 1,4-glycosyltransferase family protein alpha 1,4-glycosyltransferase family protein;FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, Golgi stack; EXPRESSED IN: flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Alpha 1,4-glycosyltransferase conserved region (InterPro:IPR007652), Glycosyltransferase, DXD sugar-binding region (InterPro:IPR007577); alpha 1,4-glycosyltransferase family protein (TAIR:AT2G38152.1); Has 54113 Blast hits to 14510 proteins in 385 species: Archae - 4; Bacteria - 200; Metazoa - 877; Fungi - 767; Plants - 50641; Viruses - 0; Other Eukaryotes - 1624 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.6 | Ch3:19312062-19314685 | AT3G15970.1 | protein_coding | 3:5408792-5411153 | -17.7674 | 402 | 444 | 656 | 603 | NUP50 (Nucleoporin 50 kDa) protein NUP50 (Nucleoporin 50 kDa) protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: intracellular transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ran binding protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993), Nuclear pore complex, NUP2/50/61 (InterPro:IPR015007); NUP50 (Nucleoporin 50 kDa) protein (TAIR:AT1G52380.1); Has 4078 Blast hits to 2719 proteins in 441 species: Archae - 18; Bacteria - 1103; Metazoa - 1379; Fungi - 710; Plants - 228; Viruses - 8; Other Eukaryotes - 632 (source: NCBI BLink). | |
| XLOC_008251 | AT2G01422.1 | Ch2:183940-184734 | AT5G49440.1 | protein_coding | 5:20048239-20049776 | -17.7657 | 41 | 75 | 1203 | 1170 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G19670.1 | protein_coding | 4:10699189-10702174 | -17.7549 | 1371 | 1410 | 1414 | 1374 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841); zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G60250.1); Has 3330 Blast hits to 3305 proteins in 225 species: Archae - 1; Bacteria - 6; Metazoa - 1257; Fungi - 660; Plants - 920; Viruses - 0; Other Eukaryotes - 486 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT4G33520.2 | protein_coding | 4:16118830-16126151 | -17.7533 | 715 | 735 | 2523 | 2503 | P-type ATP-ase 1Encodes a putative metal-transporting P-type ATPase. P-type ATP-ase 1 (PAA1);FUNCTIONS IN: copper ion transmembrane transporter activity, ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: photosynthetic electron transport chain; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, P-type copper-transporter (InterPro:IPR001756), Heavy metal transport/detoxification protein (InterPro:IPR006121), ATPase, P type, cation/copper-transporter (InterPro:IPR006403), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), Heavy-metal-associated, conserved site (InterPro:IPR017969), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type, heavy metal translocating (InterPro:IPR006416), ATPase, P-type phosphorylation site (InterPro:IPR018303); P-type ATPase of Arabidopsis 2 (TAIR:AT5G21930.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT1G02110.1 | protein_coding | 1:392831-395528 | -17.7469 | 29 | 53 | 108 | 78 | Protein ofunknown function (DUF630 and DUF632) Protein ofunknown function (DUF630 and DUF632);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF630 (InterPro:IPR006868), Protein ofunknown function DUF632 (InterPro:IPR006867); Protein ofunknown function (DUF630 and DUF632) (TAIR:AT3G60320.1); Has 861 Blast hits to 735 proteins in 117 species: Archae - 0; Bacteria - 21; Metazoa - 78; Fungi - 83; Plants - 611; Viruses - 12; Other Eukaryotes - 56 (source: NCBI BLink). | |
| XLOC_021635 | AT4G09605.1 | Ch4:17706331-17707283 | AT3G03860.1 | protein_coding | 3:992074-994697 | -17.7456 | 359 | 383 | 1211 | 1187 | APR-like 5 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. APR-like 5 (APRL5); INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); APR-like 7 (TAIR:AT5G18120.1); Has 278 Blast hits to 278 proteins in 73 species: Archae - 0; Bacteria - 38; Metazoa - 82; Fungi - 10; Plants - 137; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G49540.1 | protein_coding | 3:18365678-18366666 | -17.7384 | 1960 | 1992 | 612 | 577 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_componentunknown; Has 9244 Blast hits to 5308 proteins in 962 species: Archae - 18; Bacteria - 2665; Metazoa - 1953; Fungi - 964; Plants - 333; Viruses - 74; Other Eukaryotes - 3237 (source: NCBI BLink). | |
| XLOC_025053 | AT5G18255.1 | Ch5:6035619-6037641 | AT5G28050.2 | protein_coding | 5:10043907-10046099 | -17.7361 | 597 | 651 | 64 | 9 | Cytidine/deoxycytidylate deaminase family proteinCytidine/deoxycytidylate deaminase family protein;FUNCTIONS IN: hydrolase activity, zinc ion binding, catalytic activity; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: APOBEC/CMP deaminase, zinc-binding (InterPro:IPR016192), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193); Cytidine/deoxycytidylate deaminase family protein (TAIR:AT3G05300.1); Has 7983 Blast hits to 7983 proteins in 2406 species: Archae - 71; Bacteria - 5581; Metazoa - 106; Fungi - 179; Plants - 275; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink). | |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT1G53190.1 | protein_coding | 1:19837110-19840370 | -17.735 | 816 | 835 | 90 | 71 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT3G15070.2); Has 8436 Blast hits to 8420 proteins in 276 species: Archae - 0; Bacteria - 0; Metazoa - 2403; Fungi - 639; Plants - 3969; Viruses - 29; Other Eukaryotes - 1396 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G39170.1 | protein_coding | 2:16334546-16336297 | -17.7279 | 233 | 251 | 719 | 701 | unknown protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function NEP (InterPro:IPR019320); Has 57 Blast hits to 57 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G18840.1 | protein_coding | 2:8158106-8160091 | -17.727 | 672 | 692 | 260 | 240 | Integral membrane Yip1 family protein Integral membrane Yip1 family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); Integral membrane Yip1 family protein (TAIR:AT4G30260.1); Has 825 Blast hits to 825 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 402; Fungi - 189; Plants - 114; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). | |
| XLOC_025116 | AT5G19221.2 | Ch5:6463964-6466349 | AT5G51260.1 | protein_coding | 5:20831984-20833817 | -17.7227 | 115 | 154 | 178 | 136 | HAD superfamily, subfamily IIIB acid phosphatase HAD superfamily, subfamily IIIB acid phosphatase ;FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); HAD superfamily, subfamily IIIB acid phosphatase (TAIR:AT4G25150.1); Has 906 Blast hits to 901 proteins in 278 species: Archae - 0; Bacteria - 491; Metazoa - 2; Fungi - 0; Plants - 366; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). | |
| XLOC_022116 | AT4G06701.5 | Ch4:3939266-3940749 | AT5G48520.1 | protein_coding | 5:19661203-19666436 | -17.7148 | 66 | 97 | 213 | 182 | Encodes AUGMIN subunit3 (AUG3), a homolog of animal dim gamma-tubulin 3/human augmin-like complex, subunit 3. Plays a critical role in microtubule organization during plant cell division.unknown protein; Has 609 Blast hits to 593 proteins in 129 species: Archae - 0; Bacteria - 41; Metazoa - 390; Fungi - 40; Plants - 64; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G11670.1 | protein_coding | 5:3754091-3758342 | -17.7095 | 514 | 541 | 2128 | 2097 | NADP-malic enzyme 2The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. NADP-malic enzyme 2 (NADP-ME2);FUNCTIONS IN: malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity, oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity; INVOLVED IN: response to cadmium ion, malate metabolic process, pentose-phosphate shunt, oxidative branch, protein homooligomerization; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Malic enzyme, NAD-binding (InterPro:IPR012302), Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding domain (InterPro:IPR016040); NADP-malic enzyme 3 (TAIR:AT5G25880.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G29260.1 | protein_coding | 4:14422152-14423603 | -17.7029 | 972 | 1005 | 252 | 224 | HAD superfamily, subfamily IIIB acid phosphatase HAD superfamily, subfamily IIIB acid phosphatase ;FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); HAD superfamily, subfamily IIIB acid phosphatase (TAIR:AT4G29270.1); Has 713 Blast hits to 710 proteins in 181 species: Archae - 0; Bacteria - 300; Metazoa - 2; Fungi - 0; Plants - 366; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G77480.1 | protein_coding | 1:29114449-29117344 | -17.6978 | 250 | 303 | 275 | 228 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); Eukaryotic aspartyl protease family protein (TAIR:AT1G44130.1); Has 1752 Blast hits to 1744 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 23; Plants - 1631; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G42960.1 | protein_coding | 5:17235092-17236679 | -17.6883 | 2286 | 2317 | 78 | 50 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G45170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G26990.1 | protein_coding | 2:11519388-11522616 | -17.6845 | 3373 | 3416 | 92 | 47 | proteasome family protein Represses photomorphogenesis and induces skotomorphogenesis in the dark. FUSCA 12 (FUS12); INVOLVED IN: cullin deneddylation, photomorphogenesis, protein catabolic process; LOCATED IN: signalosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Proteasome component (PCI) domain (InterPro:IPR000717), PCI/PINT associated module (InterPro:IPR013143); non-ATPase subunit 9 (TAIR:AT1G29150.1); Has 881 Blast hits to 877 proteins in 239 species: Archae - 2; Bacteria - 9; Metazoa - 323; Fungi - 235; Plants - 190; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.2 | Ch1:5222729-5224055 | AT5G26990.1 | protein_coding | 5:9490556-9493964 | -17.6839 | 51 | 80 | 40 | 16 | Drought-responsive family proteinDrought-responsive family protein;CONTAINS InterPro DOMAIN/s: Drought induced 19/ RING finger protein 114 (InterPro:IPR008598); Drought-responsive family protein (TAIR:AT3G05700.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G45190.2 | protein_coding | 5:18277080-18281909 | -17.6828 | 2299 | 2357 | 69 | 23 | Cyclin family proteinEncodes a cyclin T partner CYCT1;5. Plays important roles in infection with Cauliflower mosaic virus (CaMV). Cyclin family protein;FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: in 6 processes; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Cyclin-related (InterPro:IPR013763), Transcription regulator cyclin (InterPro:IPR015429), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); Cyclin family protein (TAIR:AT4G19600.1); Has 4079 Blast hits to 3698 proteins in 345 species: Archae - 2; Bacteria - 149; Metazoa - 1860; Fungi - 545; Plants - 474; Viruses - 8; Other Eukaryotes - 1041 (source: NCBI BLink). | |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT1G08550.1 | protein_coding | 1:2706868-2709988 | -17.6823 | 583 | 631 | 1435 | 1398 | non-photochemical quenching 1 Violaxanthin deepoxidase involved in xanthophyll cycle.Two major consequences of the npq1 mutation are the absence of zeaxanthin formation in strong light and the partial inhibition of the quenching of singlet excited chlorophylls in the photosystem II light-harvesting complex non-photochemical quenching 1 (NPQ1);FUNCTIONS IN: violaxanthin de-epoxidase activity; INVOLVED IN: fatty acid metabolic process, response to heat, chlorophyll metabolic process, xanthophyll metabolic process, xanthophyll cycle; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast photosystem II, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Lipocalin conserved site (InterPro:IPR022272), Calycin (InterPro:IPR012674), Violaxanthin de-epoxidase (InterPro:IPR010788), Calycin-like (InterPro:IPR011038); violaxanthin de-epoxidase-related (TAIR:AT2G21860.1); Has 258 Blast hits to 254 proteins in 55 species: Archae - 0; Bacteria - 9; Metazoa - 2; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G58080.1 | protein_coding | 1:21504314-21507679 | -17.6742 | 2605 | 2633 | 171 | 142 | ATP phosphoribosyl transferase 1 ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis ATP phosphoribosyl transferase 1 (ATP-PRT1);FUNCTIONS IN: ATP phosphoribosyltransferase activity; INVOLVED IN: histidine biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Histidine biosynthesis HisG: ATP phosphoribosyltransferase (InterPro:IPR001348), ATP phosphoribosyltransferase, conserved site (InterPro:IPR018198), ATP phosphoribosyltransferase, catalytic domain (InterPro:IPR013820), Histidine biosynthesis HisG, C-terminal (InterPro:IPR013115), Nitrogen regulatory PII-like, alpha/beta (InterPro:IPR011322); ATP phosphoribosyl transferase 2 (TAIR:AT1G09795.1); Has 6414 Blast hits to 6414 proteins in 2199 species: Archae - 208; Bacteria - 4137; Metazoa - 2; Fungi - 141; Plants - 73; Viruses - 0; Other Eukaryotes - 1853 (source: NCBI BLink). | |
| XLOC_016958 | AT3G02505.1 | Ch3:3960120-3960327 | AT1G73110.1 | protein_coding | 1:27494121-27496969 | -17.667 | 123 | 154 | 107 | 82 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: ATPase activity, ATP binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959); rubisco activase (TAIR:AT2G39730.1); Has 469 Blast hits to 469 proteins in 170 species: Archae - 27; Bacteria - 71; Metazoa - 17; Fungi - 60; Plants - 256; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G52250.1 | protein_coding | 5:21216772-21218351 | -17.6601 | 973 | 996 | 168 | 145 | Transducin/WD40 repeat-like superfamily protein Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response.FUNCTIONS as a repressor of UV-B signaling.Transducin/WD40 repeat-like superfamily protein;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT5G23730.1); Has 19305 Blast hits to 12811 proteins in 562 species: Archae - 16; Bacteria - 3753; Metazoa - 6674; Fungi - 4562; Plants - 2007; Viruses - 0; Other Eukaryotes - 2293 (source: NCBI BLink). | |
| XLOC_000578 | AT1G11175.1 | Ch1:3744858-3745655 | AT2G16880.1 | protein_coding | 2:7312051-7314576 | -17.658 | 348 | 385 | 420 | 388 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); rna processing factor 2 (TAIR:AT1G62670.1); Has 61418 Blast hits to 15263 proteins in 321 species: Archae - 6; Bacteria - 91; Metazoa - 1247; Fungi - 1283; Plants - 56613; Viruses - 0; Other Eukaryotes - 2178 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G24500.1 | protein_coding | 5:8367302-8368937 | -17.649 | 9 | 41 | 593 | 556 | unknown protein; Has 133 Blast hits to 129 proteins in 40 species: Archae - 2; Bacteria - 0; Metazoa - 60; Fungi - 5; Plants - 29; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G47830.1 | protein_coding | 2:19590816-19594014 | -17.6432 | 2050 | 2088 | 159 | 124 | Cation efflux family protein Cation efflux family protein;FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); Cation efflux family protein (TAIR:AT3G58060.1); Has 9484 Blast hits to 9472 proteins in 2416 species: Archae - 234; Bacteria - 7791; Metazoa - 296; Fungi - 408; Plants - 276; Viruses - 0; Other Eukaryotes - 479 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT2G01540.1 | protein_coding | 2:242041-243649 | -17.6326 | 597 | 622 | 834 | 803 | Calcium-dependent lipid-binding (CaLB domain) family protein Calcium-dependent lipid-binding (CaLB domain) family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); Calcium-dependent lipid-binding (CaLB domain) family protein (TAIR:AT1G70790.1); Has 3447 Blast hits to 2959 proteins in 238 species: Archae - 0; Bacteria - 0; Metazoa - 1768; Fungi - 600; Plants - 764; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT4G30240.1 | protein_coding | 4:14807889-14810075 | -17.632 | 2 | 34 | 133 | 107 | Syntaxin/t-SNARE family protein Syntaxin/t-SNARE family protein; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: endomembrane system, membrane;CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); Syntaxin/t-SNARE family protein (TAIR:AT2G18860.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT4G14720.1 | protein_coding | 4:8431973-8435105 | -17.6255 | 3 | 30 | 394 | 367 | TIFY domain/Divergent CCT motif family protein PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. TIFY domain/Divergent CCT motif family protein;CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), Acireductone dioxygenase, ARD (InterPro:IPR004313), CCT domain-like (InterPro:IPR018467); TIFY domain/Divergent CCT motif family protein (TAIR:AT4G14713.1); Has 315 Blast hits to 312 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 313; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT5G48420.1 | protein_coding | 5:19626362-19626790 | -17.6252 | 1437 | 1477 | 83 | 37 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G34630.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G26100.1 | protein_coding | 4:13227450-13230797 | -17.6233 | 1862 | 1881 | 39 | 19 | casein kinase 1 Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization. casein kinase 1 (CK1);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); casein kinase I-like 12 (TAIR:AT5G57015.1); Has 62578 Blast hits to 62222 proteins in 2324 species: Archae - 33; Bacteria - 9966; Metazoa - 23829; Fungi - 6469; Plants - 10923; Viruses - 370; Other Eukaryotes - 10988 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT2G30350.2 | protein_coding | 2:12934149-12935784 | -17.6195 | 3 | 31 | 989 | 960 | Excinuclease ABC, C subunit, N-terminal Excinuclease ABC, C subunit, N-terminal;FUNCTIONS IN: nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Excinuclease ABC, C subunit, N-terminal (InterPro:IPR000305); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_008343 | AT2G04405.1 | Ch2:849921-850780 | AT1G28060.1 | protein_coding | 1:9778851-9782907 | -17.6112 | 322 | 340 | 2190 | 2172 | Pre-mRNA-splicing factor 3 Pre-mRNA-splicing factor 3;CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); Pre-mRNA-splicing factor 3 (TAIR:AT3G55930.1); Has 22923 Blast hits to 12760 proteins in 707 species: Archae - 18; Bacteria - 1085; Metazoa - 11525; Fungi - 3053; Plants - 1999; Viruses - 93; Other Eukaryotes - 5150 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT3G56550.1 | protein_coding | 3:20951340-20954701 | -17.6105 | 35 | 62 | 1827 | 1801 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21065.1); Has 30639 Blast hits to 12981 proteins in 201 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 22; Plants - 30256; Viruses - 0; Other Eukaryotes - 323 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G27360.1 | protein_coding | 3:10129105-10129937 | -17.5994 | 55 | 81 | 501 | 477 | Histone superfamily protein Histone superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: chloroplast, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); Histone superfamily protein (TAIR:AT5G10400.1); Has 14605 Blast hits to 14597 proteins in 7244 species: Archae - 0; Bacteria - 0; Metazoa - 10605; Fungi - 2040; Plants - 1257; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.1 | Ch1:3895179-3896917 | AT5G55070.1 | protein_coding | 5:22347211-22351168 | -17.5824 | 4 | 26 | 866 | 833 | Dihydrolipoamide succinyltransferase Dihydrolipoamide succinyltransferase;FUNCTIONS IN: zinc ion binding, acyltransferase activity; INVOLVED IN: response to oxidative stress, metabolic process; LOCATED IN: cytosolic ribosome, mitochondrion; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); Dihydrolipoamide succinyltransferase (TAIR:AT4G26910.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G69080.1 | protein_coding | 1:25971915-25973505 | -17.5701 | 624 | 691 | 267 | 205 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to stress; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT2G03720.1); Has 185 Blast hits to 185 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G55960.1 | protein_coding | 3:20760419-20763056 | -17.5647 | 672 | 692 | 80 | 60 | Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinHaloacid dehalogenase-like hydrolase (HAD) superfamily protein;FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_processunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT1G29780.1); Has 2169 Blast hits to 2162 proteins in 238 species: Archae - 0; Bacteria - 0; Metazoa - 723; Fungi - 425; Plants - 384; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G24800.1 | protein_coding | 3:9055509-9058020 | -17.5581 | 2685 | 2711 | 134 | 105 | proteolysis 1 CONTAINS two ring finger domains and one ZZ domain. Week similarity to yeast Rad18p. Putative component of the N-end rule pathway (ubiquitin-dependent proteolysis). proteolysis 1 (PRT1);CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, ZZ-type (InterPro:IPR000433); zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G18660.1); Has 4154 Blast hits to 3358 proteins in 276 species: Archae - 0; Bacteria - 0; Metazoa - 2882; Fungi - 341; Plants - 509; Viruses - 3; Other Eukaryotes - 419 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G26640.1 | protein_coding | 3:9793179-9794874 | -17.5566 | 232 | 256 | 26 | 2 | Transducin/WD40 repeat-like superfamily protein Encodes LIGHT-REGULATED WD1 (LWD1), a clock proteins regulating circadian period length and photoperiodic flowering. LIGHT-REGULATED WD 2 (LWD2);CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT1G12910.1); Has 5639 Blast hits to 5196 proteins in 384 species: Archae - 6; Bacteria - 320; Metazoa - 2319; Fungi - 1389; Plants - 885; Viruses - 0; Other Eukaryotes - 720 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT2G05600.1 | protein_coding | 2:2072646-2073547 | -17.5542 | 322 | 343 | 232 | 208 | F-box associated ubiquitination effector family protein F-box associated ubiquitination effector family protein;CONTAINS InterPro DOMAIN/s: F-box associated domain, type 1 (InterPro:IPR006527); F-box family protein (TAIR:AT2G02030.1); Has 182 Blast hits to 173 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G72610.1 | protein_coding | 1:27339114-27340044 | -17.553 | 2762 | 2802 | 170 | 126 | germin-like protein 1 germin-like protein (GLP1) germin-like protein 1 (GER1); INVOLVED IN: biological_processunknown; LOCATED IN: extracellular matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), Germin (InterPro:IPR001929), RmlC-like jelly roll fold (InterPro:IPR014710), Germin, manganese binding site (InterPro:IPR019780); germin 3 (TAIR:AT5G20630.1); Has 1559 Blast hits to 1557 proteins in 130 species: Archae - 0; Bacteria - 82; Metazoa - 0; Fungi - 43; Plants - 1420; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | |
| XLOC_007872 | AT1G75295.1 | Ch1:28254820-28257236 | AT4G34100.1 | protein_coding | 4:16330366-16335247 | -17.5478 | 640 | 676 | 3404 | 3372 | RING/U-box superfamily protein Encodes a protein involved in cuticular wax biosynthesis. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, RING-CH-type (InterPro:IPR011016); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT4G32670.1); Has 2169 Blast hits to 1906 proteins in 224 species: Archae - 0; Bacteria - 0; Metazoa - 966; Fungi - 273; Plants - 550; Viruses - 44; Other Eukaryotes - 336 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G68740.1 | protein_coding | 1:25812449-25816983 | -17.5447 | 30 | 67 | 2515 | 2484 | EXS (ERD1/XPR1/SYG1) family proteinEncodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. PHO1;H1;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: cellular response to phosphate starvation, phosphate transport; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: EXS, C-terminal (InterPro:IPR004342), SPX, N-terminal (InterPro:IPR004331); phosphate 1 (TAIR:AT3G23430.1); Has 1136 Blast hits to 1082 proteins in 213 species: Archae - 2; Bacteria - 16; Metazoa - 271; Fungi - 358; Plants - 319; Viruses - 3; Other Eukaryotes - 167 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G22230.1 | protein_coding | 2:9449930-9451623 | -17.5361 | 2058 | 2084 | 125 | 100 | Thioesterase superfamily protein Thioesterase superfamily protein;FUNCTIONS IN: crotonoyl-[acyl-carrier-protein] hydratase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: defense response to fungus, incompatible interaction, fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); Thioesterase superfamily protein (TAIR:AT5G10160.1); Has 7405 Blast hits to 7398 proteins in 2208 species: Archae - 0; Bacteria - 5424; Metazoa - 2; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1894 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.2 | Ch3:10392571-10398221 | AT2G23770.1 | protein_coding | 2:10119973-10122479 | -17.5361 | 270 | 302 | 232 | 190 | protein kinase family protein / peptidoglycan-binding LysM domain-containing protein protein kinase family protein / peptidoglycan-binding LysM domain-containing protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation, cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, root, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.12 twelve leaves visible;CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Immunoglobulin-like (InterPro:IPR007110), Protein kinase, catalytic domain (InterPro:IPR000719), Peptidoglycan-binding Lysin subgroup (InterPro:IPR002482), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT2G33580.1); Has 93408 Blast hits to 92552 proteins in 3130 species: Archae - 75; Bacteria - 9623; Metazoa - 34895; Fungi - 6839; Plants - 28747; Viruses - 328; Other Eukaryotes - 12901 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G17130.2 | protein_coding | 1:5854093-5856697 | -17.5264 | 234 | 266 | 713 | 680 | Family ofunknown function (DUF572) Family ofunknown function (DUF572) ;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF572 (InterPro:IPR007590); Family ofunknown function (DUF572) (TAIR:AT2G32050.1); Has 1391 Blast hits to 1324 proteins in 252 species: Archae - 3; Bacteria - 52; Metazoa - 454; Fungi - 341; Plants - 148; Viruses - 5; Other Eukaryotes - 388 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G02880.1 | protein_coding | 3:634465-637284 | -17.5163 | 2681 | 2721 | 2250 | 2213 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: anchored to plasma membrane, cell wall, plasma membrane, membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT5G16590.1); Has 140419 Blast hits to 103539 proteins in 3753 species: Archae - 105; Bacteria - 10616; Metazoa - 37369; Fungi - 7261; Plants - 69256; Viruses - 279; Other Eukaryotes - 15533 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G67020.1 | protein_coding | 1:25010710-25012987 | -17.5155 | 333 | 381 | 200 | 161 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: leaf; Has 72 Blast hits to 72 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G44750.2 | protein_coding | 5:18052607-18060169 | -17.5119 | 674 | 711 | 748 | 708 | DNA-directed DNA polymerases Homologous to Y-family DNA polymerases,CONTAINS BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). REV1;FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA repair, response to UV-B, response to DNA damage stimulus; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: DNA polymerase, Y-family, little finger domain (InterPro:IPR017961), DNA-repair protein, UmuC-like (InterPro:IPR001126), DNA-repair protein, UmuC-like, N-terminal (InterPro:IPR017963), DNA repair protein, Rev1 (InterPro:IPR012112), BRCT (InterPro:IPR001357); DNA/RNA polymerases superfamily protein (TAIR:AT1G49980.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G47140.1 | protein_coding | 5:19144601-19147657 | -17.5084 | 520 | 539 | 76 | 57 | GATA transcription factor 27 Encodes a member of the GATA factor family of zinc finger transcription factors. GATA transcription factor 27 (GATA27);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent;CONTAINS InterPro DOMAIN/s: Zinc finger, GATA-type (InterPro:IPR000679); GATA transcription factor 26 (TAIR:AT4G17570.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT1G12380.1 | protein_coding | 1:4214258-4217412 | -17.5083 | 1226 | 1255 | 668 | 627 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G62870.1); Has 173 Blast hits to 170 proteins in 34 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 8; Plants - 123; Viruses - 7; Other Eukaryotes - 6 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.3 | Ch1:9065955-9071457 | AT1G28380.1 | protein_coding | 1:9963448-9966320 | -17.5014 | 2215 | 2253 | 58 | 22 | MAC/Perforin domain-containing protein This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. necrotic spotted lesions 1 (NSL1);CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin (MACPF) domain (InterPro:IPR020864); MAC/Perforin domain-containing protein (TAIR:AT4G24290.2); Has 203 Blast hits to 202 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 202; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_015622 | AT3G52535.1 | Ch3:19487129-19488530 | AT4G36870.1 | protein_coding | 4:17368915-17374011 | -17.4961 | 157 | 188 | 1831 | 1800 | BEL1-like homeodomain 2 Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. BEL1-like homeodomain 2 (BLH2);CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), POX (InterPro:IPR006563), Homeodomain-related (InterPro:IPR012287); BEL1-like homeodomain 4 (TAIR:AT2G23760.3); Has 5744 Blast hits to 5713 proteins in 356 species: Archae - 0; Bacteria - 3; Metazoa - 2532; Fungi - 390; Plants - 2517; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G72125.1 | protein_coding | 1:27134108-27136403 | -17.4898 | 3657 | 3698 | 445 | 392 | Major facilitator superfamily protein Major facilitator superfamily protein;FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: PTR2 family proton/oligopeptide symporter, conserved site (InterPro:IPR018456), Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Major facilitator superfamily protein (TAIR:AT1G72120.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G25910.1 | protein_coding | 5:9038860-9041377 | -17.489 | 233 | 261 | 2307 | 2277 | receptor like protein 52 putative disease resistance protein induced by chitin oligomers. receptor like protein 52 (RLP52);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response to fungus, response to chitin, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: stem, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); Protein kinase family protein with leucine-rich repeat domain (TAIR:AT5G25930.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT1G24560.1 | protein_coding | 1:8702361-8705879 | -17.4824 | 567 | 605 | 1115 | 1070 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G49055.1); Has 71940 Blast hits to 38124 proteins in 2481 species: Archae - 1358; Bacteria - 12126; Metazoa - 32861; Fungi - 6786; Plants - 4024; Viruses - 195; Other Eukaryotes - 14590 (source: NCBI BLink). | |
| XLOC_013032 | AT2G45023.1 | Ch2:18570156-18572173 | AT3G62010.1 | protein_coding | 3:22964534-22971384 | -17.4811 | 664 | 687 | 2772 | 2748 | unknown protein; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 553 Blast hits to 216 proteins in 93 species: Archae - 0; Bacteria - 124; Metazoa - 193; Fungi - 58; Plants - 108; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT5G07300.1 | protein_coding | 5:2299725-2303268 | -17.4802 | 137 | 170 | 1694 | 1655 | Calcium-dependent phospholipid-binding Copine family protein Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. BONZAI 2 (BON2);FUNCTIONS IN: calcium-dependent phospholipid binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Copine (InterPro:IPR010734), C2 calcium-dependent membrane targeting (InterPro:IPR000008), von Willebrand factor, type A (InterPro:IPR002035); DCD (Development and Cell Death) domain protein (TAIR:AT5G61910.4); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G35210.1 | protein_coding | 5:13474196-13482591 | -17.4796 | 673 | 692 | 39 | 20 | metalloendopeptidases;zinc ion binding;DNA binding Encodes a chloroplast envelope-bound plant homeodomain (PHD) transcription factor with transmembrane domains thatFUNCTIONS in multiple retrograde signal pathways. The proteolytic cleavage of PTM occurs in response to retrograde signals and amino-terminal PTM accumulates in the nucleus, where it activates ABI4 transcription in a PHD-dependent manner associated with histone modifications. metalloendopeptidases;zinc ion binding;DNA binding;FUNCTIONS IN: DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: DDT domain (InterPro:IPR004022), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT domain superfamily (InterPro:IPR018501), DDT domain, subgroup (InterPro:IPR018500), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); PHD finger family protein (TAIR:AT5G22760.1); Has 4444 Blast hits to 4001 proteins in 349 species: Archae - 111; Bacteria - 223; Metazoa - 2462; Fungi - 377; Plants - 907; Viruses - 0; Other Eukaryotes - 364 (source: NCBI BLink). | |
| XLOC_013032 | AT2G45023.1 | Ch2:18570156-18572173 | AT5G18490.1 | protein_coding | 5:6134114-6136807 | -17.4727 | 262 | 295 | 728 | 693 | Plant protein ofunknown function (DUF946) Plant protein ofunknown function (DUF946);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF946 (InterPro:IPR009291); Plant protein ofunknown function (DUF946) (TAIR:AT3G04350.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G10660.2 | protein_coding | 5:3370096-3372348 | -17.4712 | 305 | 337 | 1249 | 1209 | calmodulin-binding protein-related calmodulin-binding protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G24880.1). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT5G63950.1 | protein_coding | 5:25591956-25598671 | -17.4695 | 12 | 40 | 523 | 494 | chromatin remodeling 24 chromatin remodeling 24 (CHR24);FUNCTIONS IN: helicase activity, DNA binding, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); chromatin remodeling 8 (TAIR:AT2G18760.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT1G01810.1 | protein_coding | 1:295207-295859 | -17.4668 | 764 | 812 | 602 | 559 | unknown protein; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G28240.1 | protein_coding | 1:9868257-9872278 | -17.4638 | 671 | 690 | 2187 | 2168 | Protein ofunknown function (DUF616) Protein ofunknown function (DUF616);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF616 (InterPro:IPR006852); Protein ofunknown function (DUF616) (TAIR:AT1G53040.2); Has 322 Blast hits to 322 proteins in 41 species: Archae - 14; Bacteria - 34; Metazoa - 0; Fungi - 4; Plants - 225; Viruses - 1; Other Eukaryotes - 44 (source: NCBI BLink). | |
| XLOC_018014 | AT3G05955.1 | Ch3:11586005-11586548 | AT2G26930.1 | protein_coding | 2:11491707-11494290 | -17.4626 | 300 | 335 | 120 | 85 | 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase. 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase (CDPMEK);FUNCTIONS IN: 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase activity; INVOLVED IN: response to light stimulus; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: 4-diphosphocytidyl-2C-methyl-D-erythritol kinase (InterPro:IPR004424), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), GHMP kinase (InterPro:IPR006204), Ribosomal protein S5 domain 2-type fold, subgroup (InterPro:IPR014721), GHMP kinase, C-terminal (InterPro:IPR013750); Has 6617 Blast hits to 6617 proteins in 2226 species: Archae - 3; Bacteria - 4583; Metazoa - 0; Fungi - 2; Plants - 69; Viruses - 0; Other Eukaryotes - 1960 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G19390.1 | protein_coding | 2:8389610-8397939 | -17.462 | 971 | 996 | 4289 | 4261 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G29790.1); Has 203 Blast hits to 188 proteins in 60 species: Archae - 0; Bacteria - 11; Metazoa - 24; Fungi - 34; Plants - 93; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT3G49370.1 | protein_coding | 3:18304637-18308091 | -17.4604 | 49 | 76 | 140 | 108 | Calcium-dependent protein kinase (CDPK) family proteinCalcium-dependent protein kinase (CDPK) family protein;FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), EF-hand-like domain (InterPro:IPR011992), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); Calcium-dependent protein kinase (CDPK) family protein (TAIR:AT5G24430.1); Has 120826 Blast hits to 119042 proteins in 3470 species: Archae - 178; Bacteria - 14958; Metazoa - 45068; Fungi - 12844; Plants - 26097; Viruses - 535; Other Eukaryotes - 21146 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G04090.1 | protein_coding | 1:1057041-1059454 | -17.4599 | 2194 | 2222 | 1661 | 1636 | Plant protein ofunknown function (DUF946) Plant protein ofunknown function (DUF946);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF946 (InterPro:IPR009291); Plant protein ofunknown function (DUF946) (TAIR:AT5G43950.1); Has 349 Blast hits to 319 proteins in 89 species: Archae - 0; Bacteria - 23; Metazoa - 11; Fungi - 104; Plants - 206; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G13740.1 | protein_coding | 1:4713433-4715407 | -17.4555 | 53 | 120 | 1091 | 1021 | ABI five binding protein 2 Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. ABI five binding protein 2 (AFP2);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1675 (InterPro:IPR012463); ABI five binding protein (TAIR:AT1G69260.1); Has 207 Blast hits to 201 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 6; Plants - 185; Viruses - 3; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G27570.1 | protein_coding | 3:10213996-10216964 | -17.4534 | 625 | 670 | 143 | 89 | Sucrase/ferredoxin-like family proteinSucrase/ferredoxin-like family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Sucraseferredoxin-like (InterPro:IPR009737), Thioredoxin-like fold (InterPro:IPR012336); Sucrase/ferredoxin-like family protein (TAIR:AT5G40510.1); Has 487 Blast hits to 487 proteins in 162 species: Archae - 6; Bacteria - 90; Metazoa - 0; Fungi - 283; Plants - 71; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G02320.1 | protein_coding | 3:469867-473717 | -17.4388 | 211 | 258 | 1871 | 1825 | N2,N2-dimethylguanosine tRNA methyltransferaseN2,N2-dimethylguanosine tRNA methyltransferase;FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); N2,N2-dimethylguanosine tRNA methyltransferase (TAIR:AT5G15810.1); Has 1019 Blast hits to 973 proteins in 363 species: Archae - 257; Bacteria - 68; Metazoa - 198; Fungi - 156; Plants - 105; Viruses - 0; Other Eukaryotes - 235 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT3G29810.1 | protein_coding | 3:11728024-11730350 | -17.4377 | 2286 | 2317 | 32 | 1 | COBRA-like protein 2 precursorCOBRA-like protein 2 precursor (COBL2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyl-phosphatidyl inositol-anchored, plant (InterPro:IPR006918), COBRA-like (InterPro:IPR017391); COBRA-like protein 1 precursor (TAIR:AT3G02210.1); Has 381 Blast hits to 370 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 381; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_009092 | AT2G21187.1 | Ch2:9076289-9077494 | AT2G41740.1 | protein_coding | 2:17410672-17417820 | -17.4214 | 490 | 515 | 248 | 223 | villin 2Encodes a protein with high homology to animal villin. villin 2 (VLN2);FUNCTIONS IN: actin binding, protein binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Gelsolin (InterPro:IPR007122), Villin headpiece (InterPro:IPR003128), Gelsolin domain (InterPro:IPR007123); villin 3 (TAIR:AT3G57410.1); Has 3753 Blast hits to 2353 proteins in 268 species: Archae - 0; Bacteria - 52; Metazoa - 2426; Fungi - 285; Plants - 242; Viruses - 2; Other Eukaryotes - 746 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G32760.2 | protein_coding | 4:15799077-15804199 | -17.42 | 3123 | 3147 | 2405 | 2370 | ENTH/VHS/GAT family protein ENTH/VHS/GAT family protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); ENTH/VHS/GAT family protein (TAIR:AT3G08790.1). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT1G73450.1 | protein_coding | 1:27613420-27619095 | -17.4171 | 1191 | 1239 | 860 | 813 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT1G73460.1); Has 91653 Blast hits to 89873 proteins in 2996 species: Archae - 91; Bacteria - 10272; Metazoa - 34556; Fungi - 12029; Plants - 16764; Viruses - 383; Other Eukaryotes - 17558 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G21650.1 | protein_coding | 3:7621569-7624133 | -17.4071 | 633 | 666 | 749 | 707 | Protein phosphatase 2A regulatory B subunit family protein Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. Protein phosphatase 2A regulatory B subunit family protein;FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: mitochondrion, protein phosphatase type 2A complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT4G15415.1); Has 1208 Blast hits to 1201 proteins in 208 species: Archae - 2; Bacteria - 15; Metazoa - 575; Fungi - 156; Plants - 303; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). | |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT3G48380.3 | protein_coding | 3:17916416-17920315 | -17.3893 | 1108 | 1142 | 164 | 135 | Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2 (InterPro:IPR012462). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G53230.1 | protein_coding | 3:19723350-19727128 | -17.3829 | 616 | 665 | 49 | 2 | ATPase, AAA-type, CDC48 protein ATPase, AAA-type, CDC48 protein;FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, binding, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, nucleolus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); ATPase, AAA-type, CDC48 protein (TAIR:AT5G03340.1); Has 66274 Blast hits to 38860 proteins in 3301 species: Archae - 1748; Bacteria - 29009; Metazoa - 8678; Fungi - 6310; Plants - 5885; Viruses - 85; Other Eukaryotes - 14559 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT5G52890.2 | protein_coding | 5:21444793-21447242 | -17.3821 | 9 | 46 | 53 | 13 | AT hook motif-containing protein AT hook motif-containing protein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding motif (InterPro:IPR017956); DNA binding (TAIR:AT4G21895.1). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT5G59050.1 | protein_coding | 5:23839108-23842958 | -17.3631 | 2207 | 2240 | 628 | 597 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G54000.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_023962 | AT4G38545.1 | Ch4:18022932-18025298 | AT5G40170.1 | protein_coding | 5:16064859-16067628 | -17.3619 | 9 | 52 | 692 | 636 | receptor like protein 54 receptor like protein 54 (RLP54);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 27 (TAIR:AT2G33060.1); Has 95502 Blast hits to 27133 proteins in 1050 species: Archae - 52; Bacteria - 4975; Metazoa - 18576; Fungi - 1120; Plants - 63605; Viruses - 17; Other Eukaryotes - 7157 (source: NCBI BLink). | |
| XLOC_004105 | AT1G09927.1 | Ch1:30041286-30041963 | AT2G17950.1 | protein_coding | 2:7808871-7810811 | -17.3589 | 548 | 572 | 1054 | 1032 | Homeodomain-like superfamily protein Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development. WUSCHEL (WUS);CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057); WUSCHEL related homeobox 1 (TAIR:AT3G18010.1); Has 617 Blast hits to 617 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 2; Plants - 575; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G35770.1 | protein_coding | 5:13936086-13940867 | -17.355 | 2729 | 2754 | 99 | 73 | Transducin/WD40 repeat-like superfamily protein A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development.STERILE APETALA (SAP);FUNCTIONS IN: transcription regulator activity, sequence-specific DNA binding transcription factor activity; INVOLVED IN: flower development, megasporogenesis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT3G09220.1 | protein_coding | 3:2827190-2830655 | -17.355 | 3511 | 3536 | 121 | 96 | laccase 7 putative laccase, a member of laccase family of genes (17 members in Arabidopsis).laccase 7 (LAC7);FUNCTIONS IN: laccase activity; INVOLVED IN: oxidation reduction, lignin catabolic process; LOCATED IN: endomembrane system, apoplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Laccase (InterPro:IPR017761), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, copper-binding site (InterPro:IPR002355), Multicopper oxidase, type 1 (InterPro:IPR001117); Laccase/Diphenol oxidase family protein (TAIR:AT5G01050.1); Has 10354 Blast hits to 8703 proteins in 1520 species: Archae - 53; Bacteria - 4205; Metazoa - 505; Fungi - 3603; Plants - 1597; Viruses - 0; Other Eukaryotes - 391 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT5G25270.1 | protein_coding | 5:8757434-8763005 | -17.352 | 90 | 114 | 2007 | 1984 | Ubiquitin-like superfamily protein Ubiquitin-like superfamily protein;CONTAINS InterPro DOMAIN/s: Ubiquitin subgroup (InterPro:IPR019956), Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955); Ubiquitin-like superfamily protein (TAIR:AT5G42220.1); Has 11489 Blast hits to 5746 proteins in 742 species: Archae - 0; Bacteria - 401; Metazoa - 4954; Fungi - 1390; Plants - 2430; Viruses - 186; Other Eukaryotes - 2128 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G63260.1 | protein_coding | 3:23372878-23375405 | -17.3511 | 406 | 451 | 102 | 35 | Protein kinase superfamily protein protein kinase, similar to mammal mixed-lineage kinase and Raf protein kinase ATMRK1;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G22750.1); Has 128806 Blast hits to 127373 proteins in 4996 species: Archae - 150; Bacteria - 14757; Metazoa - 48688; Fungi - 11823; Plants - 32734; Viruses - 516; Other Eukaryotes - 20138 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G04930.1 | protein_coding | 5:1444638-1449879 | -17.3457 | 521 | 545 | 270 | 248 | aminophospholipid ATPase 1 Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. aminophospholipid ATPase 1 (ALA1);FUNCTIONS IN: protein binding, ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, phospholipid-translocating, flippase (InterPro:IPR006539), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200); ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G13900.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT3G58670.1 | protein_coding | 3:21703385-21706137 | -17.3396 | 2209 | 2253 | 315 | 273 | Protein ofunknown function (DUF1637) Protein ofunknown function (DUF1637);FUNCTIONS IN: cysteamine dioxygenase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1637 (InterPro:IPR012864); Protein ofunknown function (DUF1637) (TAIR:AT2G42670.1); Has 361 Blast hits to 361 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 0; Plants - 221; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G05080.1 | protein_coding | 5:1498438-1500784 | -17.3389 | 623 | 688 | 112 | 64 | ubiquitin-conjugating enzyme 22 ubiquitin-conjugating enzyme 22 (UBC22);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquiting-conjugating enzyme 2 (TAIR:AT2G02760.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT3G12350.1 | protein_coding | 3:3931451-3933404 | -17.33 | 48 | 74 | 794 | 768 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); Has 51 Blast hits to 51 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 45; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G31280.3 | protein_coding | 2:13338818-13343710 | -17.3239 | 2346 | 2378 | 175 | 139 | conserved peptide upstream open reading frame 7 conserved peptide upstream open reading frame 7 (CPUORF7);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT1G06150.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G73430.1 | protein_coding | 1:27603655-27611120 | -17.3184 | 673 | 693 | 141 | 121 | sec34-like family proteinsec34-like family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 353 Blast hits to 340 proteins in 172 species: Archae - 0; Bacteria - 4; Metazoa - 117; Fungi - 139; Plants - 43; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT1G61690.1 | protein_coding | 1:22782427-22786942 | -17.3118 | 320 | 366 | 2277 | 2236 | phosphoinositide binding phosphoinositide binding;FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Tetratricopeptide repeat (InterPro:IPR019734); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT1G20110.1); Has 11870 Blast hits to 9510 proteins in 652 species: Archae - 53; Bacteria - 741; Metazoa - 6145; Fungi - 1417; Plants - 821; Viruses - 12; Other Eukaryotes - 2681 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT1G05680.1 | protein_coding | 1:1703002-1704838 | -17.306 | 313 | 333 | 1309 | 1289 | Uridine diphosphate glycosyltransferase 74E2 Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. Uridine diphosphate glycosyltransferase 74E2 (UGT74E2);CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT1G05675.1); Has 8397 Blast hits to 8309 proteins in 513 species: Archae - 0; Bacteria - 605; Metazoa - 2499; Fungi - 31; Plants - 5061; Viruses - 123; Other Eukaryotes - 78 (source: NCBI BLink). | |
| XLOC_026283 | AT5G06695.1 | Ch5:18172400-18175422 | AT1G08400.1 | protein_coding | 1:2643019-2646048 | -17.2958 | 849 | 865 | 712 | 696 | RINT-1 / TIP-1 family RINT-1 / TIP-1 family;CONTAINS InterPro DOMAIN/s: RINT-1/TIP-1 (InterPro:IPR007528); RINT-1 / TIP-1 family (TAIR:AT3G47700.1); Has 146 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 64; Fungi - 34; Plants - 43; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G30110.1 | protein_coding | 2:12852329-12857727 | -17.293 | 627 | 691 | 1483 | 1436 | ubiquitin-activating enzyme 1Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. ubiquitin-activating enzyme 1 (UBA1);FUNCTIONS IN: ubiquitin-protein ligase activity, ubiquitin activating enzyme activity; INVOLVED IN: response to cadmium ion, response to other organism, protein ubiquitination, ubiquitin-dependent protein catabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ubiquitin-activating enzyme, E1, active site (InterPro:IPR018074), Ubiquitin-activating enzyme, E1 (InterPro:IPR018075), Ubiquitin-activating enzyme e1, C-terminal (InterPro:IPR018965), Ubiquitin-activating enzyme repeat (InterPro:IPR000127), Ubiquitin-activating enzyme (InterPro:IPR019572), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding domain (InterPro:IPR016040), Ubiquitin-activating enzyme, E1-like (InterPro:IPR000011); ubiquitin activating enzyme 2 (TAIR:AT5G06460.1); Has 19490 Blast hits to 12603 proteins in 2346 species: Archae - 393; Bacteria - 11015; Metazoa - 2131; Fungi - 1366; Plants - 791; Viruses - 0; Other Eukaryotes - 3794 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.2 | Ch3:10392571-10398221 | AT1G09970.2 | protein_coding | 1:3252098-3255782 | -17.2913 | 834 | 852 | 185 | 167 | Leucine-rich receptor-like protein kinase family protein RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. LRR XI-23;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid autophosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Leucine-rich repeat protein kinase family protein (TAIR:AT3G19700.1); Has 205125 Blast hits to 136515 proteins in 4580 species: Archae - 168; Bacteria - 22290; Metazoa - 61642; Fungi - 10712; Plants - 85268; Viruses - 403; Other Eukaryotes - 24642 (source: NCBI BLink). | |
| XLOC_000642 | AT1G04933.1 | Ch1:4123641-4124165 | AT5G07270.1 | protein_coding | 5:2280560-2283667 | -17.2873 | 328 | 359 | 1667 | 1640 | XB3 ortholog 3 in Arabidopsis thalianaXB3 ortholog 3 in Arabidopsis thaliana (XBAT33);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); XB3 ortholog 2 in Arabidopsis thaliana (TAIR:AT5G57740.1); Has 53429 Blast hits to 23032 proteins in 965 species: Archae - 65; Bacteria - 4348; Metazoa - 27793; Fungi - 4781; Plants - 2636; Viruses - 380; Other Eukaryotes - 13426 (source: NCBI BLink). | |
| XLOC_007851 | AT1G09517.1 | Ch1:28134653-28135270 | AT5G62630.1 | protein_coding | 5:25143518-25146587 | -17.2846 | 339 | 373 | 144 | 104 | hipl2 protein precursor hipl2 protein precursor (HIPL2);FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_processunknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Soluble quinoprotein glucose/sorbosone dehydrogenase (InterPro:IPR011041), Folate receptor, conserved region (InterPro:IPR018143), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); catalytics (TAIR:AT1G74790.1); Has 3498 Blast hits to 3492 proteins in 823 species: Archae - 55; Bacteria - 1934; Metazoa - 143; Fungi - 4; Plants - 281; Viruses - 0; Other Eukaryotes - 1081 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT5G64270.1 | protein_coding | 5:25706608-25711355 | -17.2815 | 248 | 286 | 688 | 650 | splicing factor, putativesplicing factor, putative;FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), HEAT, type 2 (InterPro:IPR021133), Armadillo-type fold (InterPro:IPR016024); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT5G47690.3 | protein_coding | 5:19317668-19327431 | -17.2793 | 599 | 624 | 4725 | 4700 | binding binding;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell;CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT1G77600.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001435 | AT1G26558.1 | Ch1:9175611-9177556 | AT2G02080.1 | protein_coding | 2:518079-521737 | -17.2722 | 311 | 342 | 1140 | 1114 | indeterminate(ID)-domain 4 indeterminate(ID)-domain 4 (IDD4);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, double-stranded RNA binding (InterPro:IPR022755); C2H2-like zinc finger protein (TAIR:AT1G14580.2); Has 51298 Blast hits to 20221 proteins in 333 species: Archae - 2; Bacteria - 165; Metazoa - 48118; Fungi - 358; Plants - 855; Viruses - 7; Other Eukaryotes - 1793 (source: NCBI BLink). | |
| XLOC_015622 | AT3G52535.1 | Ch3:19487129-19488530 | AT3G58030.1 | protein_coding | 3:21484156-21487102 | -17.2707 | 917 | 943 | 993 | 952 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G42030.1); Has 4227 Blast hits to 4219 proteins in 268 species: Archae - 0; Bacteria - 0; Metazoa - 2446; Fungi - 474; Plants - 832; Viruses - 22; Other Eukaryotes - 453 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT5G61300.1 | protein_coding | 5:24650704-24653269 | -17.2646 | 154 | 174 | 1022 | 998 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G07790.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.2 | Ch1:5222729-5224055 | AT1G26208.1 | lncRNA | 1:9065955-9071468 | -17.264 | 61 | 80 | 1235 | 1216 | other RNA Potential natural antisense gene, locus overlaps with AT1G26210 | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G79280.2 | protein_coding | 1:29818970-29833016 | -17.2533 | 253 | 287 | 6277 | 6238 | nuclear pore anchorEncodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. nuclear pore anchor (NUA);CONTAINS InterPro DOMAIN/s: Tetratricopeptide, MLP1/MLP2-like (InterPro:IPR012929). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT4G02710.1 | protein_coding | 4:1193516-1197630 | -17.2528 | 272 | 291 | 2951 | 2932 | Kinase interacting (KIP1-like) family protein Kinase interacting (KIP1-like) family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); kinase interacting (KIP1-like) family protein (TAIR:AT1G03080.1); Has 113312 Blast hits to 57291 proteins in 3105 species: Archae - 1581; Bacteria - 20592; Metazoa - 51557; Fungi - 9057; Plants - 6359; Viruses - 476; Other Eukaryotes - 23690 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G49680.2 | protein_coding | 5:20176080-20188567 | -17.2411 | 7 | 56 | 5993 | 5943 | Golgi-body localisation protein domain ;RNA pol II promoter Fmp27 protein domain Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests relatedFUNCTIONS for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. Golgi-body localisation protein domain ;RNA pol II promoter Fmp27 protein domain; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function FMP27, domain-6, C-terminal (InterPro:IPR019443), Protein ofunknown function FMP27, domain-4 (InterPro:IPR019441); Golgi-body localisation protein domain ;RNA pol II promoter Fmp27 protein domain (TAIR:AT1G58250.1); Has 241 Blast hits to 185 proteins in 77 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 36; Plants - 79; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | |
| XLOC_004089 | AT1G79529.1 | Ch1:29915662-29916410 | AT5G64170.2 | protein_coding | 5:25672466-25676823 | -17.2399 | 451 | 505 | 2045 | 1998 | dentin sialophosphoprotein-related dentin sialophosphoprotein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G54500.2); Has 181 Blast hits to 169 proteins in 40 species: Archae - 2; Bacteria - 18; Metazoa - 17; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G58410.1 | protein_coding | 5:23609376-23617599 | -17.2394 | 666 | 702 | 1679 | 1639 | HEAT/U-box domain-containing protein HEAT/U-box domain-containing protein;FUNCTIONS IN: binding, zinc ion binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Armadillo-type fold (InterPro:IPR016024); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G03790.3 | protein_coding | 3:961750-968152 | -17.2372 | 2789 | 2805 | 194 | 178 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Regulator of chromosome condensation (RCC1) family protein (TAIR:AT5G63860.1). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G11080.1 | protein_coding | 3:3470304-3473685 | -17.2301 | 1346 | 1374 | 2723 | 2695 | receptor like protein 35 receptor like protein 35 (RLP35);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: stem, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 34 (TAIR:AT3G11010.1); Has 143109 Blast hits to 35332 proteins in 1251 species: Archae - 53; Bacteria - 12845; Metazoa - 35908; Fungi - 1531; Plants - 81557; Viruses - 21; Other Eukaryotes - 11194 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G07810.2 | protein_coding | 3:2492260-2495959 | -17.2169 | 153 | 171 | 203 | 185 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT5G47620.2); Has 54120 Blast hits to 30425 proteins in 1467 species: Archae - 38; Bacteria - 13586; Metazoa - 19029; Fungi - 4969; Plants - 7799; Viruses - 151; Other Eukaryotes - 8548 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G30100.1 | protein_coding | 2:12847518-12849708 | -17.2153 | 264 | 329 | 778 | 727 | pentatricopeptide (PPR) repeat-containing proteinpentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G04810.1); Has 68862 Blast hits to 30982 proteins in 1167 species: Archae - 27; Bacteria - 7834; Metazoa - 26033; Fungi - 2446; Plants - 28670; Viruses - 2; Other Eukaryotes - 3850 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G27140.1 | protein_coding | 5:9548542-9550597 | -17.2135 | 43 | 96 | 1260 | 1202 | NOP56-like pre RNA processing ribonucleoprotein NOP56-like pre RNA processing ribonucleoprotein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED IN: leaf;CONTAINS InterPro DOMAIN/s: Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (InterPro:IPR002687), NOP5, N-terminal (InterPro:IPR012974), NOSIC (InterPro:IPR012976); NOP56-like pre RNA processing ribonucleoprotein (TAIR:AT5G27120.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_009092 | AT2G21187.1 | Ch2:9076289-9077494 | AT1G79600.1 | protein_coding | 1:29949910-29952726 | -17.2071 | 670 | 705 | 74 | 41 | Protein kinase superfamily protein Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism.Protein kinase superfamily protein;FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, catalytic domain (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT1G71810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G07640.3 | protein_coding | 1:2353031-2356413 | -17.207 | 3456 | 3481 | 376 | 353 | Dof-type zinc finger DNA-binding family protein A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. OBP2;CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); Dof-type zinc finger DNA-binding family protein (TAIR:AT2G28810.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G20960.1 | protein_coding | 2:9006610-9009794 | -17.1984 | 335 | 374 | 2252 | 2212 | Arabidopsis phospholipase-like protein (PEARLI 4) family pEARLI4;CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); Arabidopsis phospholipase-like protein (PEARLI 4) family (TAIR:AT4G38560.1); Has 15842 Blast hits to 10281 proteins in 873 species: Archae - 33; Bacteria - 1976; Metazoa - 6640; Fungi - 3309; Plants - 1166; Viruses - 359; Other Eukaryotes - 2359 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.1 | Ch3:11498879-11501419 | AT2G23760.1 | protein_coding | 2:10107707-10113327 | -17.1964 | 12 | 38 | 1766 | 1736 | BEL1-like homeodomain 4 Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. BEL1-like homeodomain 4 (BLH4);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: N-terminal protein myristoylation, leaf morphogenesis; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Homeobox KN domain (InterPro:IPR008422), POX (InterPro:IPR006563), Homeodomain-related (InterPro:IPR012287); BEL1-like homeodomain 2 (TAIR:AT4G36870.2); Has 5634 Blast hits to 5559 proteins in 359 species: Archae - 0; Bacteria - 6; Metazoa - 2382; Fungi - 373; Plants - 2492; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G53650.1 | protein_coding | 1:20028923-20031619 | -17.188 | 672 | 699 | 72 | 46 | CTC-interacting domain 8 RNA-binding protein, putative, similar to RNA-binding protein GB:AAA86641 GI:1174153 from (Arabidopsis thaliana).Contains PAB2 domain which facilitates binding to PABC proteins. CTC-interacting domain 8 (CID8);CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ataxin-2, C-terminal (InterPro:IPR009818); CTC-interacting domain 9 (TAIR:AT3G14450.1); Has 4564 Blast hits to 3628 proteins in 293 species: Archae - 0; Bacteria - 0; Metazoa - 2619; Fungi - 543; Plants - 1016; Viruses - 0; Other Eukaryotes - 386 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G64150.1 | protein_coding | 1:23808835-23812725 | -17.1817 | 526 | 562 | 194 | 166 | Uncharacterized protein family (UPF0016) Uncharacterized protein family (UPF0016); LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); Uncharacterized protein family (UPF0016) (TAIR:AT4G13590.1); Has 1632 Blast hits to 1475 proteins in 546 species: Archae - 26; Bacteria - 846; Metazoa - 163; Fungi - 173; Plants - 204; Viruses - 0; Other Eukaryotes - 220 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G55940.1 | protein_coding | 1:20922342-20924587 | -17.176 | 1964 | 1984 | 1244 | 1218 | cytochrome P450, family 708, subfamily A, polypeptide 1 member of CYP708A "cytochrome P450, family 708, subfamily A, polypeptide 1" (CYP708A1);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: shoot apex, shoot, hypocotyl, root, leaf; EXPRESSED DURING: LP.12 twelve leaves visible;CONTAINS InterPro DOMAIN/s: F-box associated domain, type 3 (InterPro:IPR013187), Cytochrome P450 (InterPro:IPR001128), F-box associated interaction domain (InterPro:IPR017451), Cytochrome P450, E-class, group IV (InterPro:IPR002403), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 708, subfamily A, polypeptide 3 (TAIR:AT1G78490.1); Has 33156 Blast hits to 33083 proteins in 1720 species: Archae - 63; Bacteria - 6821; Metazoa - 10825; Fungi - 5863; Plants - 8109; Viruses - 6; Other Eukaryotes - 1469 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT3G23980.1 | protein_coding | 3:8662413-8668040 | -17.1756 | 275 | 291 | 21 | 5 | BLISTER Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). It colocalizes with CLF to the nucleus and represses a subset of Pc-G target genes. The pleiotropic developmental mutant phenotype suggests that BLI prevents premature differentiation. BLISTER (BLI);FUNCTIONS IN: transcription regulator activity; INVOLVED IN: flower development, seed development, regulation of transcription, DNA-dependent, leaf morphogenesis; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 32015 Blast hits to 19612 proteins in 1632 species: Archae - 290; Bacteria - 4748; Metazoa - 14972; Fungi - 3061; Plants - 1469; Viruses - 92; Other Eukaryotes - 7383 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G53200.1 | protein_coding | 1:19840368-19843499 | -17.1678 | 277 | 310 | 134 | 103 | unknown protein; Has 21 Blast hits to 21 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G02780.1 | protein_coding | 2:781674-784944 | -17.1661 | 971 | 1014 | 63 | 10 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT1G14390.1); Has 90498 Blast hits to 51050 proteins in 1587 species: Archae - 36; Bacteria - 4349; Metazoa - 18583; Fungi - 1583; Plants - 60249; Viruses - 102; Other Eukaryotes - 5596 (source: NCBI BLink). | |
| XLOC_009708 | AT2G31585.1 | Ch2:13446002-13446729 | AT5G57210.1 | protein_coding | 5:23180833-23184053 | -17.1657 | 500 | 519 | 1642 | 1623 | Ypt/Rab-GAP domain of gyp1p superfamily protein Ypt/Rab-GAP domain of gyp1p superfamily protein;FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular, chloroplast;CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT4G29950.1); Has 1722 Blast hits to 1340 proteins in 214 species: Archae - 0; Bacteria - 4; Metazoa - 717; Fungi - 361; Plants - 287; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT5G20930.1 | protein_coding | 5:7097868-7103206 | -17.1574 | 1221 | 1261 | 142 | 89 | Protein kinase superfamily protein Nuclear serine/threonine protein kinase that requires a coiled-coil region for oligomerization and catalytic activity. Required for leaf and flower development. Expression localized to the developing style by stage 13. TOUSLED (TSL);FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, chloroplast, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); ataurora3 (TAIR:AT2G45490.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_026283 | AT5G06695.1 | Ch5:18172400-18175422 | AT3G59910.1 | protein_coding | 3:22130483-22133604 | -17.1569 | 20 | 66 | 2327 | 2287 | Ankyrin repeat family protein Ankyrin repeat family protein;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683); Ankyrin repeat family protein (TAIR:AT2G44090.2); Has 71 Blast hits to 71 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_000802 | AT1G05133.1 | Ch1:5146658-5147266 | AT3G54950.1 | protein_coding | 3:20358896-20361560 | -17.1533 | 327 | 348 | 1298 | 1277 | patatin-like protein 6 Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. patatin-like protein 6 (PLA IIIA);CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Patatin (InterPro:IPR002641); PATATIN-like protein 6 (TAIR:AT2G39220.1); Has 1058 Blast hits to 1055 proteins in 202 species: Archae - 0; Bacteria - 325; Metazoa - 24; Fungi - 32; Plants - 544; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G31120.1 | protein_coding | 1:11104237-11108095 | -17.1324 | 218 | 260 | 2616 | 2564 | K+ uptake permease 10 potassium transporter K+ uptake permease 10 (KUP10);FUNCTIONS IN: potassium ion transmembrane transporter activity; INVOLVED IN: potassium ion transport; LOCATED IN: membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Potassium uptake protein, kup (InterPro:IPR018519), K+ potassium transporter (InterPro:IPR003855); K+ uptake permease 11 (TAIR:AT2G35060.1); Has 3472 Blast hits to 3422 proteins in 1051 species: Archae - 13; Bacteria - 2438; Metazoa - 1; Fungi - 105; Plants - 791; Viruses - 4; Other Eukaryotes - 120 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT5G04940.1 | protein_coding | 5:1454131-1457141 | -17.1275 | 1268 | 1289 | 62 | 41 | SU(VAR)3-9 homolog 1 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SU(VAR)3-9 homolog 1 (SUVH1);CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214), SRA-YDG (InterPro:IPR003105), Pre-SET zinc-binding sub-group (InterPro:IPR003606), Post-SET domain (InterPro:IPR003616), Pre-SET domain (InterPro:IPR007728); SU(VAR)3-9 homolog 3 (TAIR:AT1G73100.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G12770.1 | protein_coding | 1:4351019-4353797 | -17.1172 | 32 | 49 | 1842 | 1825 | P-loop containing nucleoside triphosphate hydrolases superfamily proteinEncodes a DEAD-box RNA helicase that localizes to mitochondria and is essential for regulating cell-to-cell transport via plasmodesmata. embryo defective 1586 (EMB1586);FUNCTIONS IN: RNA helicase activity; INVOLVED IN: plasmodesma organization, plasmodesmata-mediated intercellular transport, embryo development ending in seed dormancy; LOCATED IN: mitochondrion; EXPRESSED IN: embryo, root, flower, shoot meristem;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); DEA(D/H)-box RNA helicase family protein (TAIR:AT5G60990.1); Has 38833 Blast hits to 38121 proteins in 2993 species: Archae - 753; Bacteria - 18819; Metazoa - 5837; Fungi - 4441; Plants - 2445; Viruses - 12; Other Eukaryotes - 6526 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G11830.2 | protein_coding | 4:7115681-7121919 | -17.1074 | 970 | 992 | 837 | 810 | phospholipase D gamma 2 Encodes one of three phospholipase D enzymes of the gamma class. phospholipase D gamma 2 (PLDGAMMA2);FUNCTIONS IN: phospholipase D activity; INVOLVED IN: phospholipid catabolic process; LOCATED IN: cytosolic ribosome, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), Phospholipase D (InterPro:IPR015679), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Phospholipase D, plant (InterPro:IPR011402), Phospholipase D/Transphosphatidylase (InterPro:IPR001736), C2 calcium-dependent membrane targeting (InterPro:IPR000008); phospholipase D gamma 3 (TAIR:AT4G11840.1); Has 2065 Blast hits to 1596 proteins in 399 species: Archae - 2; Bacteria - 528; Metazoa - 398; Fungi - 435; Plants - 545; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT5G67530.1 | protein_coding | 5:26941074-26944146 | -17.1059 | 322 | 365 | 1625 | 1596 | plant U-box 49plant U-box 49 (PUB49);FUNCTIONS IN: ubiquitin-protein ligase activity, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130), U box domain (InterPro:IPR003613), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (InterPro:IPR020892); Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT1G01940.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G16860.1 | protein_coding | 1:5767300-5770602 | -17.0981 | 161 | 183 | 204 | 182 | Ubiquitin-specific protease family C19-related proteinUbiquitin-specific protease family C19-related protein; LOCATED IN: plasma membrane; Ubiquitin-specific protease family C19-related protein (TAIR:AT1G78880.1); Has 605 Blast hits to 295 proteins in 85 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 28; Plants - 169; Viruses - 0; Other Eukaryotes - 360 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G34220.1 | protein_coding | 4:16381473-16384468 | -17.0964 | 1241 | 1261 | 1822 | 1800 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT2G15300.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G11670.1 | protein_coding | 3:3680866-3684871 | -17.0855 | 662 | 698 | 631 | 608 | UDP-Glycosyltransferase superfamily proteinResponsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). DIGALACTOSYL DIACYLGLYCEROL DEFICIENT 1 (DGD1);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); digalactosyl diacylglycerol deficient 2 (TAIR:AT4G00550.1); Has 287 Blast hits to 284 proteins in 72 species: Archae - 6; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G54569.1 | lncRNA | 5:22167273-22170610 | -17.0837 | 1862 | 1898 | 943 | 906 | other RNA Potential natural antisense gene, locus overlaps with AT5G54570 | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G18730.1 | protein_coding | 1:6460403-6462344 | -17.0796 | 2215 | 2254 | 175 | 134 | NDH dependent flow 6 likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. NDH dependent flow 6 (NDF6);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast thylakoid membrane, chloroplast, NAD(P)H dehydrogenase complex (plastoquinone); EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 36 Blast hits to 36 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G06010.1 | protein_coding | 3:1802141-1807530 | -17.0785 | 1086 | 1111 | 3388 | 3356 | Homeotic gene regulator Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress. ATCHR12;FUNCTIONS IN: helicase activity, DNA binding, nucleic acid binding, ATP binding; INVOLVED IN: response to water deprivation, response to salt stress, response to heat; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); Homeotic gene regulator (TAIR:AT5G19310.1); Has 23556 Blast hits to 19403 proteins in 2220 species: Archae - 141; Bacteria - 6122; Metazoa - 5759; Fungi - 4503; Plants - 1859; Viruses - 268; Other Eukaryotes - 4904 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT2G41210.1 | protein_coding | 2:17173374-17176866 | -17.0776 | 252 | 284 | 1237 | 1193 | phosphatidylinositol- 4-phosphate 5-kinase 5 Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology. phosphatidylinositol- 4-phosphate 5-kinase 5 (PIP5K5);CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); phosphatidyl inositol monophosphate 5 kinase 4 (TAIR:AT3G56960.1); Has 28370 Blast hits to 7831 proteins in 606 species: Archae - 2; Bacteria - 4383; Metazoa - 4412; Fungi - 450; Plants - 2408; Viruses - 2; Other Eukaryotes - 16713 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G40730.1 | protein_coding | 2:16989836-16996308 | -17.0759 | 1353 | 1391 | 125 | 86 | Protein kinase family protein with ARM repeat domain Protein kinase family protein with ARM repeat domain;FUNCTIONS IN: protein serine/threonine kinase activity, binding, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Armadillo-like helical (InterPro:IPR011989), Serine/threonine-protein kinase domain (InterPro:IPR002290), HEAT, type 2 (InterPro:IPR021133), Armadillo-type fold (InterPro:IPR016024), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); ARM repeat superfamily protein (TAIR:AT1G71410.1); Has 4566 Blast hits to 2083 proteins in 348 species: Archae - 0; Bacteria - 278; Metazoa - 876; Fungi - 585; Plants - 192; Viruses - 19; Other Eukaryotes - 2616 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G60790.1 | protein_coding | 1:22380002-22382422 | -17.0712 | 2215 | 2244 | 1544 | 1511 | Plant protein ofunknown function (DUF828) Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 2 (TBL2);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); Plant protein ofunknown function (DUF828) (TAIR:AT5G06700.1); Has 1368 Blast hits to 1349 proteins in 34 species: Archae - 0; Bacteria - 2; Metazoa - 9; Fungi - 0; Plants - 1355; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_005592 | AT1G05927.1 | Ch1:8835419-8836850 | AT4G02460.1 | protein_coding | 4:1076090-1080727 | -17.0697 | 260 | 279 | 74 | 55 | DNA mismatch repair protein, putativeEncodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. POSTMEIOTIC SEGREGATION 1 (PMS1);FUNCTIONS IN: mismatched DNA binding, ATP binding; INVOLVED IN: mismatch repair, fruit development, seed development, DNA recombination, pollen development; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: DNA mismatch repair, conserved site (InterPro:IPR014762), ATPase-like, ATP-binding domain (InterPro:IPR003594), DNA mismatch repair protein, C-terminal (InterPro:IPR013507), MutL, C-terminal, dimerisation (InterPro:IPR014790), DNA mismatch repair protein, N-terminal (InterPro:IPR014763), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), DNA mismatch repair protein (InterPro:IPR002099), Post Meiotic Segregation 2 (InterPro:IPR015434), Ribosomal protein S5 domain 2-type fold, subgroup (InterPro:IPR014721); MUTL-homologue 1 (TAIR:AT4G09140.1); Has 10471 Blast hits to 7086 proteins in 2377 species: Archae - 138; Bacteria - 7516; Metazoa - 568; Fungi - 666; Plants - 148; Viruses - 0; Other Eukaryotes - 1435 (source: NCBI BLink). | |
| XLOC_009437 | AT2G26692.1 | Ch2:11350517-11351293 | AT1G51220.1 | protein_coding | 1:18989751-18992149 | -17.0672 | 186 | 221 | 102 | 67 | WIP domain protein 5 Encodes a WIP domain containing protein. Putative target of WRKY53.WIP domain protein 5 (WIP5);CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); WIP domain protein 4 (TAIR:AT3G20880.1); Has 19383 Blast hits to 11948 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 18075; Fungi - 148; Plants - 690; Viruses - 0; Other Eukaryotes - 470 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT5G55610.1 | protein_coding | 5:22525771-22528143 | -17.0634 | 87 | 127 | 951 | 921 | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G59710.1 | protein_coding | 5:24057378-24062082 | -17.0573 | 2603 | 2629 | 192 | 162 | VIRE2 interacting protein 2Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. VIRE2 interacting protein 2 (VIP2);CONTAINS InterPro DOMAIN/s: NOT2/NOT3/NOT5 (InterPro:IPR007282); NOT2 / NOT3 / NOT5 family (TAIR:AT1G07705.2); Has 3791 Blast hits to 3038 proteins in 463 species: Archae - 1; Bacteria - 1471; Metazoa - 837; Fungi - 516; Plants - 178; Viruses - 9; Other Eukaryotes - 779 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT2G43710.2 | protein_coding | 2:18119873-18122889 | -17.0556 | 133 | 193 | 525 | 480 | Plant stearoyl-acyl-carrier-protein desaturase family proteinEncodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. SSI2;FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, stearoyl-CoA 9-desaturase activity; INVOLVED IN: in 10 processes; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067), Stearoyl-ACP desaturase, conserved site (InterPro:IPR005803); Plant stearoyl-acyl-carrier-protein desaturase family protein (TAIR:AT3G02630.1); Has 946 Blast hits to 938 proteins in 221 species: Archae - 0; Bacteria - 436; Metazoa - 2; Fungi - 0; Plants - 450; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). | |
| XLOC_027988 | AT5G07322.1 | Ch5:2313119-2313563 | AT5G25050.1 | protein_coding | 5:8631461-8634027 | -17.0446 | 336 | 360 | 1112 | 1085 | Major facilitator superfamily protein Major facilitator superfamily protein;CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); Major facilitator superfamily protein (TAIR:AT5G25040.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT5G38660.1 | protein_coding | 5:15470900-15476553 | -17.0445 | 121 | 151 | 60 | 30 | acclimation of photosynthesis to environment mutant has Altered acclimation responses; ACCLIMATION OF PHOTOSYNTHESIS TO ENVIRONMENT (APE1);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2854 (InterPro:IPR021275); Has 267 Blast hits to 267 proteins in 85 species: Archae - 0; Bacteria - 122; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT2G33435.1 | protein_coding | 2:14165125-14173509 | -17.0416 | 14 | 49 | 1877 | 1836 | RNA-binding (RRM/RBD/RNP motifs) family protein RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); U2 snRNP auxilliary factor, large subunit, splicing factor (TAIR:AT4G36690.1); Has 62164 Blast hits to 35633 proteins in 1636 species: Archae - 185; Bacteria - 4712; Metazoa - 29770; Fungi - 5811; Plants - 3284; Viruses - 214; Other Eukaryotes - 18188 (source: NCBI BLink). | |
| XLOC_004089 | AT1G79529.1 | Ch1:29915662-29916410 | AT5G61840.1 | protein_coding | 5:24839177-24842143 | -17.0309 | 450 | 495 | 524 | 488 | Exostosin family protein GUT1;CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); Exostosin family protein (TAIR:AT1G27440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G12640.1 | protein_coding | 4:7462532-7467870 | -17.0297 | 24 | 59 | 138 | 107 | RNA recognition motif (RRM)-containing proteinRNA recognition motif (RRM)-containing protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue SPOC, C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA binding (TAIR:AT2G43410.4); Has 8554 Blast hits to 7148 proteins in 405 species: Archae - 8; Bacteria - 199; Metazoa - 4614; Fungi - 1472; Plants - 1436; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G31290.1 | protein_coding | 4:15185775-15188484 | -17.0238 | 2778 | 2805 | 86 | 55 | ChaC-like family protein ChaC-like family protein;CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); ChaC-like family protein (TAIR:AT5G26220.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT3G60030.1 | protein_coding | 3:22165580-22169984 | -17.02 | 41 | 89 | 410 | 354 | squamosa promoter-binding protein-like 12squamosa promoter-binding protein-like 12 (SPL12);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Transcription factor, SBP-box (InterPro:IPR004333); squamosa promoter binding protein-like 1 (TAIR:AT2G47070.1); Has 969 Blast hits to 908 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 21; Fungi - 0; Plants - 938; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT4G11110.1 | protein_coding | 4:6771605-6777225 | -17.0179 | 483 | 525 | 138 | 94 | SPA1-related 2 Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. SPA1-related 2 (SPA2);FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), Protein kinase, catalytic domain (InterPro:IPR000719), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); SPA (suppressor of phyA-105) protein family (TAIR:AT2G46340.1); Has 34047 Blast hits to 20982 proteins in 883 species: Archae - 38; Bacteria - 5461; Metazoa - 12841; Fungi - 7307; Plants - 4015; Viruses - 10; Other Eukaryotes - 4375 (source: NCBI BLink). | |
| XLOC_015797 | AT3G55485.1 | Ch3:20571434-20571938 | AT1G56660.1 | protein_coding | 1:21237839-21241014 | -17.0155 | 223 | 260 | 1111 | 1075 | unknown protein; Has 665200 Blast hits to 205811 proteins in 4684 species: Archae - 3320; Bacteria - 107592; Metazoa - 249086; Fungi - 76753; Plants - 38542; Viruses - 3008; Other Eukaryotes - 186899 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G12780.1 | protein_coding | 4:7511943-7517067 | -17.0153 | 1235 | 1273 | 296 | 257 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: guard cell;CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Chaperone DnaJ-domain superfamily protein (TAIR:AT4G12770.1); Has 31395 Blast hits to 23789 proteins in 1775 species: Archae - 112; Bacteria - 5604; Metazoa - 12875; Fungi - 3652; Plants - 1866; Viruses - 192; Other Eukaryotes - 7094 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G61510.1 | protein_coding | 5:24736871-24739002 | -17.0141 | 3600 | 3631 | 68 | 40 | GroES-like zinc-binding alcohol dehydrogenase family protein GroES-like zinc-binding alcohol dehydrogenase family protein;FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: cell differentiation, response to high light intensity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding domain (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, C-terminal (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G38840.1 | protein_coding | 5:15551243-15555077 | -17.0116 | 230 | 251 | 2109 | 2084 | SMAD/FHA domain-containing protein SMAD/FHA domain-containing protein ;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (FHA) domain (InterPro:IPR000253); SMAD/FHA domain-containing protein (TAIR:AT5G47790.1); Has 18317 Blast hits to 13795 proteins in 1254 species: Archae - 157; Bacteria - 2798; Metazoa - 7417; Fungi - 1475; Plants - 704; Viruses - 54; Other Eukaryotes - 5712 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G61270.1 | protein_coding | 5:24638491-24640765 | -17.0107 | 233 | 275 | 637 | 591 | phytochrome-interacting factor7 Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation. phytochrome-interacting factor7 (PIF7);CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT4G00050.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G26030.1 | protein_coding | 3:9516953-9519563 | -17.0064 | 542 | 558 | 67 | 51 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta protein phosphatase 2A regulatory subunit isoform B' delta serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta (ATB' DELTA);FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: nucleolus, protein phosphatase type 2A complex, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT3G26020.2); Has 1183 Blast hits to 1155 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 568; Fungi - 166; Plants - 302; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT2G19110.1 | protein_coding | 2:8278789-8286561 | -17.0043 | 25 | 49 | 761 | 737 | heavy metal atpase 4 Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. heavy metal atpase 4 (HMA4);FUNCTIONS IN: zinc ion transmembrane transporter activity, protein binding, cadmium ion transmembrane transporter activity, cadmium-transporting ATPase activity; INVOLVED IN: in 8 processes; LOCATED IN: plasma membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, P-type copper-transporter (InterPro:IPR001756), Heavy metal transport/detoxification protein (InterPro:IPR006121), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type, heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating (InterPro:IPR006404), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type, heavy metal translocating (InterPro:IPR006416), ATPase, P-type phosphorylation site (InterPro:IPR018303); heavy metal atpase 2 (TAIR:AT4G30110.1); Has 40067 Blast hits to 31648 proteins in 3107 species: Archae - 784; Bacteria - 26302; Metazoa - 4194; Fungi - 2461; Plants - 1970; Viruses - 7; Other Eukaryotes - 4349 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G53490.1 | protein_coding | 1:19963267-19966952 | -17.0032 | 182 | 222 | 307 | 276 | RING/U-box superfamily protein Encodes HEI10, a RING finger-containing protein. HEI10 belongs to a group of proteins well conserved among species known as ZMM. Required for class I crossover formation. RING/U-box superfamily protein; Has 175 Blast hits to 173 proteins in 83 species: Archae - 2; Bacteria - 14; Metazoa - 69; Fungi - 24; Plants - 38; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G34560.2 | protein_coding | 2:14560163-14562950 | -16.997 | 542 | 558 | 49 | 33 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT1G80350.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G36480.3 | protein_coding | 2:15302867-15307809 | -16.9969 | 654 | 680 | 2660 | 2634 | ENTH/VHS family protein ENTH/VHS family protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF618 (InterPro:IPR006903), RNA polymerase II, large subunit, CTD (InterPro:IPR006569), Zinc finger, C2H2-type (InterPro:IPR007087), ENTH/VHS (InterPro:IPR008942); PCF11P-similar protein 4 (TAIR:AT4G04885.1); Has 1695 Blast hits to 821 proteins in 229 species: Archae - 0; Bacteria - 223; Metazoa - 395; Fungi - 309; Plants - 134; Viruses - 0; Other Eukaryotes - 634 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G59710.1 | protein_coding | 5:24057378-24062082 | -16.9932 | 599 | 627 | 2673 | 2649 | VIRE2 interacting protein 2Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. VIRE2 interacting protein 2 (VIP2);CONTAINS InterPro DOMAIN/s: NOT2/NOT3/NOT5 (InterPro:IPR007282); NOT2 / NOT3 / NOT5 family (TAIR:AT1G07705.2); Has 3791 Blast hits to 3038 proteins in 463 species: Archae - 1; Bacteria - 1471; Metazoa - 837; Fungi - 516; Plants - 178; Viruses - 9; Other Eukaryotes - 779 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT1G05120.1 | protein_coding | 1:1471323-1476289 | -16.9907 | 568 | 613 | 2588 | 2557 | Helicase protein with RING/U-box domain Helicase protein with RING/U-box domain;FUNCTIONS IN: helicase activity, DNA binding, zinc ion binding, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT1G02670.1); Has 29218 Blast hits to 14448 proteins in 1607 species: Archae - 124; Bacteria - 8622; Metazoa - 6656; Fungi - 6694; Plants - 2674; Viruses - 189; Other Eukaryotes - 4259 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT4G21670.1 | protein_coding | 4:11510989-11517396 | -16.9897 | 1349 | 1393 | 536 | 487 | C-terminal domain phosphatase-like 1 Encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl. C-terminal domain phosphatase-like 1 (CPL1);FUNCTIONS IN: double-stranded RNA binding, phosphatase activity, nucleotide phosphatase activity; INVOLVED IN: abscisic acid mediated signaling pathway, negative regulation of transcription, response to abiotic stimulus; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding (InterPro:IPR001159), NLI interacting factor (InterPro:IPR004274); carboxyl-terminal domain (ctd) phosphatase-like 2 (TAIR:AT5G01270.2); Has 330 Blast hits to 317 proteins in 105 species: Archae - 0; Bacteria - 31; Metazoa - 57; Fungi - 81; Plants - 112; Viruses - 1; Other Eukaryotes - 48 (source: NCBI BLink). | |
| XLOC_007851 | AT1G09517.1 | Ch1:28134653-28135270 | AT3G24255.1 | protein_coding | 3:8788814-8793371 | -16.9881 | 321 | 360 | 45 | 8 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein RNA-directed DNA polymerase (reverse transcriptase)-related family protein;CONTAINS InterPro DOMAIN/s: RNA-directed DNA polymerase (reverse transcriptase), related (InterPro:IPR015706); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G23910.1); Has 2050 Blast hits to 1978 proteins in 93 species: Archae - 11; Bacteria - 19; Metazoa - 133; Fungi - 20; Plants - 1757; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT4G30940.1 | protein_coding | 4:15054873-15056945 | -16.9636 | 1249 | 1271 | 1336 | 1311 | BTB/POZ domain with WD40/YVTN repeat-like proteinBTB/POZ domain with WD40/YVTN repeat-like protein;FUNCTIONS IN: voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BTB/POZ domain with WD40/YVTN repeat-like protein (TAIR:AT2G24240.1); Has 1166 Blast hits to 1152 proteins in 112 species: Archae - 0; Bacteria - 4; Metazoa - 915; Fungi - 4; Plants - 126; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT2G12190.1 | protein_coding | 2:4891642-4893397 | -16.96 | 360 | 382 | 1434 | 1411 | Cytochrome P450 superfamily protein Cytochrome P450 superfamily protein;FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: stem, leaf whorl, male gametophyte, flower, stamen; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 87, subfamily A, polypeptide 6 (TAIR:AT1G64940.1); Has 33026 Blast hits to 32861 proteins in 1697 species: Archae - 49; Bacteria - 3625; Metazoa - 11744; Fungi - 7006; Plants - 9305; Viruses - 3; Other Eukaryotes - 1294 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT5G13030.1 | protein_coding | 5:4133134-4136688 | -16.958 | 637 | 667 | 1911 | 1882 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 5046 Blast hits to 4997 proteins in 1211 species: Archae - 8; Bacteria - 2327; Metazoa - 120; Fungi - 134; Plants - 48; Viruses - 0; Other Eukaryotes - 2409 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT4G37270.1 | protein_coding | 4:17541771-17546546 | -16.9459 | 214 | 245 | 395 | 366 | heavy metal atpase 1 Encodes a P1B-type ATPases that is localized to the chloroplast envelope and is involved in the transport of Cu into chloroplasts. It is essential for growth under high light conditions.heavy metal atpase 1 (HMA1);FUNCTIONS IN: copper-exporting ATPase activity, ATPase activity, calcium-transporting ATPase activity, zinc transporting ATPase activity, cadmium-transporting ATPase activity; INVOLVED IN: cellular copper ion homeostasis, calcium ion transport, response to toxin, zinc ion homeostasis, response to light intensity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, heavy metal translocating (InterPro:IPR006416), ATPase, P-type, ATPase-associated domain (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type, heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating (InterPro:IPR006404), ATPase, P-type phosphorylation site (InterPro:IPR018303); heavy metal atpase 2 (TAIR:AT4G30110.1); Has 36740 Blast hits to 31592 proteins in 3081 species: Archae - 714; Bacteria - 24289; Metazoa - 3807; Fungi - 1794; Plants - 1612; Viruses - 8; Other Eukaryotes - 4516 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.4 | Ch1:22294362-22297374 | AT5G60900.1 | nontranslating_CDS | 5:24498369-24501770 | -16.9431 | 1475 | 1500 | 629 | 605 | receptor-like protein kinase 1 Encodes a receptor-like protein kinase. receptor-like protein kinase 1 (RLK1);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); lectin protein kinase family protein (TAIR:AT1G34300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.1 | Ch1:22294362-22297374 | AT5G60900.1 | nontranslating_CDS | 5:24498369-24501770 | -16.9431 | 1394 | 1419 | 629 | 605 | receptor-like protein kinase 1 Encodes a receptor-like protein kinase. receptor-like protein kinase 1 (RLK1);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); lectin protein kinase family protein (TAIR:AT1G34300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT3G14660.1 | protein_coding | 3:4924777-4927607 | -16.9354 | 1310 | 1339 | 802 | 770 | cytochrome P450, family 72, subfamily A, polypeptide 13 putative cytochrome P450 "cytochrome P450, family 72, subfamily A, polypeptide 13" (CYP72A13);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 72, subfamily A, polypeptide 15 (TAIR:AT3G14690.1); Has 31786 Blast hits to 31657 proteins in 1619 species: Archae - 67; Bacteria - 4951; Metazoa - 11303; Fungi - 6022; Plants - 7953; Viruses - 3; Other Eukaryotes - 1487 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G59910.1 | protein_coding | 3:22130483-22133604 | -16.9302 | 2264 | 2330 | 44 | 9 | Ankyrin repeat family protein Ankyrin repeat family protein;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683); Ankyrin repeat family protein (TAIR:AT2G44090.2); Has 71 Blast hits to 71 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT5G49945.1 | protein_coding | 5:20317405-20319830 | -16.93 | 401 | 435 | 1409 | 1379 | Protein ofunknown function (DUF1682) Protein ofunknown function (DUF1682);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1682 (InterPro:IPR012879); Protein ofunknown function (DUF1682) (TAIR:AT4G24330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G52990.1 | protein_coding | 3:19648711-19652515 | -16.9297 | 49 | 85 | 93 | 62 | Pyruvate kinase family proteinPyruvate kinase family protein;FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: membrane; EXPRESSED IN: guard cell, cultured cell, leaf; EXPRESSED DURING: seedling growth;CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, barrel (InterPro:IPR015793); Pyruvate kinase family protein (TAIR:AT2G36580.1); Has 9836 Blast hits to 9793 proteins in 2683 species: Archae - 167; Bacteria - 5933; Metazoa - 534; Fungi - 219; Plants - 549; Viruses - 0; Other Eukaryotes - 2434 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT2G28810.1 | protein_coding | 2:12363426-12365377 | -16.9246 | 3559 | 3584 | 227 | 204 | Dof-type zinc finger DNA-binding family protein Dof-type zinc finger DNA-binding family protein;CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); Dof-type zinc finger DNA-binding family protein (TAIR:AT1G07640.3); Has 1337 Blast hits to 1306 proteins in 87 species: Archae - 0; Bacteria - 4; Metazoa - 19; Fungi - 22; Plants - 1088; Viruses - 0; Other Eukaryotes - 204 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT2G01420.2 | protein_coding | 2:180033-183764 | -16.9242 | 51 | 84 | 2106 | 2083 | Auxin efflux carrier family proteinEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). PIN-FORMED 4 (PIN4);FUNCTIONS IN: auxin:hydrogen symporter activity, transporter activity; INVOLVED IN: root development, pattern specification process, auxin polar transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Auxin efflux carrier, subgroup (InterPro:IPR014024), Auxin efflux carrier (InterPro:IPR004776); Auxin efflux carrier family protein (TAIR:AT1G70940.1); Has 1823 Blast hits to 1616 proteins in 502 species: Archae - 31; Bacteria - 1046; Metazoa - 18; Fungi - 10; Plants - 487; Viruses - 2; Other Eukaryotes - 229 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G73670.1 | protein_coding | 1:27699871-27703449 | -16.919 | 971 | 989 | 241 | 223 | MAP kinase 15 member of MAP Kinase MAP kinase 15 (MPK15);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), MAP kinase, conserved site (InterPro:IPR003527), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT1G18150.3); Has 118424 Blast hits to 117259 proteins in 3821 species: Archae - 110; Bacteria - 13457; Metazoa - 43793; Fungi - 12258; Plants - 28693; Viruses - 571; Other Eukaryotes - 19542 (source: NCBI BLink). | |
| XLOC_008431 | AT2G04755.1 | Ch2:1480219-1482007 | AT3G15410.2 | protein_coding | 3:5203205-5207574 | -16.9109 | 1075 | 1092 | 235 | 218 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing protein (InterPro:IPR015766), Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); Leucine-rich repeat receptor-like protein kinase family protein (TAIR:AT3G24240.1). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G03140.1 | protein_coding | 3:723878-727531 | -16.9067 | 990 | 1015 | 2285 | 2255 | Tudor/PWWP/MBT superfamily protein Tudor/PWWP/MBT superfamily protein;CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); Tudor/PWWP/MBT superfamily protein (TAIR:AT3G21295.1); Has 426 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 14; Metazoa - 209; Fungi - 70; Plants - 86; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G68980.1 | protein_coding | 1:25932955-25935030 | -16.9043 | 232 | 257 | 1835 | 1810 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G69290.1); Has 15528 Blast hits to 6193 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 63; Plants - 15194; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT1G43770.2 | protein_coding | 1:16548417-16551909 | -16.9016 | 737 | 761 | 563 | 537 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT5G16680.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G75660.1 | protein_coding | 1:28408134-28415118 | -16.9014 | 231 | 250 | 3158 | 3139 | 5'-3' exoribonuclease 3 Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. 5'-3' exoribonuclease 3 (XRN3);CONTAINS InterPro DOMAIN/s: 5'-3' exoribonuclease 2 (InterPro:IPR017151), Zinc finger, CCHC-type (InterPro:IPR001878), Putative 5-3 exonuclease (InterPro:IPR004859); exoribonuclease 2 (TAIR:AT5G42540.1); Has 4264 Blast hits to 3505 proteins in 442 species: Archae - 2; Bacteria - 295; Metazoa - 1361; Fungi - 725; Plants - 751; Viruses - 31; Other Eukaryotes - 1099 (source: NCBI BLink). | |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT1G32490.1 | protein_coding | 1:11742006-11749788 | -16.9009 | 1056 | 1103 | 936 | 895 | RNA helicase family proteinEncodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. ENHANCED SILENCING PHENOTYPE 3 (ESP3);FUNCTIONS IN: helicase activity, ATP-dependent RNA helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: RNA splicing, posttranscriptional gene silencing by RNA, embryo development ending in seed dormancy; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Helicase-associated domain (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Domain ofunknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); helicase domain-containing protein (TAIR:AT2G35340.1); Has 34186 Blast hits to 25955 proteins in 2213 species: Archae - 99; Bacteria - 5536; Metazoa - 12019; Fungi - 3203; Plants - 1844; Viruses - 1463; Other Eukaryotes - 10022 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G26030.1 | protein_coding | 3:9516953-9519563 | -16.8997 | 411 | 447 | 66 | 42 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta protein phosphatase 2A regulatory subunit isoform B' delta serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta (ATB' DELTA);FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: nucleolus, protein phosphatase type 2A complex, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT3G26020.2); Has 1183 Blast hits to 1155 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 568; Fungi - 166; Plants - 302; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_006678 | AT1G07933.1 | Ch1:20052416-20053149 | AT5G07910.1 | protein_coding | 5:2521534-2524390 | -16.8996 | 516 | 538 | 1325 | 1301 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G30105.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G69580.2 | protein_coding | 1:26171856-26174022 | -16.8907 | 170 | 203 | 1122 | 1091 | Homeodomain-like superfamily protein Homeodomain-like superfamily protein;CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); Homeodomain-like superfamily protein (TAIR:AT3G04030.3); Has 1687 Blast hits to 1671 proteins in 68 species: Archae - 0; Bacteria - 6; Metazoa - 4; Fungi - 0; Plants - 1652; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). | |
| XLOC_023238 | AT4G26095.1 | Ch4:13224204-13227622 | AT3G46700.1 | protein_coding | 3:17200167-17202074 | -16.8832 | 2499 | 2528 | 35 | 1 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT3G46680.1); Has 7564 Blast hits to 7513 proteins in 424 species: Archae - 0; Bacteria - 384; Metazoa - 2020; Fungi - 23; Plants - 5006; Viruses - 70; Other Eukaryotes - 61 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT1G55690.1 | protein_coding | 1:20808199-20813061 | -16.8804 | 311 | 328 | 2386 | 2369 | Sec14p-like phosphatidylinositol transfer family protein Sec14p-like phosphatidylinositol transfer family protein;CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); Sec14p-like phosphatidylinositol transfer family protein (TAIR:AT5G56160.1); Has 2150 Blast hits to 2128 proteins in 229 species: Archae - 0; Bacteria - 0; Metazoa - 576; Fungi - 461; Plants - 801; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G47940.1 | protein_coding | 2:19617986-19622301 | -16.8746 | 3106 | 3142 | 54 | 5 | DEGP protease 2 Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. DEGP protease 2 (DEGP2);FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: photosystem II repair, proteolysis; LOCATED IN: chloroplast stromal thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Serine/cysteine peptidase, trypsin-like (InterPro:IPR009003), Serine endopeptidase DegP2 (InterPro:IPR015724), Peptidase S1C, HrtA/DegP2/Q/S (InterPro:IPR001940), Peptidase S1/S6, chymotrypsin/Hap (InterPro:IPR001254), PDZ/DHR/GLGF (InterPro:IPR001478); DegP protease 9 (TAIR:AT5G40200.1); Has 15046 Blast hits to 15035 proteins in 2533 species: Archae - 101; Bacteria - 10614; Metazoa - 317; Fungi - 14; Plants - 376; Viruses - 0; Other Eukaryotes - 3624 (source: NCBI BLink). | |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT2G31210.1 | protein_coding | 2:13296143-13298277 | -16.8738 | 1015 | 1042 | 470 | 443 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: leaf whorl, sepal, flower; EXPRESSED DURING: petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT1G06170.2); Has 1830 Blast hits to 1818 proteins in 133 species: Archae - 2; Bacteria - 0; Metazoa - 18; Fungi - 11; Plants - 1605; Viruses - 5; Other Eukaryotes - 189 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT2G01610.1 | protein_coding | 2:273895-275002 | -16.8721 | 318 | 357 | 648 | 612 | Plant invertase/pectin methylesterase inhibitor superfamily protein Plant invertase/pectin methylesterase inhibitor superfamily protein;FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); Plant invertase/pectin methylesterase inhibitor superfamily protein (TAIR:AT1G14890.1); Has 850 Blast hits to 843 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 850; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G01650.1 | protein_coding | 1:232840-237905 | -16.8616 | 2261 | 2314 | 85 | 42 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4 SIGNAL PEPTIDE PEPTIDASE-LIKE 4 (SPPL4);FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); SIGNAL PEPTIDE PEPTIDASE-LIKE 2 (TAIR:AT1G63690.1); Has 1466 Blast hits to 1433 proteins in 284 species: Archae - 0; Bacteria - 176; Metazoa - 611; Fungi - 153; Plants - 303; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G35680.3 | protein_coding | 5:13857921-13859085 | -16.8594 | 50 | 102 | 196 | 137 | Nucleic acid-binding, OB-fold-like protein Nucleic acid-binding, OB-fold-like protein;FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation initiation factor 1A (eIF-1A), conserved site (InterPro:IPR018104), S1, IF1 type (InterPro:IPR006196), Translation initiation factor 1A (eIF-1A) (InterPro:IPR001253); Nucleic acid-binding, OB-fold-like protein (TAIR:AT2G04520.1). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT3G43250.1 | protein_coding | 3:15216585-15217574 | -16.8583 | 44 | 71 | 648 | 624 | Family ofunknown function (DUF572) Family ofunknown function (DUF572) ;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF572 (InterPro:IPR007590); Family ofunknown function (DUF572) (TAIR:AT2G32050.1); Has 1346 Blast hits to 1149 proteins in 221 species: Archae - 2; Bacteria - 13; Metazoa - 444; Fungi - 243; Plants - 125; Viruses - 0; Other Eukaryotes - 519 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G62910.1 | protein_coding | 5:25250256-25252354 | -16.8557 | 2690 | 2711 | 234 | 213 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT3G48070.2); Has 749 Blast hits to 665 proteins in 188 species: Archae - 0; Bacteria - 6; Metazoa - 241; Fungi - 216; Plants - 135; Viruses - 4; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT4G32285.1 | protein_coding | 4:15585443-15588089 | -16.8474 | 1860 | 1884 | 706 | 682 | ENTH/ANTH/VHS superfamily proteinENTH/ANTH/VHS superfamily protein;FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell;CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT2G25430.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT2G06040.1 | protein_coding | 2:2352145-2355597 | -16.8473 | 632 | 657 | 73 | 49 | CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); RNI-like superfamily protein (TAIR:AT5G21900.1); Has 5028 Blast hits to 2547 proteins in 240 species: Archae - 0; Bacteria - 125; Metazoa - 2326; Fungi - 765; Plants - 1373; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G16950.1 | protein_coding | 2:7353773-7361256 | -16.8436 | 2291 | 2315 | 210 | 186 | transportin 1 Nuclear import receptor for AtGRP7.transportin 1 (TRN1);CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT2G16960.1); Has 1831 Blast hits to 1766 proteins in 228 species: Archae - 0; Bacteria - 2; Metazoa - 686; Fungi - 563; Plants - 278; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G57950.1 | protein_coding | 3:21460335-21461211 | -16.8419 | 154 | 171 | 43 | 26 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G42180.1); Has 81 Blast hits to 81 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_006751 | AT1G08037.1 | Ch1:20588319-20589100 | AT2G18890.1 | protein_coding | 2:8183638-8186851 | -16.8411 | 358 | 398 | 463 | 397 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G18910.1); Has 110693 Blast hits to 109654 proteins in 4007 species: Archae - 94; Bacteria - 12578; Metazoa - 40858; Fungi - 8843; Plants - 32118; Viruses - 387; Other Eukaryotes - 15815 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT2G03140.2 | protein_coding | 2:941829-951553 | -16.8392 | 574 | 593 | 4403 | 4384 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); esterase/lipase/thioesterase family protein (TAIR:AT3G50790.1). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT3G10960.1 | protein_coding | 3:3424813-3427058 | -16.8389 | 1882 | 1924 | 2165 | 2129 | AZA-guanine resistant1 Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). AZA-guanine resistant1 (AZG1);FUNCTIONS IN: transmembrane transporter activity, purine transmembrane transporter activity; INVOLVED IN: purine transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Xanthine/uracil/vitamin C permease (InterPro:IPR006043); Xanthine/uracil permease family protein (TAIR:AT5G50300.1); Has 8325 Blast hits to 8321 proteins in 1933 species: Archae - 105; Bacteria - 6300; Metazoa - 12; Fungi - 117; Plants - 83; Viruses - 0; Other Eukaryotes - 1708 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT3G10060.1 | protein_coding | 3:3102074-3104014 | -16.8388 | 181 | 214 | 203 | 162 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein FKBP-like peptidyl-prolyl cis-trans isomerase family protein;FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); FKBP-like peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT1G20810.1); Has 8406 Blast hits to 7908 proteins in 1571 species: Archae - 44; Bacteria - 4267; Metazoa - 1616; Fungi - 433; Plants - 872; Viruses - 0; Other Eukaryotes - 1174 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT5G65620.1 | protein_coding | 5:26221829-26225903 | -16.8355 | 2946 | 2973 | 320 | 298 | Zincin-like metalloproteases family protein Zincin-like metalloproteases family protein;FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cytosol, chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M3A/M3B, thimet/oligopeptidase F (InterPro:IPR001567); Zincin-like metalloproteases family protein (TAIR:AT5G10540.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT3G48440.1 | protein_coding | 3:17941046-17943855 | -16.8336 | 304 | 329 | 272 | 243 | Zinc finger C-x8-C-x5-C-x3-H type family protein Zinc finger C-x8-C-x5-C-x3-H type family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT5G63260.1); Has 1758 Blast hits to 1034 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 243; Plants - 962; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink). | |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT4G38200.1 | protein_coding | 4:17915206-17922732 | -16.833 | 1310 | 1344 | 242 | 212 | SEC7-like guanine nucleotide exchange family protein SEC7-like guanine nucleotide exchange family protein;FUNCTIONS IN: binding, ARF guanyl-nucleotide exchange factor activity, guanyl-nucleotide exchange factor activity; INVOLVED IN: regulation of ARF protein signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SEC7-like (InterPro:IPR000904), Armadillo-type fold (InterPro:IPR016024), Protein ofunknown function DUF1981, SEC7 associated (InterPro:IPR015403); SEC7-like guanine nucleotide exchange family protein (TAIR:AT4G35380.1); Has 2912 Blast hits to 2618 proteins in 244 species: Archae - 0; Bacteria - 32; Metazoa - 1541; Fungi - 604; Plants - 295; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). | |
| XLOC_004105 | AT1G09927.1 | Ch1:30041286-30041963 | AT3G56100.1 | protein_coding | 3:20816866-20819819 | -16.8291 | 230 | 252 | 1288 | 1266 | meristematic receptor-like kinase Protein kinase expressed in meristematic cells. Phosphorylates AGL24. meristematic receptor-like kinase (MRLK);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Serine/threonine-protein kinase domain (InterPro:IPR002290), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); inflorescence meristem receptor-like kinase 2 (TAIR:AT3G51740.1); Has 154347 Blast hits to 110289 proteins in 3296 species: Archae - 124; Bacteria - 13554; Metazoa - 45622; Fungi - 8090; Plants - 69121; Viruses - 344; Other Eukaryotes - 17492 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G26230.1 | protein_coding | 1:9072256-9075350 | -16.8276 | 673 | 689 | 114 | 98 | TCP-1/cpn60 chaperonin family proteinEncodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230).TCP-1/cpn60 chaperonin family protein;FUNCTIONS IN: ATP binding; INVOLVED IN: protein refolding, cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); chaperonin 60 beta (TAIR:AT1G55490.2); Has 34077 Blast hits to 34022 proteins in 8740 species: Archae - 776; Bacteria - 21861; Metazoa - 1711; Fungi - 1609; Plants - 849; Viruses - 2; Other Eukaryotes - 7269 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G36050.1 | protein_coding | 1:13450089-13453683 | -16.8218 | 1965 | 1999 | 67 | 29 | Endoplasmic reticulum vesicle transporter proteinEndoplasmic reticulum vesicle transporter protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1692 (InterPro:IPR012936); Endoplasmic reticulum vesicle transporter protein (TAIR:AT1G22200.1); Has 1210 Blast hits to 1080 proteins in 199 species: Archae - 0; Bacteria - 0; Metazoa - 398; Fungi - 262; Plants - 277; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G77130.1 | protein_coding | 1:28978864-28981345 | -16.8211 | 829 | 865 | 1793 | 1766 | plant glycogenin-like starch initiation protein 2 Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. plant glycogenin-like starch initiation protein 2 (PGSIP2);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); plant glycogenin-like starch initiation protein 1 (TAIR:AT3G18660.3); Has 1471 Blast hits to 1463 proteins in 343 species: Archae - 0; Bacteria - 240; Metazoa - 259; Fungi - 287; Plants - 508; Viruses - 75; Other Eukaryotes - 102 (source: NCBI BLink). | |
| XLOC_004828 | AT1G11592.2 | Ch1:3895179-3896917 | AT1G77260.1 | protein_coding | 1:29023712-29027108 | -16.8183 | 429 | 456 | 411 | 387 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF248, methyltransferase putative (InterPro:IPR004159); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT2G39750.1); Has 919 Blast hits to 909 proteins in 49 species: Archae - 0; Bacteria - 17; Metazoa - 3; Fungi - 4; Plants - 891; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G27390.1 | protein_coding | 5:9674320-9676219 | -16.8169 | 650 | 679 | 221 | 194 | Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family proteinMog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein;FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124); Has 23 Blast hits to 23 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G64065.1 | protein_coding | 1:23778255-23779529 | -16.8147 | 973 | 997 | 257 | 231 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein familyLate embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 2 (InterPro:IPR004864); Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (TAIR:AT2G46150.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G30630.1 | protein_coding | 1:10858232-10860322 | -16.8139 | 39 | 68 | 95 | 57 | Coatomer epsilon subunit Coatomer epsilon subunit;FUNCTIONS IN: protein transporter activity, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); Coatomer epsilon subunit (TAIR:AT2G34840.1); Has 442 Blast hits to 442 proteins in 180 species: Archae - 6; Bacteria - 14; Metazoa - 175; Fungi - 90; Plants - 92; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.5 | Ch1:12118990-12124001 | AT1G74740.1 | protein_coding | 1:28079946-28082671 | -16.8117 | 511 | 536 | 905 | 875 | calcium-dependent protein kinase 30member of Calcium Dependent Protein Kinase calcium-dependent protein kinase 30 (CPK30);FUNCTIONS IN: calmodulin-dependent protein kinase activity, protein kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation, abscisic acid mediated signaling pathway; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), EF-Hand 1, calcium-binding site (InterPro:IPR018247), Serine/threonine-protein kinase domain (InterPro:IPR002290), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), EF-HAND 2 (InterPro:IPR018249), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); calcium-dependent protein kinase 1 (TAIR:AT1G18890.1); Has 129906 Blast hits to 123880 proteins in 3943 species: Archae - 178; Bacteria - 14335; Metazoa - 48347; Fungi - 17163; Plants - 26785; Viruses - 481; Other Eukaryotes - 22617 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.1 | Ch1:5222729-5224055 | AT5G18190.1 | protein_coding | 5:6009812-6014864 | -16.8091 | 1196 | 1219 | 678 | 657 | Protein kinase family protein Protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase family protein (TAIR:AT3G03940.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT2G06040.1 | protein_coding | 2:2352145-2355597 | -16.8068 | 786 | 807 | 1082 | 1046 | CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); RNI-like superfamily protein (TAIR:AT5G21900.1); Has 5028 Blast hits to 2547 proteins in 240 species: Archae - 0; Bacteria - 125; Metazoa - 2326; Fungi - 765; Plants - 1373; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G28350.1 | protein_coding | 5:10320114-10327374 | -16.8058 | 673 | 693 | 67 | 47 | Quinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factorQuinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factor;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Ribosome control protein 1 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); Quinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factor (TAIR:AT3G61480.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006751 | AT1G08037.1 | Ch1:20588319-20589100 | AT4G18670.1 | protein_coding | 4:10275462-10278794 | -16.8034 | 358 | 402 | 816 | 782 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein;FUNCTIONS IN: structural constituent of cell wall; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210); Leucine-rich repeat (LRR) family protein (TAIR:AT3G24480.1); Has 60217 Blast hits to 20533 proteins in 968 species: Archae - 15; Bacteria - 2115; Metazoa - 6070; Fungi - 1014; Plants - 47629; Viruses - 97; Other Eukaryotes - 3277 (source: NCBI BLink). | |
| XLOC_000642 | AT1G04933.1 | Ch1:4123641-4124165 | AT1G11480.1 | protein_coding | 1:3864043-3867000 | -16.8033 | 176 | 207 | 75 | 40 | eukaryotic translation initiation factor-related eukaryotic translation initiation factor-related; Has 394 Blast hits to 370 proteins in 111 species: Archae - 0; Bacteria - 23; Metazoa - 177; Fungi - 53; Plants - 82; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT3G28790.1 | protein_coding | 3:10813224-10815699 | -16.7944 | 3 | 27 | 650 | 624 | Protein ofunknown function (DUF1216) Protein ofunknown function (DUF1216);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1216 (InterPro:IPR009605); Protein ofunknown function (DUF1216) (TAIR:AT3G28830.1); Has 177545 Blast hits to 90545 proteins in 3397 species: Archae - 691; Bacteria - 36593; Metazoa - 57458; Fungi - 33385; Plants - 8167; Viruses - 3173; Other Eukaryotes - 38078 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G01430.1 | protein_coding | 5:176388-178654 | -16.7944 | 154 | 189 | 88 | 40 | Got1/Sft2-like vescicle transport protein family Got1/Sft2-like vescicle transport protein family;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Vesicle transport protein, Got1/SFT2-like (InterPro:IPR007305); Got1/Sft2-like vescicle transport protein family (TAIR:AT3G49420.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT5G35450.1 | protein_coding | 5:13666524-13671200 | -16.7845 | 24 | 75 | 2761 | 2713 | Disease resistance protein (CC-NBS-LRR class) family Disease resistance protein (CC-NBS-LRR class) family;FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance protein (InterPro:IPR000767); Disease resistance protein (CC-NBS-LRR class) family (TAIR:AT5G43470.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_008692 | AT2G13665.2 | Ch2:5692090-5693030 | AT4G23860.1 | protein_coding | 4:12408950-12411678 | -16.7833 | 488 | 535 | 103 | 61 | PHD finger protein-related PHD finger protein-related;FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, N-recognin (InterPro:IPR003126); Has 484 Blast hits to 449 proteins in 164 species: Archae - 0; Bacteria - 2; Metazoa - 240; Fungi - 124; Plants - 56; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.1 | Ch2:13497140-13502275 | AT5G53590.1 | protein_coding | 5:21771811-21772794 | -16.7793 | 3614 | 3641 | 122 | 95 | SAUR-like auxin-responsive protein familySAUR-like auxin-responsive protein family ;CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); SAUR-like auxin-responsive protein family (TAIR:AT4G00880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT3G48320.1 | protein_coding | 3:17891134-17892847 | -16.7721 | 2 | 26 | 284 | 252 | cytochrome P450, family 71, subfamily A, polypeptide 21 putative cytochrome P450 "cytochrome P450, family 71, subfamily A, polypeptide 21" (CYP71A21);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 71, subfamily A, polypeptide 22 (TAIR:AT3G48310.1); Has 32159 Blast hits to 31925 proteins in 1622 species: Archae - 46; Bacteria - 2978; Metazoa - 11709; Fungi - 6921; Plants - 9489; Viruses - 3; Other Eukaryotes - 1013 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G61930.1 | protein_coding | 5:24865086-24868812 | -16.7706 | 72 | 119 | 386 | 341 | Arabidopsis thaliana protein ofunknown function (DUF794) ACCUMULATION OF PHOTOSYSTEM ONE 3 ACCUMULATION OF PHOTOSYSTEM ONE 3 (APO3); INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF794, plant (InterPro:IPR008512); Arabidopsis thaliana protein ofunknown function (DUF794) (TAIR:AT1G64810.2); Has 145 Blast hits to 119 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G04400.1 | protein_coding | 2:1531148-1533737 | -16.768 | 2446 | 2479 | 325 | 295 | Aldolase-type TIM barrel family protein Aldolase-type TIM barrel family protein;FUNCTIONS IN: indole-3-glycerol-phosphate synthase activity, copper ion binding; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate binding barrel (InterPro:IPR011060), Indole-3-glycerol phosphate synthase, conserved site (InterPro:IPR001468), Indole-3-glycerol phosphate synthase (InterPro:IPR013798); Aldolase-type TIM barrel family protein (TAIR:AT5G48220.1); Has 8050 Blast hits to 8050 proteins in 2237 species: Archae - 197; Bacteria - 5328; Metazoa - 3; Fungi - 164; Plants - 82; Viruses - 0; Other Eukaryotes - 2276 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G03190.1 | protein_coding | 1:775527-780062 | -16.7667 | 387 | 411 | 56 | 33 | RAD3-like DNA-binding helicase protein UV damage and heat induce a common stress response in plants that leads to tissue death and reduced chloroplast function. The UVH6 product is suggested to be a negative regulator of this response. ULTRAVIOLET HYPERSENSITIVE 6 (UVH6);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: DNA repair, response to UV, response to heat; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (InterPro:IPR014013), Xeroderma pigmentosum group D protein (InterPro:IPR001945), Helicase-like, DEXD box c2 type (InterPro:IPR006554), Helicase, ATP-dependent, c2 type (InterPro:IPR006555), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD2 (InterPro:IPR010614), DNA helicase (DNA repair), Rad3 type (InterPro:IPR013020), Protein ofunknown function DUF1227 (InterPro:IPR010643); RAD3-like DNA-binding helicase protein (TAIR:AT1G20720.1); Has 3290 Blast hits to 2576 proteins in 779 species: Archae - 308; Bacteria - 1186; Metazoa - 653; Fungi - 359; Plants - 198; Viruses - 2; Other Eukaryotes - 584 (source: NCBI BLink). | |
| XLOC_007472 | AT1G08973.2 | Ch1:25596554-25596989 | AT5G51050.1 | protein_coding | 5:20753040-20756137 | -16.7656 | 585 | 606 | 428 | 405 | Mitochondrial substrate carrier family protein Encodes a mitochondrial ATP-Mg/Pi transporter. Binds to calcium. Mitochondrial substrate carrier family protein;FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Mitochondrial substrate carrier family protein (TAIR:AT5G07320.1); Has 35093 Blast hits to 20803 proteins in 1083 species: Archae - 0; Bacteria - 15; Metazoa - 13922; Fungi - 9690; Plants - 7280; Viruses - 2; Other Eukaryotes - 4184 (source: NCBI BLink). | |
| XLOC_021635 | AT4G09605.1 | Ch4:17706331-17707283 | AT3G03490.1 | protein_coding | 3:830116-831997 | -16.7645 | 489 | 505 | 340 | 324 | peroxin 19-1 Encodes one of two PEX19 peroxin isoforms. It is predominantly cytosolic and forms dimers.peroxin 19-1 (PEX19-1);CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); peroxin 19-2 (TAIR:AT5G17550.1); Has 637 Blast hits to 625 proteins in 250 species: Archae - 3; Bacteria - 161; Metazoa - 169; Fungi - 149; Plants - 43; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT4G14990.1 | protein_coding | 4:8565622-8569871 | -16.7574 | 2680 | 2711 | 68 | 32 | Topoisomerase II-associated protein PAT1 Topoisomerase II-associated protein PAT1; Topoisomerase II-associated protein PAT1 (TAIR:AT3G22270.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_003208 | AT1G64572.1 | Ch1:23984011-23984795 | AT3G05850.1 | protein_coding | 3:1743413-1746785 | -16.7497 | 181 | 231 | 2523 | 2472 | odes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). Mutator-like transposase family, has a 1.9e-58 P-value blast match to GB:AAA21566 mudrA of transposon="MuDR" (MuDr-element) (Zea mays) | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G36490.1 | protein_coding | 4:17221885-17225088 | -16.7479 | 48 | 75 | 1717 | 1690 | SEC14-like 12 SEC14-like 12 (SFH12);CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); Sec14p-like phosphatidylinositol transfer family protein (TAIR:AT2G18180.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.3 | Ch2:18682089-18684072 | AT2G42080.1 | protein_coding | 2:17553204-17555673 | -16.7451 | 1348 | 1371 | 579 | 556 | Chaperone DnaJ-domain superfamily proteinChaperone DnaJ-domain superfamily protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Chaperone DnaJ-domain superfamily protein (TAIR:AT3G58020.1); Has 1438 Blast hits to 1435 proteins in 312 species: Archae - 0; Bacteria - 313; Metazoa - 345; Fungi - 73; Plants - 359; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). | |
| XLOC_008692 | AT2G13665.2 | Ch2:5692090-5693030 | AT5G62220.1 | protein_coding | 5:24988214-24990331 | -16.7428 | 551 | 589 | 266 | 227 | glycosyltransferase 18 Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. glycosyltransferase 18 (GT18);FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); Exostosin family protein (TAIR:AT2G20370.1); Has 691 Blast hits to 690 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 667; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G18830.1 | protein_coding | 4:10336566-10338674 | -16.7361 | 141 | 171 | 303 | 273 | ovate family protein 5 Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1. ovate family protein 5 (OFP5);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF623 (InterPro:IPR006458); ovate family protein 4 (TAIR:AT1G06920.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.3 | Ch1:9726607-9730185 | AT1G09130.3 | protein_coding | 1:2939568-2942345 | -16.7352 | 603 | 651 | 160 | 92 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein ATP-dependent caseinolytic (Clp) protease/crotonase family protein;FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: mitochondrion, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); CLP protease proteolytic subunit 1 (TAIR:AT1G49970.1). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT2G16870.1 | protein_coding | 2:7307970-7311796 | -16.7332 | 631 | 653 | 27 | 4 | Disease resistance protein (TIR-NBS-LRR class) family Disease resistance protein (TIR-NBS-LRR class) family;FUNCTIONS IN: transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, apoptosis, defense response, innate immune response; LOCATED IN: intrinsic to membrane;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157), Disease resistance protein (InterPro:IPR000767); Disease resistance protein (TIR-NBS-LRR class) family (TAIR:AT1G64070.1); Has 20392 Blast hits to 15740 proteins in 660 species: Archae - 17; Bacteria - 1396; Metazoa - 2110; Fungi - 75; Plants - 16264; Viruses - 0; Other Eukaryotes - 530 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.2 | Ch1:19496461-19497686 | AT1G18700.4 | protein_coding | 1:6437474-6444076 | -16.7309 | 21 | 53 | 2157 | 2120 | DNAJ heat shock N-terminal domain-containing protein DNAJ heat shock N-terminal domain-containing protein;FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Thioredoxin-like fold (InterPro:IPR012336). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT3G18750.1 | protein_coding | 3:6454013-6457613 | -16.726 | 6 | 56 | 1729 | 1678 | with no lysine (K) kinase 6Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. with no lysine (K) kinase 6 (WNK6);CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G49160.2); Has 109997 Blast hits to 108787 proteins in 3825 species: Archae - 81; Bacteria - 10561; Metazoa - 41131; Fungi - 10681; Plants - 29357; Viruses - 431; Other Eukaryotes - 17755 (source: NCBI BLink). | |
| XLOC_002565 | AT1G07887.1 | Ch1:19963067-19964105 | AT5G47800.1 | protein_coding | 5:19353532-19356448 | -16.7173 | 510 | 535 | 1863 | 1833 | Phototropic-responsive NPH3 family protein Phototropic-responsive NPH3 family protein;FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); Phototropic-responsive NPH3 family protein (TAIR:AT1G67900.3); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G01370.1 | protein_coding | 4:566917-570299 | -16.7156 | 8 | 38 | 343 | 312 | MAP kinase 4 Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1 and probably MAP65-1.The MAP65-1 interaction is involved in mediating cortical microtuble organization. Required for male-specific meiotic cytokinesis. MAP kinase 4 (MPK4);FUNCTIONS IN: MAP kinase activity, kinase activity; INVOLVED IN: in 14 processes; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), JNK MAP kinase (InterPro:IPR008351), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), MAP kinase, conserved site (InterPro:IPR003527), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); MAP kinase 11 (TAIR:AT1G01560.2); Has 123445 Blast hits to 122024 proteins in 4656 species: Archae - 100; Bacteria - 13145; Metazoa - 47072; Fungi - 12439; Plants - 29862; Viruses - 477; Other Eukaryotes - 20350 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT5G53570.2 | protein_coding | 5:21760558-21763462 | -16.7132 | 424 | 448 | 385 | 355 | Ypt/Rab-GAP domain of gyp1p superfamily protein Ypt/Rab-GAP domain of gyp1p superfamily protein;FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT3G49350.1); Has 4559 Blast hits to 4121 proteins in 234 species: Archae - 0; Bacteria - 21; Metazoa - 2510; Fungi - 811; Plants - 657; Viruses - 1; Other Eukaryotes - 559 (source: NCBI BLink). | |
| XLOC_018271 | AT3G45638.1 | Ch3:16755215-16756263 | AT5G10610.1 | protein_coding | 5:3353442-3355124 | -16.71 | 347 | 365 | 1313 | 1295 | cytochrome P450, family 81, subfamily K, polypeptide 1 member of CYP81K "cytochrome P450, family 81, subfamily K, polypeptide 1" (CYP81K1);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 81, subfamily K, polypeptide 2 (TAIR:AT5G10600.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G00060.1 | protein_coding | 4:21351-29064 | -16.7089 | 2933 | 2972 | 339 | 300 | Nucleotidyltransferase family protein maternal effect embryo arrest 44 (MEE44);FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: embryo development ending in seed dormancy;CONTAINS InterPro DOMAIN/s: Nucleotidyl transferase domain (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); Nucleotidyltransferase family protein (TAIR:AT5G53770.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029693 | AT5G43403.1 | Ch5:17430539-17431765 | AT3G60030.1 | protein_coding | 3:22165580-22169984 | -16.7074 | 592 | 633 | 395 | 357 | squamosa promoter-binding protein-like 12squamosa promoter-binding protein-like 12 (SPL12);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Transcription factor, SBP-box (InterPro:IPR004333); squamosa promoter binding protein-like 1 (TAIR:AT2G47070.1); Has 969 Blast hits to 908 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 21; Fungi - 0; Plants - 938; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G58760.1 | protein_coding | 5:23730450-23733707 | -16.7007 | 233 | 271 | 1610 | 1560 | damaged DNA binding 2Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity.damaged DNA binding 2 (DDB2);FUNCTIONS IN: nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA repair, response to UV-B; LOCATED IN: nucleus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), Zinc finger, CCHC-type (InterPro:IPR001878), WD40 repeat, subgroup (InterPro:IPR019781); DROUGHT SENSITIVE 1 (TAIR:AT1G80710.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G01320.1 | protein_coding | 3:106294-113679 | -16.6998 | 235 | 263 | 4133 | 4107 | SIN3-like 1Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190). SIN3-like 1 (SNL1);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Histone deacetylase interacting (InterPro:IPR013194), Paired amphipathic helix (InterPro:IPR003822); SIN3-like 2 (TAIR:AT5G15020.2); Has 8924 Blast hits to 4656 proteins in 481 species: Archae - 44; Bacteria - 2736; Metazoa - 2712; Fungi - 1300; Plants - 581; Viruses - 181; Other Eukaryotes - 1370 (source: NCBI BLink). | |
| XLOC_000802 | AT1G05133.1 | Ch1:5146658-5147266 | AT3G26150.1 | protein_coding | 3:9565627-9567226 | -16.6986 | 170 | 189 | 657 | 638 | cytochrome P450, family 71, subfamily B, polypeptide 16 putative cytochrome P450 "cytochrome P450, family 71, subfamily B, polypeptide 16" (CYP71B16);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 71, subfamily B, polypeptide 17 (TAIR:AT3G26160.1); Has 32381 Blast hits to 32138 proteins in 1637 species: Archae - 44; Bacteria - 2936; Metazoa - 11906; Fungi - 6889; Plants - 9492; Viruses - 3; Other Eukaryotes - 1111 (source: NCBI BLink). | |
| XLOC_007253 | AT1G08727.1 | Ch1:24051980-24052457 | AT1G02110.1 | protein_coding | 1:392831-395528 | -16.6955 | 265 | 296 | 2217 | 2189 | Protein ofunknown function (DUF630 and DUF632) Protein ofunknown function (DUF630 and DUF632);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF630 (InterPro:IPR006868), Protein ofunknown function DUF632 (InterPro:IPR006867); Protein ofunknown function (DUF630 and DUF632) (TAIR:AT3G60320.1); Has 861 Blast hits to 735 proteins in 117 species: Archae - 0; Bacteria - 21; Metazoa - 78; Fungi - 83; Plants - 611; Viruses - 12; Other Eukaryotes - 56 (source: NCBI BLink). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT4G34660.1 | protein_coding | 4:16545190-16548494 | -16.6955 | 356 | 381 | 139 | 110 | SH3 domain-containing protein SH3 domain-containing protein;CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); SH3 domain-containing protein (TAIR:AT4G18060.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G14360.1 | protein_coding | 4:8267289-8271176 | -16.6882 | 2780 | 2804 | 40 | 15 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF248, methyltransferase putative (InterPro:IPR004159); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G23300.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.1 | Ch5:16534231-16535279 | AT1G67000.1 | protein_coding | 1:25003818-25007647 | -16.6882 | 632 | 649 | 91 | 74 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: stem;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G66930.1); Has 113853 Blast hits to 112150 proteins in 4512 species: Archae - 151; Bacteria - 11870; Metazoa - 43414; Fungi - 9147; Plants - 32426; Viruses - 293; Other Eukaryotes - 16552 (source: NCBI BLink). | |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT2G33390.1 | protein_coding | 2:14150993-14153118 | -16.686 | 53 | 84 | 160 | 129 | unknown protein; Has 34 Blast hits to 34 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT3G53630.1 | protein_coding | 3:19883787-19885938 | -16.6851 | 299 | 331 | 583 | 551 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G18692.1); Has 42 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT3G05675.2 | protein_coding | 3:1657758-1660429 | -16.6788 | 24 | 62 | 37 | 1 | BTB/POZ domain-containing proteinBTB/POZ domain-containing protein;CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G10800.1); Has 259 Blast hits to 259 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 257; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_009092 | AT2G21187.1 | Ch2:9076289-9077494 | AT2G38410.1 | protein_coding | 2:16086514-16090274 | -16.677 | 490 | 531 | 1527 | 1489 | ENTH/VHS/GAT family protein ENTH/VHS/GAT family protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); ENTH/VHS/GAT family protein (TAIR:AT5G01760.1); Has 42231 Blast hits to 23362 proteins in 1216 species: Archae - 12; Bacteria - 2643; Metazoa - 15006; Fungi - 7319; Plants - 4169; Viruses - 367; Other Eukaryotes - 12715 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G15120.1 | protein_coding | 3:5088093-5095965 | -16.676 | 53 | 76 | 819 | 797 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); cell division cycle protein 48-related / CDC48-related (TAIR:AT1G05910.1); Has 80986 Blast hits to 58843 proteins in 3591 species: Archae - 1718; Bacteria - 20912; Metazoa - 22400; Fungi - 8848; Plants - 5536; Viruses - 480; Other Eukaryotes - 21092 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.3 | Ch3:23422590-23425169 | AT3G11810.1 | protein_coding | 3:3727771-3729059 | -16.6718 | 45 | 78 | 166 | 135 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G03330.1); Has 141 Blast hits to 141 proteins in 21 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 131; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.1 | Ch1:19496461-19497686 | AT4G01960.1 | protein_coding | 4:850914-853329 | -16.6612 | 61 | 89 | 529 | 502 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G02380.1); Has 67 Blast hits to 67 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G03150.1 | protein_coding | 2:951888-959236 | -16.6565 | 48 | 93 | 3759 | 3713 | ATP/GTP-binding protein familyembryo defective 1579 (emb1579);FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryo development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_025053 | AT5G18255.2 | Ch5:6035619-6037641 | AT4G15360.1 | protein_coding | 4:8770180-8771960 | -16.6563 | 1191 | 1241 | 1350 | 1315 | cytochrome P450, family 705, subfamily A, polypeptide 3 member of CYP705A "cytochrome P450, family 705, subfamily A, polypeptide 3" (CYP705A3);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 705, subfamily A, polypeptide 32 (TAIR:AT3G20950.1); Has 32425 Blast hits to 32215 proteins in 1647 species: Archae - 54; Bacteria - 3233; Metazoa - 11564; Fungi - 7006; Plants - 9384; Viruses - 6; Other Eukaryotes - 1178 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G59710.1 | protein_coding | 5:24057378-24062082 | -16.6556 | 2288 | 2330 | 2675 | 2646 | VIRE2 interacting protein 2Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator. VIRE2 interacting protein 2 (VIP2);CONTAINS InterPro DOMAIN/s: NOT2/NOT3/NOT5 (InterPro:IPR007282); NOT2 / NOT3 / NOT5 family (TAIR:AT1G07705.2); Has 3791 Blast hits to 3038 proteins in 463 species: Archae - 1; Bacteria - 1471; Metazoa - 837; Fungi - 516; Plants - 178; Viruses - 9; Other Eukaryotes - 779 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.1 | Ch1:19496461-19497686 | AT3G60300.2 | protein_coding | 3:22285138-22287548 | -16.6535 | 63 | 85 | 1169 | 1146 | RWD domain-containing protein RWD domain-containing protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Zinc finger, RING-type (InterPro:IPR001841), RWD (InterPro:IPR006575). | |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT2G27600.1 | protein_coding | 2:11780896-11783992 | -16.6486 | 386 | 402 | 45 | 29 | AAA-type ATPase family protein Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. SUPPRESSOR OF K+ TRANSPORT GROWTH DEFECT1 (SKD1);FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: vesicle-mediated transport, endosome organization; LOCATED IN: cytoplasm, multivesicular body; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Vps4 oligomerisation, C-terminal (InterPro:IPR015415), MIT (InterPro:IPR007330); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT1G80350.1); Has 30691 Blast hits to 28172 proteins in 3117 species: Archae - 1476; Bacteria - 10868; Metazoa - 5113; Fungi - 3519; Plants - 2854; Viruses - 27; Other Eukaryotes - 6834 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G14880.1 | protein_coding | 5:4813931-4817881 | -16.6466 | 2607 | 2630 | 1481 | 1460 | Potassium transporter family protein Potassium transporter family protein;FUNCTIONS IN: potassium ion transmembrane transporter activity; INVOLVED IN: potassium ion transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Potassium uptake protein, kup (InterPro:IPR018519), K+ potassium transporter (InterPro:IPR003855); K+ uptake permease 6 (TAIR:AT1G70300.1); Has 3431 Blast hits to 3392 proteins in 1031 species: Archae - 13; Bacteria - 2398; Metazoa - 1; Fungi - 104; Plants - 790; Viruses - 4; Other Eukaryotes - 121 (source: NCBI BLink). | |
| XLOC_011416 | AT2G18440.2 | Ch2:7994941-7997239 | AT4G39170.1 | protein_coding | 4:18240605-18243795 | -16.6448 | 428 | 449 | 2182 | 2161 | Sec14p-like phosphatidylinositol transfer family protein Sec14p-like phosphatidylinositol transfer family protein;FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); Sec14p-like phosphatidylinositol transfer family protein (TAIR:AT2G21520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.1 | Ch1:19496461-19497686 | AT4G23850.1 | protein_coding | 4:12403454-12408421 | -16.6444 | 61 | 78 | 63 | 46 | AMP-dependent synthetase and ligase family protein long-chain acyl-CoA synthetase 4 (LACS4);FUNCTIONS IN: catalytic activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); AMP-dependent synthetase and ligase family protein (TAIR:AT4G11030.1); Has 52797 Blast hits to 49694 proteins in 3271 species: Archae - 966; Bacteria - 33480; Metazoa - 2301; Fungi - 1946; Plants - 2035; Viruses - 1; Other Eukaryotes - 12068 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT1G10610.1 | protein_coding | 1:3506186-3509006 | -16.6443 | 1025 | 1046 | 300 | 276 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G16910.1); Has 1439 Blast hits to 1421 proteins in 116 species: Archae - 0; Bacteria - 21; Metazoa - 63; Fungi - 6; Plants - 1338; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT3G05450.1 | protein_coding | 3:1573909-1576418 | -16.6434 | 1233 | 1264 | 253 | 219 | CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); Cystatin/monellin superfamily protein (TAIR:AT3G05685.1); Has 2098 Blast hits to 1525 proteins in 202 species: Archae - 2; Bacteria - 561; Metazoa - 485; Fungi - 302; Plants - 191; Viruses - 20; Other Eukaryotes - 537 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G55510.1 | protein_coding | 1:20723279-20725747 | -16.6427 | 259 | 285 | 868 | 845 | branched-chain alpha-keto acid decarboxylase E1 beta subunit branched-chain alpha-keto acid decarboxylase E1 beta branched-chain alpha-keto acid decarboxylase E1 beta subunit (BCDH BETA1);FUNCTIONS IN: 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase-like, C-terminal (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase-like, pyrimidine-binding domain (InterPro:IPR005475); Transketolase family protein (TAIR:AT3G13450.1); Has 16577 Blast hits to 16568 proteins in 2706 species: Archae - 211; Bacteria - 10745; Metazoa - 523; Fungi - 224; Plants - 389; Viruses - 0; Other Eukaryotes - 4485 (source: NCBI BLink). | |
| XLOC_000642 | AT1G04933.1 | Ch1:4123641-4124165 | AT2G32430.1 | protein_coding | 2:13771296-13774502 | -16.6423 | 308 | 338 | 966 | 929 | Galactosyltransferase family protein Galactosyltransferase family protein;FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); Galactosyltransferase family protein (TAIR:AT1G05170.2); Has 1395 Blast hits to 1385 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 768; Fungi - 2; Plants - 602; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). | |
| XLOC_000580 | AT1G11185.1 | Ch1:3749510-3750035 | AT2G25680.1 | protein_coding | 2:10933005-10934604 | -16.6419 | 24 | 78 | 684 | 635 | molybdate transporter 1 Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. molybdate transporter 1 (MOT1);FUNCTIONS IN: molybdate ion transmembrane transporter activity, sulfate transmembrane transporter activity; INVOLVED IN: molybdate ion transport; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; sulfate transmembrane transporters (TAIR:AT1G80310.1); Has 761 Blast hits to 750 proteins in 291 species: Archae - 26; Bacteria - 503; Metazoa - 6; Fungi - 58; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT1G09730.1 | protein_coding | 1:3147637-3154404 | -16.6377 | 10 | 45 | 3038 | 3008 | Cysteine proteinases superfamily protein Cysteine proteinases superfamily protein;FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase C48, SUMO/Sentrin/Ubl1 (InterPro:IPR003653); Cysteine proteinases superfamily protein (TAIR:AT4G33620.1); Has 1713 Blast hits to 1567 proteins in 224 species: Archae - 4; Bacteria - 15; Metazoa - 815; Fungi - 324; Plants - 268; Viruses - 7; Other Eukaryotes - 280 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT1G62530.1 | protein_coding | 1:23146200-23148367 | -16.6364 | 365 | 385 | 278 | 258 | Plant protein ofunknown function (DUF863) Plant protein ofunknown function (DUF863);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF863, plant (InterPro:IPR008581); Plant protein ofunknown function (DUF863) (TAIR:AT1G12120.1); Has 96 Blast hits to 90 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G15730.2 | protein_coding | 5:5130449-5133267 | -16.633 | 709 | 743 | 1438 | 1416 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G54590.2); Has 117437 Blast hits to 116208 proteins in 4662 species: Archae - 111; Bacteria - 12502; Metazoa - 44353; Fungi - 9876; Plants - 32963; Viruses - 432; Other Eukaryotes - 17200 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G22680.1 | protein_coding | 1:8024967-8026356 | -16.6307 | 1791 | 1816 | 424 | 392 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G71970.1); Has 44 Blast hits to 44 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G34100.1 | protein_coding | 4:16330366-16335247 | -16.6262 | 971 | 993 | 220 | 198 | RING/U-box superfamily protein Encodes a protein involved in cuticular wax biosynthesis. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, RING-CH-type (InterPro:IPR011016); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT4G32670.1); Has 2169 Blast hits to 1906 proteins in 224 species: Archae - 0; Bacteria - 0; Metazoa - 966; Fungi - 273; Plants - 550; Viruses - 44; Other Eukaryotes - 336 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G03490.1 | protein_coding | 5:871204-873072 | -16.6243 | 972 | 999 | 1179 | 1152 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity, UDP-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT1G51210.1); Has 6070 Blast hits to 5962 proteins in 306 species: Archae - 0; Bacteria - 104; Metazoa - 824; Fungi - 18; Plants - 5054; Viruses - 30; Other Eukaryotes - 40 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT3G54760.1 | protein_coding | 3:20269024-20272504 | -16.623 | 422 | 444 | 2862 | 2840 | dentin sialophosphoprotein-related dentin sialophosphoprotein-related; INVOLVED IN: biological_processunknown; LOCATED IN: cytosol; EXPRESSED IN: guard cell, cultured cell; Tudor/PWWP/MBT superfamily protein (TAIR:AT5G02950.1); Has 25330 Blast hits to 15408 proteins in 1388 species: Archae - 237; Bacteria - 6371; Metazoa - 7552; Fungi - 2715; Plants - 1153; Viruses - 230; Other Eukaryotes - 7072 (source: NCBI BLink). | |
| XLOC_023962 | AT4G38545.2 | Ch4:18022932-18025298 | AT5G07120.1 | protein_coding | 5:2206894-2209556 | -16.623 | 757 | 781 | 740 | 716 | sorting nexin 2BEncodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. sorting nexin 2B (SNX2b);FUNCTIONS IN: phospholipid binding; INVOLVED IN: vesicle-mediated transport, intracellular signaling pathway; LOCATED IN: membrane; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); sorting nexin 2A (TAIR:AT5G58440.1); Has 2399 Blast hits to 2386 proteins in 279 species: Archae - 13; Bacteria - 100; Metazoa - 1366; Fungi - 555; Plants - 146; Viruses - 0; Other Eukaryotes - 219 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G09390.1 | protein_coding | 5:2913482-2915979 | -16.6221 | 799 | 841 | 652 | 611 | CD2-binding protein-related CD2-binding protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; suppressor of abi3-5 (TAIR:AT3G54230.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT5G15470.1 | protein_coding | 5:5020941-5024750 | -16.6215 | 1228 | 1250 | 2555 | 2531 | galacturonosyltransferase 14 Encodes a protein with putative galacturonosyltransferase activity. galacturonosyltransferase 14 (GAUT14);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); galacturonosyltransferase 13 (TAIR:AT3G01040.2); Has 1751 Blast hits to 1745 proteins in 385 species: Archae - 0; Bacteria - 750; Metazoa - 147; Fungi - 0; Plants - 822; Viruses - 2; Other Eukaryotes - 30 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT5G10946.1 | protein_coding | 5:3455402-3457627 | -16.6136 | 426 | 451 | 46 | 22 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G09710.2 | protein_coding | 1:3140862-3144381 | -16.6087 | 2601 | 2627 | 1630 | 1600 | Homeodomain-like superfamily protein Homeodomain-like superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription;CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); Homeodomain-like superfamily protein (TAIR:AT1G58220.1). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G66640.2 | protein_coding | 5:26599351-26602034 | -16.6059 | 971 | 994 | 1433 | 1410 | DA1-related protein 3 DA1-related protein 3 (DAR3);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3633 (InterPro:IPR022087); DA1-related protein 6 (TAIR:AT5G66620.1). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G57570.2 | protein_coding | 3:21312498-21320481 | -16.6028 | 152 | 170 | 3476 | 3458 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G02800.1 | protein_coding | 2:795515-799591 | -16.6025 | 672 | 691 | 36 | 17 | protein kinase 2B Encodes protein kinase APK2b. protein kinase 2B (APK2B);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); protein kinase 2A (TAIR:AT1G14370.1); Has 113663 Blast hits to 112197 proteins in 3955 species: Archae - 101; Bacteria - 13127; Metazoa - 42007; Fungi - 9244; Plants - 32902; Viruses - 370; Other Eukaryotes - 15912 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G64040.1 | protein_coding | 1:23758241-23760663 | -16.5981 | 530 | 558 | 1362 | 1340 | type one serine/threonine protein phosphatase 3 Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. type one serine/threonine protein phosphatase 3 (TOPP3);CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (InterPro:IPR006186); Calcineurin-like metallo-phosphoesterase superfamily protein (TAIR:AT4G11240.1); Has 6826 Blast hits to 6627 proteins in 481 species: Archae - 78; Bacteria - 203; Metazoa - 2409; Fungi - 1417; Plants - 984; Viruses - 0; Other Eukaryotes - 1735 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G73200.1 | protein_coding | 1:27523043-27526818 | -16.5944 | 673 | 699 | 35 | 6 | Putative integral membrane protein conserved region (DUF2404) Putative integral membrane protein conserved region (DUF2404);FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2404, transmembrane (InterPro:IPR019411), Pleckstrin homology (InterPro:IPR001849); Putative integral membrane protein conserved region (DUF2404) (TAIR:AT1G17820.1); Has 453 Blast hits to 336 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 247; Plants - 53; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
| XLOC_023962 | AT4G38545.2 | Ch4:18022932-18025298 | AT1G11630.1 | protein_coding | 1:3912754-3914465 | -16.5921 | 0 | 44 | 138 | 92 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); pentatricopeptide repeat 336 (TAIR:AT1G61870.1); Has 27426 Blast hits to 8035 proteins in 245 species: Archae - 4; Bacteria - 14; Metazoa - 220; Fungi - 290; Plants - 26279; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT1G02520.1 | protein_coding | 1:523536-529069 | -16.5861 | 48 | 96 | 137 | 100 | P-glycoprotein 11 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. P-glycoprotein 11 (PGP11);FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane; EXPRESSED IN: callus;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); P-glycoprotein 12 (TAIR:AT1G02530.1); Has 844961 Blast hits to 391444 proteins in 4162 species: Archae - 14749; Bacteria - 659839; Metazoa - 18308; Fungi - 13140; Plants - 9783; Viruses - 35; Other Eukaryotes - 129107 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT3G06260.1 | protein_coding | 3:1892964-1895091 | -16.5859 | 236 | 258 | 962 | 940 | galacturonosyltransferase-like 4Encodes a protein with putative galacturonosyltransferase activity. galacturonosyltransferase-like 4 (GATL4);FUNCTIONS IN: transferase activity, transferring hexosyl groups, polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); galacturonosyltransferase-like 3 (TAIR:AT1G13250.1); Has 2860 Blast hits to 2846 proteins in 632 species: Archae - 2; Bacteria - 1548; Metazoa - 358; Fungi - 53; Plants - 770; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). | |
| XLOC_011469 | AT2G07225.1 | Ch2:8447744-8448283 | AT3G21990.1 | protein_coding | 3:7749247-7750602 | -16.5845 | 63 | 79 | 89 | 73 | Domain ofunknown function (DUF26) Domain ofunknown function (DUF26);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF26 (InterPro:IPR002902); Domain ofunknown function (DUF26) (TAIR:AT4G20670.1); Has 1420 Blast hits to 1390 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1420; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G27700.1 | protein_coding | 3:10256895-10261975 | -16.5741 | 2686 | 2711 | 80 | 50 | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 3784 Blast hits to 2558 proteins in 341 species: Archae - 8; Bacteria - 515; Metazoa - 625; Fungi - 291; Plants - 164; Viruses - 7; Other Eukaryotes - 2174 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT1G02520.1 | protein_coding | 1:523536-529069 | -16.5739 | 291 | 310 | 3764 | 3745 | P-glycoprotein 11 Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. P-glycoprotein 11 (PGP11);FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane; EXPRESSED IN: callus;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140), ABC transporter, conserved site (InterPro:IPR017871); P-glycoprotein 12 (TAIR:AT1G02530.1); Has 844961 Blast hits to 391444 proteins in 4162 species: Archae - 14749; Bacteria - 659839; Metazoa - 18308; Fungi - 13140; Plants - 9783; Viruses - 35; Other Eukaryotes - 129107 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT3G48060.1 | protein_coding | 3:17742989-17748785 | -16.5633 | 2778 | 2806 | 41 | 13 | BAH domain ;TFIIS helical bundle-like domain BAH domain ;TFIIS helical bundle-like domain;FUNCTIONS IN: transcription regulator activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Transcription factor IIS, N-terminal (InterPro:IPR017923), Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (InterPro:IPR003617), Bromo adjacent homology (BAH) domain (InterPro:IPR001025), Transcription elongation factor, TFIIS/elongin A/CRSP70, N-terminal (InterPro:IPR010990); BAH domain ;TFIIS helical bundle-like domain (TAIR:AT3G48050.2); Has 5615 Blast hits to 3296 proteins in 434 species: Archae - 6; Bacteria - 1034; Metazoa - 2145; Fungi - 615; Plants - 463; Viruses - 15; Other Eukaryotes - 1337 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT5G20270.1 | protein_coding | 5:6840833-6842946 | -16.5607 | 3591 | 3639 | 879 | 830 | heptahelical transmembrane protein1heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors heptahelical transmembrane protein1 (HHP1);FUNCTIONS IN: receptor activity; INVOLVED IN: response to salt stress, response to hormone stimulus, response to sucrose stimulus; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Hly-III related (InterPro:IPR004254); heptahelical transmembrane protein2 (TAIR:AT4G30850.2); Has 2727 Blast hits to 2656 proteins in 794 species: Archae - 0; Bacteria - 1143; Metazoa - 823; Fungi - 356; Plants - 236; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). | |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT1G51740.1 | protein_coding | 1:19188799-19191372 | -16.5575 | 819 | 835 | 37 | 21 | syntaxin of plants 81 member of SYP8 Gene Family syntaxin of plants 81 (SYP81); INVOLVED IN: vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), SNARE-complex protein Syntaxin-18 N-terminal (InterPro:IPR019529); Has 429 Blast hits to 426 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 200; Fungi - 82; Plants - 110; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | |
| XLOC_000642 | AT1G04933.2 | Ch1:4123641-4124165 | AT5G12230.1 | protein_coding | 5:3953140-3956185 | -16.5561 | 0 | 27 | 340 | 318 | MED19A; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G19480.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G71310.2 | protein_coding | 1:26877745-26880064 | -16.5544 | 601 | 643 | 77 | 26 | cobalt ion binding A protein coding gene withunknown function. The 5? UTR and the first two exons and introns of this gene overlap with a RNA coding gene TER1. TER1 (GenBank accession no. HQ401284) encodes a putative template sequence (5′-CTAAACCCTA-3′) corresponding to 1.5 copies of the Arabidopsis telomere repeat (PNAS 2011, 108:73-78). cobalt ion binding; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G47870.1); Has 94 Blast hits to 94 proteins in 17 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). | |
| XLOC_001435 | AT1G26558.2 | Ch1:9175611-9177556 | AT1G48090.1 | protein_coding | 1:17732010-17758508 | -16.5539 | 669 | 692 | 10491 | 10468 | calcium-dependent lipid-binding family proteincalcium-dependent lipid-binding family protein;FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), Protein ofunknown function DUF946 (InterPro:IPR009291), Vacuolar protein sorting-associated protein (InterPro:IPR009543), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973); pleckstrin homology (PH) domain-containing protein (TAIR:AT4G17140.2); Has 2732 Blast hits to 1481 proteins in 212 species: Archae - 2; Bacteria - 15; Metazoa - 1181; Fungi - 466; Plants - 461; Viruses - 0; Other Eukaryotes - 607 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT1G79915.1 | protein_coding | 1:30057206-30058657 | -16.5528 | 520 | 548 | 99 | 70 | Putative methyltransferase family proteinPutative methyltransferase family protein;CONTAINS InterPro DOMAIN/s: Methyltransferase-16, putative (InterPro:IPR019410); Has 424 Blast hits to 423 proteins in 116 species: Archae - 0; Bacteria - 1; Metazoa - 170; Fungi - 70; Plants - 129; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G61460.1 | protein_coding | 5:24714076-24721970 | -16.5491 | 67 | 102 | 2108 | 2074 | P-loop containing nucleoside triphosphate hydrolases superfamily proteinEncodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. hypersensitive to MMS, irradiation and MMC (MIM);FUNCTIONS IN: ATP binding; INVOLVED IN: double-strand break repair, sister chromatid cohesion, chromosome segregation, response to X-ray, double-strand break repair via homologous recombination; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); structural maintenance of chromosomes 6A (TAIR:AT5G07660.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G03540.3 | protein_coding | 5:889385-894205 | -16.5487 | 62 | 86 | 1755 | 1726 | exocyst subunit exo70 family protein A1 AtEXO70A1 is a member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thalianaCONTAINS 23 putative EXO70 genes, which can be classified into nine clusters on the phylogenetic treeexocyst subunit exo70 family protein A1 (EXO70A1);CONTAINS InterPro DOMAIN/s: Exo70 exocyst complex subunit (InterPro:IPR004140); exocyst subunit exo70 family protein A2 (TAIR:AT5G52340.1). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT3G03340.1 | protein_coding | 3:786205-790152 | -16.5455 | 194 | 257 | 108 | 44 | LUC7 related protein unfertilized embryo sac 6 (UNE6);CONTAINS InterPro DOMAIN/s: LUC7 related (InterPro:IPR004882); LUC7 related protein (TAIR:AT5G17440.1); Has 25128 Blast hits to 10547 proteins in 429 species: Archae - 23; Bacteria - 333; Metazoa - 14905; Fungi - 3154; Plants - 2060; Viruses - 86; Other Eukaryotes - 4567 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G14940.1 | protein_coding | 4:8541879-8544566 | -16.5453 | 1870 | 1906 | 1812 | 1783 | amine oxidase 1 atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. amine oxidase 1 (AO1);FUNCTIONS IN: primary amine oxidase activity, copper ion binding; INVOLVED IN: secondary cell wall biogenesis; LOCATED IN: cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Copper amine oxidase, N-terminal (InterPro:IPR016182), Copper amine oxidase, N2-terminal (InterPro:IPR015800), Copper amine oxidase, N2/N3-terminal (InterPro:IPR015801), Copper amine oxidase, N3-terminal (InterPro:IPR015802), Copper amine oxidase (InterPro:IPR000269), Copper amine oxidase, C-terminal (InterPro:IPR015798); Copper amine oxidase family protein (TAIR:AT1G31690.1); Has 1545 Blast hits to 1541 proteins in 275 species: Archae - 14; Bacteria - 376; Metazoa - 250; Fungi - 453; Plants - 241; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G77150.1 | protein_coding | 1:28992876-28993170 | -16.544 | 252 | 292 | 171 | 131 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G77170.1); Has 4376 Blast hits to 4365 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4376; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G11750.1 | protein_coding | 5:3787230-3789212 | -16.5325 | 973 | 992 | 205 | 186 | Ribosomal protein L19 family protein Ribosomal protein L19 family protein;FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular;CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857); Ribosomal protein L19 family protein (TAIR:AT4G11630.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_004801 | AT1G04837.1 | Ch1:3702554-3703796 | AT5G62260.1 | protein_coding | 5:25008843-25011666 | -16.5185 | 58 | 98 | 1429 | 1393 | AT hook motif DNA-binding family protein AT hook motif DNA-binding family protein;FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding motif (InterPro:IPR017956); AT hook motif DNA-binding family protein (TAIR:AT4G25320.1); Has 865 Blast hits to 854 proteins in 59 species: Archae - 0; Bacteria - 11; Metazoa - 37; Fungi - 23; Plants - 764; Viruses - 14; Other Eukaryotes - 16 (source: NCBI BLink). | |
| XLOC_028301 | AT5G02095.1 | Ch5:4341236-4341690 | AT3G47910.2 | protein_coding | 3:17674287-17681730 | -16.5141 | 71 | 92 | 3362 | 3341 | Ubiquitin carboxyl-terminal hydrolase-related protein Ubiquitin carboxyl-terminal hydrolase-related protein;FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF627 (InterPro:IPR006866), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394), Zinc finger, C2H2-type (InterPro:IPR007087), Protein ofunknown function DUF629 (InterPro:IPR006865); Ubiquitin carboxyl-terminal hydrolase-related protein (TAIR:AT3G47890.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT1G21380.1 | protein_coding | 1:7485636-7488780 | -16.5132 | 385 | 430 | 163 | 121 | Target of Myb protein 1 Target of Myb protein 1;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); Target of Myb protein 1 (TAIR:AT1G76970.1); Has 1707 Blast hits to 1699 proteins in 198 species: Archae - 0; Bacteria - 6; Metazoa - 892; Fungi - 452; Plants - 279; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G19390.1 | protein_coding | 2:8389610-8397939 | -16.5091 | 671 | 692 | 4276 | 4255 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G29790.1); Has 203 Blast hits to 188 proteins in 60 species: Archae - 0; Bacteria - 11; Metazoa - 24; Fungi - 34; Plants - 93; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT5G50380.1 | protein_coding | 5:20516055-20518815 | -16.5075 | 635 | 688 | 498 | 429 | exocyst subunit exo70 family protein F1 A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thalianaCONTAINS 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. exocyst subunit exo70 family protein F1 (EXO70F1); INVOLVED IN: exocytosis, vesicle docking involved in exocytosis; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Exo70 exocyst complex subunit (InterPro:IPR004140); exocyst subunit exo70 family protein D3 (TAIR:AT3G14090.1); Has 952 Blast hits to 944 proteins in 146 species: Archae - 0; Bacteria - 2; Metazoa - 140; Fungi - 117; Plants - 671; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). | |
| XLOC_020135 | AT4G13495.2 | Ch4:7842967-7846774 | AT4G13494.1 | miRNA | 4:7846597-7846899 | -16.5054 | 733 | 772 | 269 | 230 | MIR863a; miRNA Encodes a microRNA ofunknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G16500.1 | protein_coding | 5:5386524-5389311 | -16.5053 | 75 | 102 | 1926 | 1899 | Protein kinase superfamily protein Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G02810.1); Has 200394 Blast hits to 156502 proteins in 5222 species: Archae - 339; Bacteria - 26270; Metazoa - 73030; Fungi - 18373; Plants - 36753; Viruses - 1149; Other Eukaryotes - 44480 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT4G31750.1 | protein_coding | 4:15363708-15367892 | -16.5053 | 387 | 411 | 160 | 136 | HOPW1-1-interacting 2Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). HOPW1-1-interacting 2 (WIN2);FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, defense response to bacterium; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT5G24940.1); Has 8917 Blast hits to 8860 proteins in 1196 species: Archae - 18; Bacteria - 2164; Metazoa - 1691; Fungi - 821; Plants - 2764; Viruses - 9; Other Eukaryotes - 1450 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G11480.1 | protein_coding | 1:3864043-3867000 | -16.494 | 2194 | 2225 | 119 | 89 | eukaryotic translation initiation factor-related eukaryotic translation initiation factor-related; Has 394 Blast hits to 370 proteins in 111 species: Archae - 0; Bacteria - 23; Metazoa - 177; Fungi - 53; Plants - 82; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT3G28630.1 | protein_coding | 3:10728951-10730898 | -16.492 | 2731 | 2756 | 711 | 686 | Protein ofunknown function (DUF569) FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF569 (InterPro:IPR007679), Actin cross-linking (InterPro:IPR008999); Protein ofunknown function (DUF569) (TAIR:AT3G01311.1); Has 233 Blast hits to 211 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT5G40190.1 | protein_coding | 5:16069043-16070044 | -16.4809 | 14 | 45 | 260 | 232 | RNA ligase/cyclic nucleotide phosphodiesterase family protein Identified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library.RNA ligase/cyclic nucleotide phosphodiesterase family protein;FUNCTIONS IN: calmodulin binding; INVOLVED IN: RNA metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA ligase/cyclic nucleotide phosphodiesterase (InterPro:IPR009097); RNA ligase/cyclic nucleotide phosphodiesterase family protein (TAIR:AT3G28140.1); Has 227 Blast hits to 227 proteins in 109 species: Archae - 0; Bacteria - 185; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.6 | Ch3:23422590-23425169 | AT3G10400.1 | protein_coding | 3:3232608-3233690 | -16.4776 | 168 | 207 | 261 | 215 | RNA recognition motif and CCHC-type zinc finger domains containing protein Encodes a U12-type spliceosomal protein U11/U12-31K. Involved in U12 intron splicing via RNA chaperone activity and affects plant development. RNA recognition motif and CCHC-type zinc finger domains containing protein;FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); ortholog of human splicing factor SC35 (TAIR:AT5G64200.2); Has 867 Blast hits to 867 proteins in 310 species: Archae - 0; Bacteria - 0; Metazoa - 452; Fungi - 160; Plants - 158; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). | |
| XLOC_023109 | AT4G07165.1 | Ch4:12314032-12314494 | AT3G14860.2 | protein_coding | 3:4998304-5001046 | -16.4772 | 214 | 246 | 590 | 553 | NHL domain-containing protein NHL domain-containing protein;CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); NHL domain-containing protein (TAIR:AT1G70280.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_008571 | AT2G05215.1 | Ch2:3334410-3335689 | AT4G19150.1 | protein_coding | 4:10471331-10472742 | -16.4767 | 738 | 776 | 114 | 80 | Ankyrin repeat family protein Ankyrin repeat family protein; INVOLVED IN: biological_processunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Ankyrin repeat family protein (TAIR:AT2G03430.1); Has 81213 Blast hits to 28344 proteins in 1181 species: Archae - 93; Bacteria - 6443; Metazoa - 41453; Fungi - 7183; Plants - 4369; Viruses - 872; Other Eukaryotes - 20800 (source: NCBI BLink). | |
| XLOC_008692 | AT2G13665.3 | Ch2:5692090-5693030 | AT1G69080.1 | protein_coding | 1:25971915-25973505 | -16.4751 | 219 | 239 | 28 | 8 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to stress; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT2G03720.1); Has 185 Blast hits to 185 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G32240.1 | protein_coding | 2:13684299-13691155 | -16.4735 | 25 | 63 | 948 | 913 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G05320.3); Has 470429 Blast hits to 168274 proteins in 4282 species: Archae - 6896; Bacteria - 131956; Metazoa - 175525; Fungi - 33166; Plants - 25441; Viruses - 2243; Other Eukaryotes - 95202 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G65920.1 | protein_coding | 1:24525102-24529362 | -16.4717 | 672 | 697 | 78 | 52 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain;FUNCTIONS IN: zinc ion binding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation, RCC1 (InterPro:IPR000408), Disease resistance/zinc finger/chromosome condensation-like region (InterPro:IPR013591), Pleckstrin homology (InterPro:IPR001849), Zinc finger, FYVE-type (InterPro:IPR000306), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Zinc finger, FYVE-related (InterPro:IPR017455), Pleckstrin homology-type (InterPro:IPR011993), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain (TAIR:AT5G42140.1); Has 20784 Blast hits to 8293 proteins in 486 species: Archae - 65; Bacteria - 2335; Metazoa - 8187; Fungi - 1149; Plants - 2727; Viruses - 3; Other Eukaryotes - 6318 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G00440.2 | protein_coding | 4:193528-198582 | -16.4667 | 634 | 666 | 555 | 529 | Protein ofunknown function (DUF3741)FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3741 (InterPro:IPR022212); Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-related (TAIR:AT2G45900.1); Has 1283 Blast hits to 1059 proteins in 155 species: Archae - 0; Bacteria - 77; Metazoa - 265; Fungi - 74; Plants - 239; Viruses - 0; Other Eukaryotes - 628 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G52890.2 | protein_coding | 5:21444793-21447242 | -16.466 | 1574 | 1599 | 1566 | 1545 | AT hook motif-containing protein AT hook motif-containing protein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding motif (InterPro:IPR017956); DNA binding (TAIR:AT4G21895.1). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G24630.1 | protein_coding | 2:10471196-10474610 | -16.4645 | 2940 | 2974 | 2035 | 1992 | Glycosyl transferase family 2 proteinEncodes a gene similar to cellulose synthase ATCSLC08;CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); Cellulose-synthase-like C5 (TAIR:AT4G31590.1); Has 5319 Blast hits to 5316 proteins in 1532 species: Archae - 206; Bacteria - 4134; Metazoa - 30; Fungi - 95; Plants - 510; Viruses - 14; Other Eukaryotes - 330 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT2G31560.1 | protein_coding | 2:13436485-13438011 | -16.4608 | 50 | 79 | 283 | 252 | Protein ofunknown function (DUF1685) Protein ofunknown function (DUF1685);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1685 (InterPro:IPR012881); Protein ofunknown function (DUF1685) (TAIR:AT1G05870.4); Has 279 Blast hits to 279 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_015275 | AT3G46668.1 | Ch3:17191668-17194444 | AT5G28220.1 | protein_coding | 5:10190357-10193123 | -16.4585 | 773 | 798 | 472 | 433 | Protein prenylyltransferase superfamily protein Protein prenylyltransferase superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); Protein prenylyltransferase superfamily protein (TAIR:AT3G04830.1); Has 532 Blast hits to 529 proteins in 210 species: Archae - 27; Bacteria - 37; Metazoa - 228; Fungi - 111; Plants - 54; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G20320.1 | protein_coding | 5:6859212-6869307 | -16.4564 | 52 | 80 | 181 | 153 | dicer-like 4 Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein.dicer-like 4 (DCL4);CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Ribonuclease III (InterPro:IPR000999), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Dicer double-stranded RNA-binding fold (InterPro:IPR005034), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); dicer-like 2 (TAIR:AT3G03300.3); Has 20138 Blast hits to 15531 proteins in 2958 species: Archae - 325; Bacteria - 10957; Metazoa - 2671; Fungi - 1592; Plants - 1161; Viruses - 33; Other Eukaryotes - 3399 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT3G61790.1 | protein_coding | 3:22871697-22873833 | -16.4531 | 51 | 78 | 90 | 70 | Protein with RING/U-box and TRAF-like domains Protein with RING/U-box and TRAF-like domains;FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Seven-in-absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, SIAH-type (InterPro:IPR013010), Zinc finger, RING-type (InterPro:IPR001841), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven-in-absentia protein, sina (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); Protein with RING/U-box and TRAF-like domains (TAIR:AT4G27880.1); Has 1836 Blast hits to 1817 proteins in 706 species: Archae - 0; Bacteria - 0; Metazoa - 1264; Fungi - 11; Plants - 486; Viruses - 2; Other Eukaryotes - 73 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT3G26060.2 | protein_coding | 3:9524590-9526501 | -16.4506 | 972 | 1004 | 765 | 732 | Thioredoxin superfamily protein encodes periredoxin Q which decomposes peroxides and plays a role in the protection of the photosynthetic apparatusATPRX Q;FUNCTIONS IN: peroxiredoxin activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast stromal thylakoid, chloroplast thylakoid membrane, plastoglobule; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); 2-cysteine peroxiredoxin B (TAIR:AT5G06290.1). | |
| XLOC_000848 | AT1G05183.1 | Ch1:5402553-5403853 | AT1G69720.1 | protein_coding | 1:26226731-26228580 | -16.4479 | 966 | 997 | 355 | 329 | heme oxygenase 3Encodes a member (HO3) of the heme oxygenase family. heme oxygenase 3 (HO3);FUNCTIONS IN: heme oxygenase (decyclizing) activity, heme binding; INVOLVED IN: oxidation reduction, heme oxidation; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), Haem oxygenase-like (InterPro:IPR016053), Haem oxygenase (decyclizing), plant (InterPro:IPR016951); Plant haem oxygenase (decyclizing) family protein (TAIR:AT2G26670.1); Has 543 Blast hits to 543 proteins in 142 species: Archae - 0; Bacteria - 177; Metazoa - 122; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G43560.1 | protein_coding | 1:16397979-16399880 | -16.4427 | 1573 | 1598 | 220 | 198 | thioredoxin Y2thioredoxin Y2 (ty2);FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: glycerol ether metabolic process, cell redox homeostasis; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin (InterPro:IPR005746), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); thioredoxin Y1 (TAIR:AT1G76760.1); Has 23180 Blast hits to 21538 proteins in 3021 species: Archae - 298; Bacteria - 11849; Metazoa - 3466; Fungi - 1262; Plants - 2020; Viruses - 15; Other Eukaryotes - 4270 (source: NCBI BLink). | |
| XLOC_010940 | AT2G04785.1 | Ch2:1601495-1601751 | AT1G29965.1 | protein_coding | 1:10498310-10499462 | -16.4424 | 0 | 40 | 268 | 230 | Ribosomal protein L18ae/LX family proteinRibosomal protein L18ae/LX family protein;FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, cytosolic large ribosomal subunit;CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae/LX (InterPro:IPR021138), Ribosomal protein L18ae (InterPro:IPR002670); 60S ribosomal protein L18A-1 (TAIR:AT1G29970.2); Has 759 Blast hits to 757 proteins in 282 species: Archae - 0; Bacteria - 0; Metazoa - 315; Fungi - 159; Plants - 155; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G20060.1 | protein_coding | 3:7002697-7004508 | -16.4414 | 3097 | 3141 | 56 | 17 | ubiquitin-conjugating enzyme19 Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in dividing cells, but also in other non-dividing cells. Protein is localized to the cytoplasm as well as to the nucleus. ubiquitin-conjugating enzyme19 (UBC19);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme E2 H10 (InterPro:IPR015582), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquitin-conjugating enzyme 20 (TAIR:AT1G50490.1); Has 2436 Blast hits to 2429 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 552; Fungi - 119; Plants - 1682; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT2G23300.1 | protein_coding | 2:9914246-9917427 | -16.4397 | 487 | 525 | 84 | 52 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT4G37250.1); Has 130463 Blast hits to 92142 proteins in 3849 species: Archae - 98; Bacteria - 10554; Metazoa - 34539; Fungi - 5704; Plants - 66254; Viruses - 237; Other Eukaryotes - 13077 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G04690.1 | protein_coding | 2:1644456-1646443 | -16.437 | 673 | 692 | 181 | 162 | Pyridoxamine 5'-phosphate oxidase family protein Pyridoxamine 5'-phosphate oxidase family protein;FUNCTIONS IN: FMN binding; INVOLVED IN: biological_processunknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT3G27160.1 | protein_coding | 3:10017321-10019442 | -16.4362 | 673 | 692 | 40 | 21 | Ribosomal protein S21 family protein GHS1 encodes plastid ribosomal protein S21 GLUCOSE HYPERSENSITIVE 1 (GHS1);FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein S21 (InterPro:IPR001911); Ribosomal protein S21 family protein (TAIR:AT5G63300.1); Has 1937 Blast hits to 1937 proteins in 824 species: Archae - 0; Bacteria - 1717; Metazoa - 0; Fungi - 4; Plants - 72; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). | |
| XLOC_018271 | AT3G45638.1 | Ch3:16755215-16756263 | AT5G10600.1 | protein_coding | 5:3351037-3352894 | -16.4338 | 347 | 365 | 1540 | 1522 | cytochrome P450, family 81, subfamily K, polypeptide 2 member of CYP81K "cytochrome P450, family 81, subfamily K, polypeptide 2" (CYP81K2);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 81, subfamily K, polypeptide 1 (TAIR:AT5G10610.1); Has 31994 Blast hits to 31803 proteins in 1635 species: Archae - 50; Bacteria - 3220; Metazoa - 11846; Fungi - 6519; Plants - 9340; Viruses - 3; Other Eukaryotes - 1016 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT2G03140.2 | protein_coding | 2:941829-951553 | -16.4315 | 238 | 280 | 3026 | 2982 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); esterase/lipase/thioesterase family protein (TAIR:AT3G50790.1). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT4G33540.1 | protein_coding | 4:16130593-16133969 | -16.4291 | 11 | 34 | 44 | 21 | metallo-beta-lactamase family protein metallo-beta-lactamase family protein;FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1592 Blast hits to 1592 proteins in 436 species: Archae - 145; Bacteria - 835; Metazoa - 30; Fungi - 10; Plants - 78; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink). | |
| XLOC_014170 | AT3G17185.1 | Ch3:5861491-5862437 | AT5G39550.1 | protein_coding | 5:15837178-15840678 | -16.4286 | 0 | 54 | 1883 | 1831 | Zinc finger (C3HC4-type RING finger) family proteinEncodes the VIM3/ORTH1 protein that is similar to VIM1. This protein has an N-terminal PHD domain and two RING domains surrounding an SRA domain. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. This proteinFUNCTIONS as an E3 ubiquitin ligase in vitro with members of the UBC8 family E2s. Either of the two RING domains present in the protein can promote ubiquitylation in vitro, but, not the PHD domain. Over-expression of ORTH1/VIM3 leads to decreased levels of FWA methylation, increased levels of FWA transcripts, and delayed flowering. Cen180 repeats are also hypomethylated in plants overexpressing this protein. VARIANT IN METHYLATION 3 (VIM3);CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SRA-YDG (InterPro:IPR003105), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G66040.1); Has 6556 Blast hits to 5308 proteins in 497 species: Archae - 0; Bacteria - 14; Metazoa - 4783; Fungi - 431; Plants - 899; Viruses - 19; Other Eukaryotes - 410 (source: NCBI BLink). | |
| XLOC_002495 | AT1G52347.2 | Ch1:19496461-19497686 | AT5G03770.1 | protein_coding | 5:995095-997849 | -16.4266 | 506 | 532 | 1309 | 1281 | KDO transferase A Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase KDO transferase A (KDTA);FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_015998 | AT3G59068.1 | Ch3:21832192-21833041 | AT2G22180.1 | protein_coding | 2:9428743-9430141 | -16.4233 | 222 | 250 | 435 | 399 | hydroxyproline-rich glycoprotein family protein hydroxyproline-rich glycoprotein family protein; hydroxyproline-rich glycoprotein family protein (TAIR:AT4G39745.1); Has 202 Blast hits to 201 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 9; Fungi - 3; Plants - 182; Viruses - 2; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT1G17370.1 | protein_coding | 1:5951542-5955143 | -16.4187 | 424 | 448 | 1693 | 1665 | oligouridylate binding protein 1B Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA.oligouridylate binding protein 1B (UBP1B);FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT3G14100.1); Has 681 Blast hits to 681 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 681; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G29930.1 | protein_coding | 1:10477885-10479114 | -16.4175 | 84 | 117 | 177 | 150 | chlorophyll A/B binding protein 1 Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. chlorophyll A/B binding protein 1 (CAB1);FUNCTIONS IN: chlorophyll binding; INVOLVED IN: photosynthesis; LOCATED IN: light-harvesting complex, thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: guard cell, juvenile leaf, cultured cell;CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); chlorophyll A/B binding protein 3 (TAIR:AT1G29910.1); Has 2419 Blast hits to 2339 proteins in 222 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 2091; Viruses - 0; Other Eukaryotes - 324 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT2G33730.1 | protein_coding | 2:14265281-14268003 | -16.4162 | 666 | 702 | 565 | 530 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT1G28180.1); Has 125674 Blast hits to 72393 proteins in 3317 species: Archae - 1039; Bacteria - 55089; Metazoa - 31149; Fungi - 11223; Plants - 5926; Viruses - 327; Other Eukaryotes - 20921 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.2 | Ch1:7908568-7909708 | AT3G11570.1 | protein_coding | 3:3645022-3647542 | -16.4132 | 1003 | 1023 | 277 | 256 | TRICHOME BIREFRINGENCE-LIKE 8Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 8 (TBL8);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 9 (TAIR:AT5G06230.1); Has 1362 Blast hits to 1341 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 1353; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT4G24680.1 | protein_coding | 4:12732494-12740094 | -16.411 | 2601 | 2629 | 64 | 29 | modifier of snc1Encodes MOS1 (MODIFIER OF snc1). MOS1CONTAINS a BAT2 domain that is conserved in plants and animals. MOS1 regulates the expression of SNC1, a TIR-NB-LRR-type of R protein. MODIFIER OF snc1 (MOS1);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: regulation of gene expression, epigenetic; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; Has 5806 Blast hits to 4291 proteins in 546 species: Archae - 8; Bacteria - 946; Metazoa - 2312; Fungi - 705; Plants - 202; Viruses - 15; Other Eukaryotes - 1618 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G36890.1 | protein_coding | 4:17379173-17382028 | -16.4106 | 154 | 195 | 384 | 337 | Nucleotide-diphospho-sugar transferases superfamily proteinThe IRX14 gene encodes a putative family 43 glycosyl transferase that contributes to xylan biosynthesis. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. irregular xylem 14 (IRX14);CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); Nucleotide-diphospho-sugar transferases superfamily protein (TAIR:AT5G67230.1); Has 636 Blast hits to 635 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 399; Fungi - 0; Plants - 221; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G46460.1 | protein_coding | 3:17095706-17097465 | -16.4092 | 92 | 136 | 597 | 566 | ubiquitin-conjugating enzyme 13 ubiquitin-conjugating enzyme 13 (UBC13);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquitin carrier protein 7 (TAIR:AT5G59300.1); Has 10290 Blast hits to 10255 proteins in 396 species: Archae - 0; Bacteria - 0; Metazoa - 4390; Fungi - 2251; Plants - 1992; Viruses - 23; Other Eukaryotes - 1634 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT4G00420.2 | protein_coding | 4:181267-184469 | -16.4091 | 476 | 525 | 89 | 40 | Double-stranded RNA-binding domain (DsRBD)-containing protein Double-stranded RNA-binding domain (DsRBD)-containing protein;FUNCTIONS IN: double-stranded RNA binding, RNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding (InterPro:IPR001159), Double-stranded RNA-binding-like (InterPro:IPR014720); RNAse THREE-like protein 1 (TAIR:AT1G80650.1); Has 72 Blast hits to 72 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT4G34480.1 | protein_coding | 4:16480887-16484231 | -16.409 | 799 | 839 | 66 | 35 | O-Glycosyl hydrolases family 17 protein O-Glycosyl hydrolases family 17 protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); O-Glycosyl hydrolases family 17 protein (TAIR:AT2G16230.1); Has 576 Blast hits to 566 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 570; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G32020.1 | protein_coding | 4:15487914-15490048 | -16.3983 | 973 | 995 | 100 | 78 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G25250.1); Has 65 Blast hits to 65 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G65270.2 | protein_coding | 1:24241706-24245074 | -16.3952 | 262 | 284 | 848 | 823 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 149 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_028934 | AT5G24735.1 | Ch5:8468331-8469262 | AT4G19990.2 | protein_coding | 4:10832214-10835702 | -16.3802 | 449 | 466 | 1571 | 1554 | FAR1-related sequence 1 FAR1-related sequence 1 (FRS1);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); FRS (FAR1 Related Sequences) transcription factor family (TAIR:AT4G15090.1). | |
| XLOC_028257 | AT5G01935.1 | Ch5:4008968-4010413 | AT1G50450.1 | protein_coding | 1:18687785-18690503 | -16.378 | 946 | 975 | 268 | 243 | Saccharopine dehydrogenase Saccharopine dehydrogenase ;FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase / Homospermidine synthase (InterPro:IPR005097), NAD(P)-binding domain (InterPro:IPR016040); Has 1549 Blast hits to 1547 proteins in 500 species: Archae - 22; Bacteria - 980; Metazoa - 33; Fungi - 88; Plants - 49; Viruses - 0; Other Eukaryotes - 377 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G16170.1 | protein_coding | 3:5475855-5480349 | -16.3738 | 959 | 979 | 1423 | 1403 | AMP-dependent synthetase and ligase family protein AMP-dependent synthetase and ligase family protein;FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: metabolic process; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); AMP-dependent synthetase and ligase family protein (TAIR:AT3G48990.1); Has 81919 Blast hits to 74550 proteins in 3809 species: Archae - 1169; Bacteria - 53765; Metazoa - 3235; Fungi - 4485; Plants - 2227; Viruses - 1; Other Eukaryotes - 17037 (source: NCBI BLink). | |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT5G40700.2 | protein_coding | 5:16291755-16293649 | -16.3705 | 123 | 148 | 666 | 642 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G27350.1); Has 475 Blast hits to 414 proteins in 93 species: Archae - 0; Bacteria - 43; Metazoa - 127; Fungi - 17; Plants - 143; Viruses - 7; Other Eukaryotes - 138 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G76850.1 | protein_coding | 1:28847871-28854499 | -16.3675 | 256 | 277 | 1359 | 1337 | exocyst complex component sec5 Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. exocyst complex component sec5 (SEC5A);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Exocyst complex component SEC5 (TAIR:AT1G21170.1); Has 532 Blast hits to 503 proteins in 167 species: Archae - 0; Bacteria - 2; Metazoa - 234; Fungi - 147; Plants - 83; Viruses - 4; Other Eukaryotes - 62 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT4G38170.1 | protein_coding | 4:17904532-17906821 | -16.3635 | 622 | 644 | 432 | 410 | FAR1-related sequence 9 FAR1-related sequence 9 (FRS9);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); FAR1-related sequence 5 (TAIR:AT4G38180.1); Has 1073 Blast hits to 1051 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 2; Plants - 1067; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G61560.1 | protein_coding | 1:22708468-22712289 | -16.3603 | 1969 | 1995 | 594 | 567 | Seven transmembrane MLO family protein A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genomeCONTAINS 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). MILDEW RESISTANCE LOCUS O 6 (MLO6);FUNCTIONS IN: calmodulin binding; INVOLVED IN: defense response to fungus, incompatible interaction, cell death, defense response; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Mlo-related protein (InterPro:IPR004326); Seven transmembrane MLO family protein (TAIR:AT1G11310.1); Has 556 Blast hits to 535 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 551; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT3G52560.4 | protein_coding | 3:19494369-19496147 | -16.3561 | 108 | 158 | 268 | 211 | ubiquitin E2 variant 1D-4ubiquitin E2 variant 1D-4 (UEV1D-4);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); MMS ZWEI homologue 3 (TAIR:AT2G36060.2). | |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT2G36670.1 | protein_coding | 2:15364776-15368169 | -16.3526 | 814 | 845 | 29 | 3 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Twin-arginine translocation pathway, signal sequence (InterPro:IPR006311); Eukaryotic aspartyl protease family protein (TAIR:AT5G22850.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT4G36760.1 | protein_coding | 4:17326537-17330383 | -16.3521 | 2512 | 2554 | 1608 | 1575 | aminopeptidase P1 Arabidopsis aminopeptidase P1 aminopeptidase P1 (APP1);FUNCTIONS IN: aminopeptidase activity, N-1-naphthylphthalamic acid binding; INVOLVED IN: auxin polar transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P, conserved site (InterPro:IPR001131), Peptidase M24, structural domain (InterPro:IPR000994), Creatinase (InterPro:IPR000587); Metallopeptidase M24 family protein (TAIR:AT3G05350.1); Has 10398 Blast hits to 10335 proteins in 2401 species: Archae - 277; Bacteria - 6310; Metazoa - 362; Fungi - 246; Plants - 146; Viruses - 0; Other Eukaryotes - 3057 (source: NCBI BLink). | |
| XLOC_018008 | AT3G29644.4 | Ch3:11498879-11501419 | AT3G01520.1 | protein_coding | 3:208250-210161 | -16.3514 | 12 | 36 | 625 | 602 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT5G14680.1); Has 2506 Blast hits to 2501 proteins in 678 species: Archae - 111; Bacteria - 1598; Metazoa - 89; Fungi - 33; Plants - 646; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT2G45520.1 | protein_coding | 2:18755045-18756302 | -16.3471 | 257 | 277 | 308 | 279 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 260 Blast hits to 238 proteins in 75 species: Archae - 0; Bacteria - 6; Metazoa - 94; Fungi - 40; Plants - 38; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT2G20960.1 | protein_coding | 2:9006610-9009794 | -16.3424 | 734 | 755 | 2234 | 2213 | Arabidopsis phospholipase-like protein (PEARLI 4) family pEARLI4;CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); Arabidopsis phospholipase-like protein (PEARLI 4) family (TAIR:AT4G38560.1); Has 15842 Blast hits to 10281 proteins in 873 species: Archae - 33; Bacteria - 1976; Metazoa - 6640; Fungi - 3309; Plants - 1166; Viruses - 359; Other Eukaryotes - 2359 (source: NCBI BLink). | |
| XLOC_013898 | AT3G13277.1 | Ch3:4290082-4291595 | AT5G06839.3 | protein_coding | 5:2120472-2126457 | -16.342 | 425 | 452 | 1545 | 1524 | bZIP transcription factor family protein bZIP transcription factor family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: leaf whorl, root, flower, seed; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); bZIP transcription factor family protein (TAIR:AT1G08320.3). | |
| XLOC_008709 | AT2G14115.1 | Ch2:5953196-5954039 | AT2G29065.1 | protein_coding | 2:12484658-12487110 | -16.34 | 358 | 383 | 772 | 747 | GRAS family transcription factor GRAS family transcription factor;CONTAINS InterPro DOMAIN/s: Transcription factor GRAS (InterPro:IPR005202); GRAS family transcription factor (TAIR:AT1G07520.1). | |
| XLOC_023555 | AT4G31408.1 | Ch4:15241687-15242987 | AT1G10770.1 | protein_coding | 1:3591633-3592580 | -16.3382 | 918 | 958 | 684 | 641 | Plant invertase/pectin methylesterase inhibitor superfamily proteinEncodes a putative pectin methylesterase/invertase inhibitor. Anti-sense reduction of this gene's transcript results in pollen tube growth retardation and then partial male sterility and reduced seed set. Plant invertase/pectin methylesterase inhibitor superfamily protein;FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: pollen tube growth; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); Plant invertase/pectin methylesterase inhibitor superfamily protein (TAIR:AT1G60760.1); Has 183 Blast hits to 183 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_001435 | AT1G26558.2 | Ch1:9175611-9177556 | AT1G80700.1 | protein_coding | 1:30331842-30333400 | -16.3356 | 663 | 720 | 479 | 394 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G80980.1); Has 476 Blast hits to 340 proteins in 85 species: Archae - 2; Bacteria - 44; Metazoa - 84; Fungi - 36; Plants - 40; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.2 | Ch2:18682089-18684072 | AT1G12680.1 | protein_coding | 1:4319877-4323265 | -16.3352 | 87 | 106 | 1543 | 1522 | phosphoenolpyruvate carboxylase-related kinase 2 phosphoenolpyruvate carboxylase-related kinase 2 (PEPKR2);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); calcium-dependent protein kinase 29 (TAIR:AT1G76040.2); Has 127165 Blast hits to 125151 proteins in 3799 species: Archae - 184; Bacteria - 15080; Metazoa - 45775; Fungi - 13042; Plants - 31031; Viruses - 550; Other Eukaryotes - 21503 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT4G21450.3 | protein_coding | 4:11425933-11428435 | -16.3338 | 2058 | 2088 | 390 | 357 | PapD-like superfamily protein PapD-like superfamily protein;FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_processunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535); PapD-like superfamily protein (TAIR:AT4G05060.1). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT2G09795.1 | lncRNA | 2:3669906-3672766 | -16.3327 | 2264 | 2318 | 53 | 3 | other RNA Potential natural antisense gene, locus overlaps with AT2G09800 | |
| XLOC_026203 | AT5G43725.1 | Ch5:17559541-17560062 | AT1G77180.1 | protein_coding | 1:28999577-29002143 | -16.3283 | 107 | 132 | 1464 | 1437 | chromatin protein familyEncodes a putative transcriptional factor. Shows transcriptional activator activity in yeast. Involved in response to abscisic acid, salt and osmotic stress. SKIP;FUNCTIONS IN: transcription activator activity; INVOLVED IN: response to salt stress, response to mannitol stimulus, RNA splicing, response to abscisic acid stimulus; LOCATED IN: nucleolus, nucleus; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: SKI-interacting protein, SKIP (InterPro:IPR017862), SKI-interacting protein SKIP, SNW domain (InterPro:IPR004015); Has 9534 Blast hits to 6488 proteins in 453 species: Archae - 14; Bacteria - 426; Metazoa - 4688; Fungi - 1154; Plants - 570; Viruses - 47; Other Eukaryotes - 2635 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G43403.1 | ncRNA | 5:17430539-17431765 | -16.3242 | 263 | 290 | 271 | 243 | other RNA unknown gene | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G13300.1 | protein_coding | 5:4255547-4262568 | -16.3236 | 73 | 111 | 229 | 191 | ARF GTPase-activating protein Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The proteinCONTAINS four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. SCARFACE (SFC);FUNCTIONS IN: ARF GTPase activator activity, phosphoinositide binding; INVOLVED IN: xylem and phloem pattern formation, response to auxin stimulus, phloem or xylem histogenesis, leaf morphogenesis; LOCATED IN: cytosol, trans-Golgi network transport vesicle, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Arf GTPase activating protein (InterPro:IPR001164), Pleckstrin homology-type (InterPro:IPR011993), Ankyrin repeat-containing domain (InterPro:IPR020683), BAR (InterPro:IPR004148), Pleckstrin homology (InterPro:IPR001849), Ankyrin repeat (InterPro:IPR002110); ARF-GAP domain 1 (TAIR:AT5G61980.1); Has 64753 Blast hits to 27558 proteins in 1221 species: Archae - 110; Bacteria - 5131; Metazoa - 34265; Fungi - 4887; Plants - 2591; Viruses - 654; Other Eukaryotes - 17115 (source: NCBI BLink). | |
| XLOC_013057 | AT2G09640.1 | Ch2:18756673-18757928 | AT1G15030.1 | protein_coding | 1:5177480-5180049 | -16.3218 | 567 | 592 | 27 | 1 | Protein ofunknown function (DUF789) Encodes a Cysteine-rich peptide (CRP) family protein Protein ofunknown function (DUF789);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF789 (InterPro:IPR008507); Protein ofunknown function (DUF789) (TAIR:AT2G01260.1); Has 315 Blast hits to 313 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 311; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_001767 | AT1G31485.1 | Ch1:11271744-11273075 | AT1G06230.1 | protein_coding | 1:1906963-1911056 | -16.3187 | 1009 | 1031 | 82 | 60 | global transcription factor group E4 This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation.global transcription factor group E4 (GTE4);CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); DNA-binding bromodomain-containing protein (TAIR:AT1G17790.1); Has 9656 Blast hits to 6188 proteins in 362 species: Archae - 8; Bacteria - 274; Metazoa - 4793; Fungi - 1365; Plants - 669; Viruses - 49; Other Eukaryotes - 2498 (source: NCBI BLink). | |
| XLOC_016958 | AT3G02505.1 | Ch3:3960120-3960327 | AT1G03600.1 | protein_coding | 1:898480-899794 | -16.3183 | 111 | 139 | 163 | 129 | photosystem II family protein PSB27;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: photosystem II repair; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast photosystem II, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 273 Blast hits to 273 proteins in 82 species: Archae - 0; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). | |
| XLOC_017896 | AT3G27990.1 | Ch3:10392571-10398221 | AT5G46340.1 | protein_coding | 5:18795737-18800122 | -16.3171 | 4 | 26 | 2059 | 2034 | O-acetyltransferase family protein Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. O-acetyltransferase family protein;CONTAINS InterPro DOMAIN/s: Cas1p-like (InterPro:IPR012419); O-acetyltransferase family protein (TAIR:AT2G34410.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT2G39810.1 | protein_coding | 2:16612777-16618122 | -16.3153 | 126 | 158 | 3022 | 2974 | ubiquitin-protein ligases A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses.FUNCTIONS as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress. HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 1 (HOS1);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: response to cold, negative regulation of transcription, protein ubiquitination; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; Has 239 Blast hits to 237 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 0; Plants - 80; Viruses - 5; Other Eukaryotes - 23 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT1G53590.1 | protein_coding | 1:19996205-20000782 | -16.3138 | 256 | 274 | 2479 | 2461 | Calcium-dependent lipid-binding (CaLB domain) family protein NTMC2T6.1; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); Calcium-dependent lipid-binding (CaLB domain) family protein (TAIR:AT3G14590.2); Has 5916 Blast hits to 4916 proteins in 346 species: Archae - 2; Bacteria - 105; Metazoa - 3154; Fungi - 722; Plants - 1160; Viruses - 7; Other Eukaryotes - 766 (source: NCBI BLink). | |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT1G79080.1 | protein_coding | 1:29746972-29749085 | -16.2986 | 152 | 186 | 1686 | 1653 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT1G09900.1); Has 46001 Blast hits to 12732 proteins in 282 species: Archae - 3; Bacteria - 36; Metazoa - 518; Fungi - 600; Plants - 43410; Viruses - 0; Other Eukaryotes - 1434 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT4G15550.1 | protein_coding | 4:8877590-8879327 | -16.2967 | 1863 | 1888 | 1618 | 1586 | indole-3-acetate beta-D-glucosyltransferaseUDP-glucose:indole-3-acetate beta-D-glucosyltransferase indole-3-acetate beta-D-glucosyltransferase (IAGLU);FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyltransferase 75B1 (TAIR:AT1G05560.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT3G13890.1 | protein_coding | 3:4576193-4578082 | -16.2966 | 1684 | 1704 | 1070 | 1050 | myb domain protein 26Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants. myb domain protein 26 (MYB26);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 103 (TAIR:AT1G63910.1); Has 8645 Blast hits to 8092 proteins in 471 species: Archae - 0; Bacteria - 0; Metazoa - 730; Fungi - 412; Plants - 5794; Viruses - 3; Other Eukaryotes - 1706 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G21630.1 | protein_coding | 3:7615357-7618671 | -16.288 | 530 | 561 | 119 | 88 | chitin elicitor receptor kinase 1 LysM receptor-like kinase. Essential in the perception and transduction of the chitin oligosaccharide elicitor. Involved in chitin-mediated plant innate immunity. Located in the plasma membrane.chitin elicitor receptor kinase 1 (CERK1);FUNCTIONS IN: transmembrane receptor protein kinase activity, receptor signaling protein activity, kinase activity; INVOLVED IN: defense response to fungus, incompatible interaction, response to chitin, detection of molecule of fungal origin; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT1G51940.1); Has 117788 Blast hits to 116484 proteins in 4898 species: Archae - 166; Bacteria - 13638; Metazoa - 43401; Fungi - 9900; Plants - 32885; Viruses - 579; Other Eukaryotes - 17219 (source: NCBI BLink). | |
| XLOC_024332 | AT5G00990.1 | Ch5:1373673-1374232 | AT1G24706.2 | protein_coding | 1:8741836-8755604 | -16.287 | 360 | 393 | 5256 | 5220 | THO2 Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. THO2;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: THO complex, subunitTHOC2, C-region (InterPro:IPR021418), THO complex, subunitTHOC2, N-region (InterPro:IPR021726). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT5G17900.1 | protein_coding | 5:5924372-5927041 | -16.2829 | 921 | 946 | 594 | 574 | microfibrillar-associated protein-relatedmicrofibrillar-associated protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: extracellular region;CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); microfibrillar-associated protein-related (TAIR:AT4G08580.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_008571 | AT2G05215.1 | Ch2:3334410-3335689 | AT2G16940.2 | protein_coding | 2:7342607-7347464 | -16.2825 | 745 | 773 | 510 | 478 | Splicing factor, CC1-likeSplicing factor, CC1-like;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, domain 1 (InterPro:IPR003954); Splicing factor, CC1-like (TAIR:AT5G09880.1). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G17290.1 | protein_coding | 1:5922332-5926400 | -16.2741 | 671 | 689 | 297 | 279 | alanine aminotransferas Encodes for alanine aminotransferase (ALAAT1), involved in alanine catabolism during plants recovery from hypoxia alanine aminotransferas (AlaAT1);FUNCTIONS IN: L-alanine:2-oxoglutarate aminotransferase activity, ATP binding; INVOLVED IN: response to cadmium ion, response to hypoxia, L-alanine catabolic process, by transamination; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); alanine aminotransferase 2 (TAIR:AT1G72330.1); Has 28241 Blast hits to 28232 proteins in 2888 species: Archae - 752; Bacteria - 19527; Metazoa - 637; Fungi - 692; Plants - 1303; Viruses - 0; Other Eukaryotes - 5330 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G28950.1 | protein_coding | 2:12431338-12433796 | -16.272 | 3118 | 3148 | 104 | 71 | expansin A6Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. expansin A6 (EXPA6);CONTAINS InterPro DOMAIN/s: Barwin-related endoglucanase (InterPro:IPR009009), Pollen allergen, N-terminal (InterPro:IPR014734), Expansin (InterPro:IPR002963), Rare lipoprotein A (InterPro:IPR005132), Expansin/Lol pI (InterPro:IPR007118), Expansin 45, endoglucanase-like (InterPro:IPR007112), Pollen allergen/expansin, C-terminal (InterPro:IPR007117); expansin A4 (TAIR:AT2G39700.1); Has 2139 Blast hits to 2136 proteins in 145 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 24; Plants - 2081; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). | |
| XLOC_000343 | AT1G04513.1 | Ch1:2089765-2090865 | AT2G46040.1 | protein_coding | 2:18935236-18938447 | -16.2707 | 823 | 860 | 1019 | 983 | ARID/BRIGHT DNA-binding domain;ELM2 domain protein ARID/BRIGHT DNA-binding domain;ELM2 domain protein;FUNCTIONS IN: DNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular; EXPRESSED IN: sperm cell, male gametophyte, cultured cell, seed, pollen tube; EXPRESSED DURING: M germinated pollen stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: ELM2 (InterPro:IPR000949), ARID/BRIGHT DNA-binding domain (InterPro:IPR001606); ARID/BRIGHT DNA-binding domain;ELM2 domain protein (TAIR:AT4G11400.1); Has 198 Blast hits to 184 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 35; Fungi - 2; Plants - 156; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT4G08350.1 | protein_coding | 4:5286158-5292270 | -16.2704 | 9 | 26 | 261 | 244 | global transcription factor group A2 global transcription factor group A2 (GTA2);FUNCTIONS IN: transcription elongation regulator activity, structural constituent of ribosome, sequence-specific DNA binding transcription factor activity; INVOLVED IN: translation, regulation of transcription from RNA polymerase II promoter, positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell;CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription elongation factor Spt5 (InterPro:IPR017071), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Transcription elongation factor Spt5, NGN domain (InterPro:IPR005100); Transcription elongation factor Spt5 (TAIR:AT2G34210.1); Has 14630 Blast hits to 9620 proteins in 607 species: Archae - 121; Bacteria - 647; Metazoa - 6069; Fungi - 2592; Plants - 1061; Viruses - 307; Other Eukaryotes - 3833 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT3G15850.1 | protein_coding | 3:5358601-5361185 | -16.2572 | 29 | 62 | 375 | 334 | fatty acid desaturase 5 Chloroplastic enzyme responsible for the synthesis of 16:1 fatty acids from galactolipids and sulpholipids. Uses ferredoxin as electron donor. fatty acid desaturase 5 (FAD5);CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); Fatty acid desaturase family protein (TAIR:AT3G15870.1); Has 3424 Blast hits to 3424 proteins in 822 species: Archae - 0; Bacteria - 1534; Metazoa - 801; Fungi - 236; Plants - 106; Viruses - 4; Other Eukaryotes - 743 (source: NCBI BLink). | |
| XLOC_008744 | AT2G14878.1 | Ch2:6392167-6393042 | AT5G15080.1 | protein_coding | 5:4886029-4888817 | -16.2569 | 624 | 643 | 434 | 415 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G01300.1); Has 114476 Blast hits to 113108 proteins in 3886 species: Archae - 103; Bacteria - 13473; Metazoa - 41986; Fungi - 9512; Plants - 32487; Viruses - 375; Other Eukaryotes - 16540 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G15780.1 | protein_coding | 1:5430040-5436618 | -16.2565 | 2354 | 2371 | 947 | 930 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G10440.1); Has 103701 Blast hits to 43153 proteins in 1828 species: Archae - 30; Bacteria - 7385; Metazoa - 38639; Fungi - 11531; Plants - 7727; Viruses - 307; Other Eukaryotes - 38082 (source: NCBI BLink). | |
| XLOC_015622 | AT3G52535.1 | Ch3:19487129-19488530 | AT5G49440.1 | protein_coding | 5:20048239-20049776 | -16.2481 | 157 | 179 | 1198 | 1176 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT2G31280.3 | protein_coding | 2:13338818-13343710 | -16.2475 | 1267 | 1288 | 147 | 119 | conserved peptide upstream open reading frame 7 conserved peptide upstream open reading frame 7 (CPUORF7);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT1G06150.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_011062 | AT2G05205.1 | Ch2:3334410-3335689 | AT4G32390.1 | protein_coding | 4:15636415-15638040 | -16.2469 | 294 | 317 | 352 | 319 | Nucleotide-sugar transporter family protein Nucleotide-sugar transporter family protein;FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF6, transmembrane (InterPro:IPR000620), Protein ofunknown function DUF250 (InterPro:IPR004853); Drug/metabolite transporter superfamily protein (TAIR:AT2G25520.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT1G78265.1 | lncRNA | 1:29450551-29452415 | -16.2444 | 3348 | 3379 | 256 | 223 | other RNA Potential natural antisense gene, locus overlaps with AT1G78270 | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G61080.1 | protein_coding | 1:22492878-22497267 | -16.2415 | 75 | 97 | 709 | 686 | Hydroxyproline-rich glycoprotein family protein Hydroxyproline-rich glycoprotein family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G11070.1); Has 309070 Blast hits to 105260 proteins in 2835 species: Archae - 563; Bacteria - 69679; Metazoa - 122906; Fungi - 37150; Plants - 37869; Viruses - 8514; Other Eukaryotes - 32389 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G54170.1 | protein_coding | 1:20221029-20226055 | -16.2371 | 230 | 255 | 1087 | 1062 | CTC-interacting domain 3 ataxin-2-related, similar to SCA2 (GI:1770390) (Homo sapiens); similar to ataxin-2 (GI:3005020) (Mus musculus). Member of a family of PAM2 motif containing proteins. CTC-interacting domain 3 (CID3);CONTAINS InterPro DOMAIN/s: LsmAD domain (InterPro:IPR009604), Ataxin-2, C-terminal (InterPro:IPR009818); CTC-interacting domain 4 (TAIR:AT3G14010.3); Has 939 Blast hits to 759 proteins in 220 species: Archae - 0; Bacteria - 26; Metazoa - 423; Fungi - 216; Plants - 125; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT2G46750.1 | protein_coding | 2:19207991-19211021 | -16.2356 | 3387 | 3407 | 78 | 56 | D-arabinono-1,4-lactone oxidase family protein Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. D-arabinono-1,4-lactone oxidase family protein;FUNCTIONS IN: oxidoreductase activity, D-arabinono-1,4-lactone oxidase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction; LOCATED IN: membrane; EXPRESSED IN: hypocotyl, root;CONTAINS InterPro DOMAIN/s: D-arabinono-1,4-lactone oxidase (InterPro:IPR007173), FAD-binding, type 2 (InterPro:IPR016166), Plant-specific FAD-dependent oxidoreductase (InterPro:IPR010030), FAD linked oxidase, N-terminal (InterPro:IPR006094); D-arabinono-1,4-lactone oxidase family protein (TAIR:AT2G46760.1); Has 2214 Blast hits to 2141 proteins in 703 species: Archae - 18; Bacteria - 1466; Metazoa - 84; Fungi - 192; Plants - 250; Viruses - 0; Other Eukaryotes - 204 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G56250.1 | protein_coding | 3:20865913-20868156 | -16.2327 | 684 | 716 | 39 | 18 | unknown protein; Has 109 Blast hits to 83 proteins in 41 species: Archae - 0; Bacteria - 6; Metazoa - 18; Fungi - 20; Plants - 21; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.1 | Ch1:20617324-20618241 | AT4G19180.1 | protein_coding | 4:10485116-10488534 | -16.2212 | 4 | 71 | 206 | 146 | GDA1/CD39 nucleoside phosphatase family protein Encodes a putative apyrase involved in pollen exine pattern formation and anther dehiscence. GDA1/CD39 nucleoside phosphatase family protein;FUNCTIONS IN: hydrolase activity; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); GDA1/CD39 nucleoside phosphatase family protein (TAIR:AT2G02970.1); Has 1352 Blast hits to 1349 proteins in 221 species: Archae - 0; Bacteria - 34; Metazoa - 590; Fungi - 302; Plants - 310; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.1 | Ch1:12118990-12124001 | AT5G62910.1 | protein_coding | 5:25250256-25252354 | -16.221 | 1572 | 1599 | 783 | 755 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT3G48070.2); Has 749 Blast hits to 665 proteins in 188 species: Archae - 0; Bacteria - 6; Metazoa - 241; Fungi - 216; Plants - 135; Viruses - 4; Other Eukaryotes - 147 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G76510.3 | protein_coding | 1:28708339-28712968 | -16.2166 | 1267 | 1303 | 118 | 75 | ARID/BRIGHT DNA-binding domain-containing proteinARID/BRIGHT DNA-binding domain-containing protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978), ARID/BRIGHT DNA-binding domain (InterPro:IPR001606); ARID/BRIGHT DNA-binding domain-containing protein (TAIR:AT1G20910.1). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G26580.1 | protein_coding | 1:9184567-9187578 | -16.2134 | 54 | 71 | 2107 | 2090 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; ELM2 domain-containing protein (TAIR:AT2G03470.1); Has 161 Blast hits to 161 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 4; Plants - 156; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.1 | Ch3:23422590-23425169 | AT1G17520.1 | protein_coding | 1:6024636-6027565 | -16.2111 | 2194 | 2225 | 962 | 928 | Homeodomain-like/winged-helix DNA-binding family protein Homeodomain-like/winged-helix DNA-binding family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Histone H1/H5 (InterPro:IPR005818), Homeodomain-related (InterPro:IPR012287), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930); Homeodomain-like/winged-helix DNA-binding family protein (TAIR:AT1G72740.1); Has 882 Blast hits to 875 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 89; Plants - 618; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT1G64230.4 | protein_coding | 1:23833485-23835539 | -16.2099 | 30 | 53 | 770 | 748 | ubiquitin-conjugating enzyme 28 ubiquitin-conjugating enzyme 28 (UBC28);CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); ubiquitin conjugating enzyme 8 (TAIR:AT5G41700.5); Has 10460 Blast hits to 10419 proteins in 398 species: Archae - 0; Bacteria - 4; Metazoa - 4543; Fungi - 2213; Plants - 1965; Viruses - 26; Other Eukaryotes - 1709 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G00720.1 | protein_coding | 4:293588-297479 | -16.2057 | 973 | 989 | 1915 | 1899 | shaggy-like protein kinase 32Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase.FUNCTIONS in the brassinosteroid signalling pathway. shaggy-like protein kinase 32 (SK32);FUNCTIONS IN: kinase activity; INVOLVED IN: response to brassinosteroid stimulus; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); shaggy-like kinase 13 (TAIR:AT5G14640.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_003575 | AT1G70581.1 | Ch1:26616267-26616996 | AT5G66640.2 | protein_coding | 5:26599351-26602034 | -16.2052 | 111 | 148 | 374 | 332 | DA1-related protein 3 DA1-related protein 3 (DAR3);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3633 (InterPro:IPR022087); DA1-related protein 6 (TAIR:AT5G66620.1). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT1G67960.1 | protein_coding | 1:25480652-25484396 | -16.2017 | 1958 | 1992 | 269 | 240 | POD1 is involved in pollen tube guidence and early embryo patterning. CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 447 Blast hits to 428 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 190; Fungi - 133; Plants - 49; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). | |
| XLOC_019949 | AT4G05785.1 | Ch4:6478619-6478855 | AT5G60030.1 | protein_coding | 5:24171888-24173046 | -16.2004 | 9 | 43 | 712 | 686 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G75335.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018428 | AT3G48115.2 | Ch3:17771170-17772038 | AT1G27752.1 | protein_coding | 1:9662021-9667550 | -16.1982 | 819 | 848 | 311 | 284 | Ubiquitin system component Cue proteinUbiquitin system component Cue protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Ubiquitin system component Cue (InterPro:IPR003892); Has 423 Blast hits to 397 proteins in 140 species: Archae - 0; Bacteria - 35; Metazoa - 153; Fungi - 103; Plants - 62; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). | |
| XLOC_015622 | AT3G52535.1 | Ch3:19487129-19488530 | AT3G15970.1 | protein_coding | 3:5408792-5411153 | -16.198 | 153 | 174 | 633 | 608 | NUP50 (Nucleoporin 50 kDa) protein NUP50 (Nucleoporin 50 kDa) protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: intracellular transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ran binding protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993), Nuclear pore complex, NUP2/50/61 (InterPro:IPR015007); NUP50 (Nucleoporin 50 kDa) protein (TAIR:AT1G52380.1); Has 4078 Blast hits to 2719 proteins in 441 species: Archae - 18; Bacteria - 1103; Metazoa - 1379; Fungi - 710; Plants - 228; Viruses - 8; Other Eukaryotes - 632 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G67280.1 | protein_coding | 5:26842114-26845294 | -16.1972 | 236 | 258 | 1285 | 1261 | receptor-like kinase receptor-like kinase (RLK);FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT4G37250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006751 | AT1G08037.1 | Ch1:20588319-20589100 | AT3G63200.1 | protein_coding | 3:23345754-23347672 | -16.1972 | 345 | 375 | 661 | 628 | PATATIN-like protein 9PATATIN-like protein 9 (PLP9);FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: metabolic process, lipid metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Patatin (InterPro:IPR002641); PATATIN-like protein 6 (TAIR:AT2G39220.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_020466 | AT4G06810.1 | Ch4:10180117-10180748 | AT1G06230.1 | protein_coding | 1:1906963-1911056 | -16.1898 | 2 | 33 | 39 | 10 | global transcription factor group E4 This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation.global transcription factor group E4 (GTE4);CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); DNA-binding bromodomain-containing protein (TAIR:AT1G17790.1); Has 9656 Blast hits to 6188 proteins in 362 species: Archae - 8; Bacteria - 274; Metazoa - 4793; Fungi - 1365; Plants - 669; Viruses - 49; Other Eukaryotes - 2498 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT5G46260.1 | protein_coding | 5:18758699-18763503 | -16.188 | 472 | 530 | 2975 | 2922 | disease resistance protein (TIR-NBS-LRR class) family disease resistance protein (TIR-NBS-LRR class) family;FUNCTIONS IN: transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157), Disease resistance protein (InterPro:IPR000767); Disease resistance protein (TIR-NBS-LRR class) family (TAIR:AT5G46270.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.4 | Ch1:9726607-9730185 | AT5G27870.1 | protein_coding | 5:9878689-9881848 | -16.1871 | 1423 | 1457 | 2164 | 2133 | Plant invertase/pectin methylesterase inhibitor superfamily Plant invertase/pectin methylesterase inhibitor superfamily;FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); Plant invertase/pectin methylesterase inhibitor superfamily (TAIR:AT3G05610.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT3G60910.1 | protein_coding | 3:22501544-22503372 | -16.1845 | 108 | 147 | 49 | 5 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G17365.1); Has 1732 Blast hits to 1731 proteins in 520 species: Archae - 43; Bacteria - 761; Metazoa - 337; Fungi - 50; Plants - 206; Viruses - 0; Other Eukaryotes - 335 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT5G67340.1 | protein_coding | 5:26864395-26867847 | -16.1824 | 1863 | 1885 | 47 | 25 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: endomembrane system, ubiquitin ligase complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); RING/U-box superfamily protein with ARM repeat domain (TAIR:AT2G23140.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_021250 | AT4G31248.1 | Ch4:15179132-15180803 | AT2G35620.1 | protein_coding | 2:14960851-14965497 | -16.1823 | 1 | 31 | 90 | 61 | Leucine-rich repeat protein kinase family protein Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. FEI 2 (FEI2);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Leucine-rich repeat protein kinase family protein (TAIR:AT1G31420.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT2G26600.1 | protein_coding | 2:11316346-11318520 | -16.1716 | 673 | 693 | 365 | 345 | Glycosyl hydrolase superfamily proteinGlycosyl hydrolase superfamily protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); Glycosyl hydrolase superfamily protein (TAIR:AT3G15800.1); Has 2133 Blast hits to 2119 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 2120; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | |
| XLOC_016958 | AT3G02505.1 | Ch3:3960120-3960327 | AT1G21580.1 | protein_coding | 1:7557140-7565914 | -16.1688 | 110 | 136 | 282 | 258 | Zinc finger C-x8-C-x5-C-x3-H type family protein Zinc finger C-x8-C-x5-C-x3-H type family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 6412 Blast hits to 4180 proteins in 441 species: Archae - 2; Bacteria - 615; Metazoa - 1993; Fungi - 936; Plants - 1540; Viruses - 149; Other Eukaryotes - 1177 (source: NCBI BLink). | |
| XLOC_023950 | AT4G09695.1 | Ch4:17935407-17937048 | AT3G28030.1 | protein_coding | 3:10424179-10431364 | -16.1667 | 334 | 355 | 873 | 852 | 5'-3' exonuclease family protein Required for repair of pyrimidine-pyrimidinone (6-4) dimers. ULTRAVIOLET HYPERSENSITIVE 3 (UVH3);FUNCTIONS IN: protein binding, nuclease activity; INVOLVED IN: DNA repair, response to UV-B, response to heat, non-photoreactive DNA repair; LOCATED IN: nucleus; EXPRESSED IN: stem, leaf whorl, seed; EXPRESSED DURING: E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: XPG conserved site (InterPro:IPR019974), Xeroderma pigmentosum group G protein (InterPro:IPR001044), XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease, C-terminal subdomain (InterPro:IPR020045), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG/RAD2 endonuclease (InterPro:IPR006086); 5'-3' exonuclease family protein (TAIR:AT1G01880.1); Has 8115 Blast hits to 5779 proteins in 624 species: Archae - 528; Bacteria - 414; Metazoa - 2441; Fungi - 1496; Plants - 576; Viruses - 71; Other Eukaryotes - 2589 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT2G02800.1 | protein_coding | 2:795515-799591 | -16.1655 | 977 | 1019 | 74 | 36 | protein kinase 2B Encodes protein kinase APK2b. protein kinase 2B (APK2B);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); protein kinase 2A (TAIR:AT1G14370.1); Has 113663 Blast hits to 112197 proteins in 3955 species: Archae - 101; Bacteria - 13127; Metazoa - 42007; Fungi - 9244; Plants - 32902; Viruses - 370; Other Eukaryotes - 15912 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.4 | Ch1:22294362-22297374 | AT2G46920.1 | protein_coding | 2:19277884-19281811 | -16.1634 | 1472 | 1495 | 3150 | 3128 | Protein phosphatase 2C family protein Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS.poltergeist (POL);FUNCTIONS IN: phospholipid binding, protein serine/threonine phosphatase activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); poltergeist like 1 (TAIR:AT2G35350.1); Has 1941 Blast hits to 1802 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 375; Fungi - 295; Plants - 1017; Viruses - 0; Other Eukaryotes - 254 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.3 | Ch1:22294362-22297374 | AT2G46920.1 | protein_coding | 2:19277884-19281811 | -16.1634 | 1049 | 1072 | 3150 | 3128 | Protein phosphatase 2C family protein Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS.poltergeist (POL);FUNCTIONS IN: phospholipid binding, protein serine/threonine phosphatase activity; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); poltergeist like 1 (TAIR:AT2G35350.1); Has 1941 Blast hits to 1802 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 375; Fungi - 295; Plants - 1017; Viruses - 0; Other Eukaryotes - 254 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT2G36800.1 | protein_coding | 2:15423172-15425129 | -16.1632 | 737 | 761 | 1409 | 1378 | don-glucosyltransferase 1 Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. don-glucosyltransferase 1 (DOGT1);CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyl transferase 73C6 (TAIR:AT2G36790.1); Has 7663 Blast hits to 7564 proteins in 401 species: Archae - 0; Bacteria - 196; Metazoa - 2172; Fungi - 32; Plants - 5134; Viruses - 64; Other Eukaryotes - 65 (source: NCBI BLink). | |
| XLOC_023849 | AT4G36648.1 | Ch4:17280528-17282730 | AT3G03490.1 | protein_coding | 3:830116-831997 | -16.1596 | 1970 | 2001 | 263 | 233 | peroxin 19-1 Encodes one of two PEX19 peroxin isoforms. It is predominantly cytosolic and forms dimers.peroxin 19-1 (PEX19-1);CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); peroxin 19-2 (TAIR:AT5G17550.1); Has 637 Blast hits to 625 proteins in 250 species: Archae - 3; Bacteria - 161; Metazoa - 169; Fungi - 149; Plants - 43; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). | |
| XLOC_013247 | AT3G01035.1 | Ch3:182977-183321 | AT1G05490.1 | protein_coding | 1:1618504-1623489 | -16.1492 | 102 | 137 | 3443 | 3404 | chromatin remodeling 31 chromatin remodeling 31 (chr31);FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); chromatin remodeling 40 (TAIR:AT3G24340.1); Has 38115 Blast hits to 26256 proteins in 2107 species: Archae - 207; Bacteria - 10267; Metazoa - 11226; Fungi - 5719; Plants - 1929; Viruses - 244; Other Eukaryotes - 8523 (source: NCBI BLink). | |
| XLOC_019365 | AT3G63445.2 | Ch3:23422590-23425169 | AT1G23880.1 | protein_coding | 1:8435657-8438811 | -16.1484 | 764 | 786 | 554 | 521 | NHL domain-containing protein NHL domain-containing protein;CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); NHL domain-containing protein (TAIR:AT1G70280.2); Has 2830 Blast hits to 1270 proteins in 217 species: Archae - 77; Bacteria - 1235; Metazoa - 81; Fungi - 0; Plants - 196; Viruses - 0; Other Eukaryotes - 1241 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT2G32770.3 | protein_coding | 2:13895825-13898389 | -16.142 | 3131 | 3148 | 244 | 227 | purple acid phosphatase 13 purple acid phosphatase 13 (PAP13);FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage;CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); purple acid phosphatase 15 (TAIR:AT3G07130.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | |
| XLOC_001968 | AT1G34844.1 | Ch1:12751156-12752796 | AT4G37110.1 | protein_coding | 4:17484030-17486400 | -16.1412 | 1046 | 1071 | 247 | 226 | Zinc-finger domain of monoamine-oxidase A repressor R1Zinc-finger domain of monoamine-oxidase A repressor R1;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Cell division cycle-associated protein (InterPro:IPR018866); Zinc-finger domain of monoamine-oxidase A repressor R1 (TAIR:AT2G23530.1); Has 452 Blast hits to 447 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 54; Plants - 229; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). | |
| XLOC_021568 | AT4G09335.1 | Ch4:17225058-17225421 | AT2G46500.1 | protein_coding | 2:19086492-19089229 | -16.138 | 211 | 244 | 156 | 122 | phosphoinositide 4-kinase gamma 4 Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates.CONTAINS phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. phosphoinositide 4-kinase gamma 4 (PI4K GAMMA 4);CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403), Ubiquitin subgroup (InterPro:IPR019956), Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955); Phosphatidylinositol 3- and 4-kinase ;Ubiquitin family protein (TAIR:AT5G24240.1); Has 12754 Blast hits to 4652 proteins in 669 species: Archae - 0; Bacteria - 30; Metazoa - 5285; Fungi - 1569; Plants - 3375; Viruses - 284; Other Eukaryotes - 2211 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G80010.1 | protein_coding | 1:30097336-30100045 | -16.1365 | 1802 | 1856 | 799 | 753 | FAR1-related sequence 8 FAR1-related sequence 8 (FRS8);FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); FAR1-related sequence 6 (TAIR:AT1G52520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_003665 | AT1G09297.1 | Ch1:27119300-27119697 | AT1G50732.1 | protein_coding | 1:18802552-18803755 | -16.1349 | 313 | 332 | 433 | 414 | unknown protein. | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT3G22425.2 | protein_coding | 3:7951023-7953223 | -16.1312 | 537 | 557 | 265 | 245 | imidazoleglycerol-phosphate dehydratase Encodes imidazoleglycerolphosphate dehydratase. imidazoleglycerol-phosphate dehydratase (IGPD);FUNCTIONS IN: imidazoleglycerol-phosphate dehydratase activity; INVOLVED IN: histidine biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Imidazoleglycerol-phosphate dehydratase, conserved site (InterPro:IPR020565), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), Imidazoleglycerol-phosphate dehydratase (InterPro:IPR000807); HISTIDINE BIOSYNTHESIS 5B (TAIR:AT4G14910.1); Has 6872 Blast hits to 6870 proteins in 2212 species: Archae - 198; Bacteria - 4110; Metazoa - 4; Fungi - 197; Plants - 87; Viruses - 0; Other Eukaryotes - 2276 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G20320.1 | protein_coding | 5:6859212-6869307 | -16.1281 | 974 | 1020 | 505 | 464 | dicer-like 4 Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein.dicer-like 4 (DCL4);CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Ribonuclease III (InterPro:IPR000999), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Dicer double-stranded RNA-binding fold (InterPro:IPR005034), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); dicer-like 2 (TAIR:AT3G03300.3); Has 20138 Blast hits to 15531 proteins in 2958 species: Archae - 325; Bacteria - 10957; Metazoa - 2671; Fungi - 1592; Plants - 1161; Viruses - 33; Other Eukaryotes - 3399 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT1G73150.1 | protein_coding | 1:27503973-27506406 | -16.1277 | 3371 | 3420 | 925 | 877 | global transcription factor group E3 Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. global transcription factor group E3 (GTE3);FUNCTIONS IN: histone binding, DNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); DNA-binding bromodomain-containing protein (TAIR:AT1G17790.1); Has 5728 Blast hits to 4631 proteins in 254 species: Archae - 0; Bacteria - 6; Metazoa - 3450; Fungi - 928; Plants - 599; Viruses - 0; Other Eukaryotes - 745 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.4 | Ch1:12118990-12124001 | AT3G59050.1 | protein_coding | 3:21824696-21827509 | -16.127 | 27 | 46 | 415 | 396 | polyamine oxidase 3Encodes a polyamine oxidase. polyamine oxidase 3 (PAO3);CONTAINS InterPro DOMAIN/s: Amine oxidase (InterPro:IPR002937), Flavin-containing amine oxidase (InterPro:IPR001613); polyamine oxidase 2 (TAIR:AT2G43020.1); Has 6641 Blast hits to 6191 proteins in 1102 species: Archae - 131; Bacteria - 2618; Metazoa - 1408; Fungi - 589; Plants - 766; Viruses - 0; Other Eukaryotes - 1129 (source: NCBI BLink). | |
| XLOC_001325 | AT1G05837.1 | Ch1:8423069-8424073 | AT1G72040.1 | protein_coding | 1:27111894-27114399 | -16.1248 | 646 | 700 | 275 | 238 | P-loop containing nucleoside triphosphate hydrolases superfamily proteinEncodes a multisubstrate deoxyribonucleoside kinase that salvages DNA precursors. P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 2859 Blast hits to 2855 proteins in 704 species: Archae - 0; Bacteria - 1629; Metazoa - 493; Fungi - 0; Plants - 69; Viruses - 71; Other Eukaryotes - 597 (source: NCBI BLink). | |
| XLOC_029565 | AT5G06155.2 | Ch5:16534231-16535279 | AT3G02250.1 | protein_coding | 3:423791-427095 | -16.1248 | 643 | 678 | 263 | 234 | O-fucosyltransferase family protein O-fucosyltransferase family protein;CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); O-fucosyltransferase family protein (TAIR:AT5G15740.1); Has 830 Blast hits to 821 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 830; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G17120.1 | protein_coding | 3:5841046-5843624 | -16.1246 | 3104 | 3148 | 486 | 445 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G02380.1); Has 67 Blast hits to 67 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT5G20840.1 | protein_coding | 5:7060992-7069343 | -16.1228 | 673 | 693 | 157 | 132 | Phosphoinositide phosphatase family protein Phosphoinositide phosphatase family protein;CONTAINS InterPro DOMAIN/s: Synaptojanin, N-terminal (InterPro:IPR002013); Phosphoinositide phosphatase family protein (TAIR:AT3G43220.1); Has 1872 Blast hits to 1673 proteins in 232 species: Archae - 0; Bacteria - 12; Metazoa - 657; Fungi - 613; Plants - 279; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G38880.1 | protein_coding | 5:15562939-15569250 | -16.1224 | 23 | 72 | 829 | 784 | unknown protein; Has 474 Blast hits to 433 proteins in 138 species: Archae - 6; Bacteria - 80; Metazoa - 195; Fungi - 44; Plants - 59; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). | |
| XLOC_012212 | AT2G31751.2 | Ch2:13497140-13502275 | AT3G42880.1 | protein_coding | 3:14954363-14957031 | -16.12 | 1230 | 1264 | 1016 | 978 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT5G20690.1); Has 99886 Blast hits to 64132 proteins in 3251 species: Archae - 77; Bacteria - 7250; Metazoa - 18347; Fungi - 2712; Plants - 63147; Viruses - 166; Other Eukaryotes - 8187 (source: NCBI BLink). | |
| XLOC_013898 | AT3G13277.1 | Ch3:4290082-4291595 | AT4G22470.1 | protein_coding | 4:11840134-11841450 | -16.1176 | 416 | 449 | 830 | 787 | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein protease inhibitor/seed storage/lipid transfer protein (LTP) family protein;FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, hypocotyl, sepal, stamen; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/hydrophobic protein, helical domain (InterPro:IPR013770); Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (TAIR:AT4G22485.1); Has 219939 Blast hits to 80042 proteins in 2746 species: Archae - 655; Bacteria - 50351; Metazoa - 79801; Fungi - 26960; Plants - 28532; Viruses - 6737; Other Eukaryotes - 26903 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT4G22560.1 | protein_coding | 4:11880080-11881088 | -16.1163 | 309 | 332 | 707 | 686 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G12450.1); Has 380 Blast hits to 380 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 374; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT5G24100.1 | protein_coding | 5:8148544-8151385 | -16.1102 | 262 | 295 | 2126 | 2095 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT5G53320.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.2 | Ch3:19312062-19314685 | AT2G25220.2 | protein_coding | 2:10742623-10745819 | -16.1047 | 1447 | 1478 | 107 | 69 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT4G32000.1). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT5G02540.1 | protein_coding | 5:568425-570973 | -16.1041 | 599 | 638 | 226 | 201 | NAD(P)-binding Rossmann-fold superfamily protein NAD(P)-binding Rossmann-fold superfamily protein;FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: NAD(P)-binding domain (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT2G37540.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_006755 | AT1G08043.2 | Ch1:20617324-20618241 | AT1G73660.1 | protein_coding | 1:27691893-27697372 | -16.1021 | 100 | 147 | 2229 | 2186 | protein tyrosine kinase family protein Encodes a protein with similarity to MAPKKKs. May function as a negative regulator of salt tolerance. protein tyrosine kinase family protein;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Ubiquitin interacting motif (InterPro:IPR003903), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G18160.1); Has 126827 Blast hits to 124278 proteins in 4857 species: Archae - 98; Bacteria - 13376; Metazoa - 48156; Fungi - 11388; Plants - 33654; Viruses - 503; Other Eukaryotes - 19652 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.2 | Ch1:9065955-9071457 | AT1G49832.1 | ncRNA | 1:18447615-18448335 | -16.0993 | 2776 | 2806 | 28 | 2 | ||
| XLOC_023238 | AT4G26095.1 | Ch4:13224204-13227622 | AT4G04890.1 | protein_coding | 4:2476390-2482447 | -16.0963 | 901 | 919 | 90 | 67 | protodermal factor 2 Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. protodermal factor 2 (PDF2);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: epidermal cell differentiation, regulation of transcription, DNA-dependent, cotyledon development; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Lipid-binding START (InterPro:IPR002913), Homeodomain-related (InterPro:IPR012287); Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein (TAIR:AT4G21750.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT4G01000.1 | protein_coding | 4:431516-434029 | -16.0945 | 56 | 86 | 525 | 496 | Ubiquitin-like superfamily protein Ubiquitin-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); ubiquitin family protein (TAIR:AT3G06455.1); Has 9247 Blast hits to 4627 proteins in 669 species: Archae - 0; Bacteria - 50; Metazoa - 4022; Fungi - 1172; Plants - 2220; Viruses - 170; Other Eukaryotes - 1613 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G14350.1 | protein_coding | 1:4907887-4911168 | -16.0924 | 667 | 719 | 204 | 137 | Duplicated homeodomain-like superfamily protein Encodes a putative MYB transcription factor involved in stomata development, loss of FLP activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants with MYB88. FOUR LIPS (FLP);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287), Myb transcription factor (InterPro:IPR015495); myb domain protein 88 (TAIR:AT2G02820.2); Has 8541 Blast hits to 7630 proteins in 544 species: Archae - 0; Bacteria - 2; Metazoa - 904; Fungi - 531; Plants - 5146; Viruses - 6; Other Eukaryotes - 1952 (source: NCBI BLink). | |
| XLOC_019150 | AT3G09275.1 | Ch3:22142893-22144281 | AT1G47870.1 | protein_coding | 1:17634697-17637809 | -16.0905 | 139 | 156 | 343 | 326 | winged-helix DNA-binding transcription factor family protein Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. AtE2Fc is regulated by a balance between gene expression and ubiquitin-proteasome proteolysis. AtE2Fc might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. E2Fc has been shown to interact with DPB in its nonphosphorylated form; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost.ATE2F2;CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Transcription factor E2F/dimerisation partner (TDP) (InterPro:IPR003316), E2F Family (InterPro:IPR015633); E2F transcription factor 1 (TAIR:AT5G22220.3); Has 948 Blast hits to 896 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 12; Plants - 245; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT3G60400.1 | protein_coding | 3:22329048-22331338 | -16.0902 | 534 | 555 | 417 | 396 | Mitochondrial transcription termination factor family protein Mitochondrial transcription termination factor family protein;CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); Mitochondrial transcription termination factor family protein (TAIR:AT5G06810.1); Has 395 Blast hits to 388 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 394; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT3G61240.1 | protein_coding | 3:22666147-22669757 | -16.0893 | 154 | 171 | 137 | 120 | DEA(D/H)-box RNA helicase family protein DEA(D/H)-box RNA helicase family protein;FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); DEA(D/H)-box RNA helicase family protein (TAIR:AT2G45810.1); Has 53038 Blast hits to 46572 proteins in 3157 species: Archae - 705; Bacteria - 22269; Metazoa - 8742; Fungi - 5746; Plants - 2904; Viruses - 84; Other Eukaryotes - 12588 (source: NCBI BLink). | |
| XLOC_021911 | AT4G04055.1 | Ch4:897472-898253 | AT1G18390.2 | protein_coding | 1:6325536-6330179 | -16.0862 | 673 | 697 | 50 | 29 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT1G66880.1); Has 128125 Blast hits to 126473 proteins in 4812 species: Archae - 110; Bacteria - 14433; Metazoa - 47787; Fungi - 10757; Plants - 35416; Viruses - 568; Other Eukaryotes - 19054 (source: NCBI BLink). | |
| XLOC_019676 | AT4G04223.1 | Ch4:2036511-2037800 | AT5G09600.1 | protein_coding | 5:2978825-2981096 | -16.083 | 52 | 69 | 303 | 286 | succinate dehydrogenase 3-1Encodes one of the membrane anchor subunits of the mitochondrial respiratory complex II. The protein is encoded by the nuclear genome but is imported into the mitochondrion. There are two genes that encode this protein, the other is SDH3-2. succinate dehydrogenase 3-1 (SDH3-1);CONTAINS InterPro DOMAIN/s: Succinate dehydrogenase/Fumarate reductase, transmembrane subunit (InterPro:IPR000701); succinate dehydrogenase 3-2 (TAIR:AT4G32210.1); Has 400 Blast hits to 400 proteins in 121 species: Archae - 0; Bacteria - 45; Metazoa - 67; Fungi - 61; Plants - 100; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT5G20300.1 | protein_coding | 5:6853299-6856981 | -16.082 | 2293 | 2317 | 50 | 27 | Avirulence induced gene (AIG1) family proteinEncodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast. Avirulence induced gene (AIG1) family protein;FUNCTIONS IN: GTP binding; LOCATED IN: chloroplast outer membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: AIG1 (InterPro:IPR006703); multimeric translocon complex in the outer envelope membrane 132 (TAIR:AT2G16640.1); Has 993 Blast hits to 978 proteins in 186 species: Archae - 2; Bacteria - 206; Metazoa - 376; Fungi - 41; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.3 | Ch1:22302306-22305242 | AT1G69170.1 | protein_coding | 1:26005068-26007368 | -16.0808 | 2262 | 2315 | 182 | 131 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein Encodes SPL6. Required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that SPL6 positively regulates a subset of defense genes. Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); squamosa promoter binding protein-like 14 (TAIR:AT1G20980.1); Has 836 Blast hits to 835 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 834; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005049 | AT1G15175.3 | Ch1:5222729-5224055 | AT1G41830.1 | protein_coding | 1:15603568-15607966 | -16.067 | 60 | 80 | 101 | 81 | SKU5-similar 6SKU5-similar 6 (SKS6);FUNCTIONS IN: pectinesterase activity; INVOLVED IN: oxidation reduction; LOCATED IN: apoplast, cell wall, membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 3 (InterPro:IPR011707), Multicopper oxidase, type 1 (InterPro:IPR001117); SKU5 similar 5 (TAIR:AT1G76160.1); Has 4991 Blast hits to 4914 proteins in 848 species: Archae - 16; Bacteria - 1377; Metazoa - 295; Fungi - 1862; Plants - 1313; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). | |
| XLOC_003487 | AT1G69252.1 | Ch1:26036570-26037649 | AT2G48010.1 | protein_coding | 2:19641351-19643899 | -16.0667 | 22 | 53 | 51 | 24 | receptor-like kinase in in flowers 3 receptor-like serine/threonine kinase (RKF3) receptor-like kinase in in flowers 3 (RKF3);FUNCTIONS IN: receptor signaling protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT1G11050.1); Has 112833 Blast hits to 111726 proteins in 4356 species: Archae - 97; Bacteria - 12546; Metazoa - 41926; Fungi - 9138; Plants - 32648; Viruses - 383; Other Eukaryotes - 16095 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT5G12480.1 | protein_coding | 5:4047513-4050643 | -16.0654 | 231 | 250 | 1879 | 1859 | calmodulin-domain protein kinase 7 calmodulin-domain protein kinase CDPK isoform 7 (CPK7) calmodulin-domain protein kinase 7 (CPK7);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), EF-Hand 1, calcium-binding site (InterPro:IPR018247), Serine/threonine-protein kinase domain (InterPro:IPR002290), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand-like domain (InterPro:IPR011992), EF-hand (InterPro:IPR018248), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), EF-HAND 2 (InterPro:IPR018249), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); calcium-dependent protein kinase 19 (TAIR:AT5G19450.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_010840 | AT2G04285.1 | Ch2:763851-764640 | AT3G57100.1 | protein_coding | 3:21133013-21134482 | -16.0627 | 12 | 35 | 209 | 186 | Protein ofunknown function (DUF677) Protein ofunknown function (DUF677);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF677 (InterPro:IPR007749); Protein ofunknown function (DUF677) (TAIR:AT4G34320.1); Has 123 Blast hits to 123 proteins in 12 species: Archae - 2; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 116; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_025053 | AT5G18255.2 | Ch5:6035619-6037641 | AT1G54570.1 | protein_coding | 1:20380435-20385380 | -16.0588 | 1017 | 1046 | 890 | 853 | Esterase/lipase/thioesterase family proteinEncodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. Esterase/lipase/thioesterase family protein;FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, catalytic activity; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); Esterase/lipase/thioesterase family protein (TAIR:AT5G41130.1); Has 651 Blast hits to 637 proteins in 188 species: Archae - 0; Bacteria - 283; Metazoa - 139; Fungi - 19; Plants - 149; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). | |
| XLOC_028851 | AT5G23410.1 | Ch5:7885591-7886785 | AT5G51420.1 | protein_coding | 5:20885419-20886762 | -16.0587 | 7 | 52 | 167 | 125 | long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein; MBOAT (membrane bound O-acyl transferase) family protein (TAIR:AT5G55350.1); Has 429 Blast hits to 418 proteins in 114 species: Archae - 0; Bacteria - 193; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | |
| XLOC_025053 | AT5G18255.2 | Ch5:6035619-6037641 | AT4G00580.1 | protein_coding | 4:247927-250406 | -16.058 | 1192 | 1221 | 418 | 392 | COP1-interacting protein-related COP1-interacting protein-related; COP1-interacting protein-related (TAIR:AT2G01800.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.4 | Ch1:9065955-9071457 | AT3G27090.1 | protein_coding | 3:9989511-9991903 | -16.0548 | 675 | 719 | 1281 | 1241 | DCD (Development and Cell Death) domain protein DCD (Development and Cell Death) domain protein;CONTAINS InterPro DOMAIN/s: Development/cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); DCD (Development and Cell Death) domain protein (TAIR:AT5G42050.1); Has 746 Blast hits to 671 proteins in 44 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 297; Viruses - 0; Other Eukaryotes - 441 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.3 | Ch1:22294362-22297374 | AT2G23420.1 | protein_coding | 2:9971603-9975207 | -16.0482 | 2536 | 2565 | 1894 | 1855 | nicotinate phosphoribosyltransferase 2nicotinate phosphoribosyltransferase 2 (NAPRT2);FUNCTIONS IN: nicotinate phosphoribosyltransferase activity; INVOLVED IN: pyridine nucleotide biosynthetic process, nicotinate nucleotide salvage; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Nicotinate phosphoribosyltransferase-related (InterPro:IPR007229), Nicotinate phosphoribosyltransferase putative (InterPro:IPR006405), Nicotinate phosphoribosyltransferase-like (InterPro:IPR015977); nicotinate phosphoribosyltransferase 1 (TAIR:AT4G36940.1); Has 2998 Blast hits to 2961 proteins in 1361 species: Archae - 146; Bacteria - 2405; Metazoa - 184; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). | |
| XLOC_006986 | AT1G60505.2 | Ch1:22294362-22297374 | AT2G23420.1 | protein_coding | 2:9971603-9975207 | -16.048 | 2536 | 2565 | 1894 | 1855 | nicotinate phosphoribosyltransferase 2nicotinate phosphoribosyltransferase 2 (NAPRT2);FUNCTIONS IN: nicotinate phosphoribosyltransferase activity; INVOLVED IN: pyridine nucleotide biosynthetic process, nicotinate nucleotide salvage; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Nicotinate phosphoribosyltransferase-related (InterPro:IPR007229), Nicotinate phosphoribosyltransferase putative (InterPro:IPR006405), Nicotinate phosphoribosyltransferase-like (InterPro:IPR015977); nicotinate phosphoribosyltransferase 1 (TAIR:AT4G36940.1); Has 2998 Blast hits to 2961 proteins in 1361 species: Archae - 146; Bacteria - 2405; Metazoa - 184; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). | |
| XLOC_002964 | AT1G60545.2 | Ch1:22302306-22305242 | AT4G34030.1 | protein_coding | 4:16301027-16304099 | -16.0477 | 259 | 301 | 1713 | 1669 | 3-methylcrotonyl-CoA carboxylase MCC-B is involved in leucine degradation in mitochondria. The active protein is a dimer of MCC-A and MCC-B. MCC-A is biotinylated whereas MCC-B is not. 3-methylcrotonyl-CoA carboxylase (MCCB);FUNCTIONS IN: biotin carboxylase activity, cobalt ion binding, methylcrotonoyl-CoA carboxylase activity, zinc ion binding; INVOLVED IN: leucine catabolic process; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Acetyl-coenzyme A carboxyltransferase, N-terminal (InterPro:IPR011762), Carboxyl transferase (InterPro:IPR000022), Acetyl-coenzyme A carboxyltransferase, C-terminal (InterPro:IPR011763); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT1G04520.1 | protein_coding | 1:1231452-1234032 | -16.0461 | 970 | 996 | 1035 | 1009 | plasmodesmata-located protein 2 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. plasmodesmata-located protein 2 (PDLP2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: N-terminal protein myristoylation, plasmodesmata-mediated intercellular transport; LOCATED IN: plasmodesma; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF26 (InterPro:IPR002902); plasmodesmata-located protein 3 (TAIR:AT2G33330.1); Has 1091 Blast hits to 1028 proteins in 65 species: Archae - 0; Bacteria - 64; Metazoa - 5; Fungi - 13; Plants - 1007; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.1 | Ch1:9726607-9730185 | AT1G04210.1 | protein_coding | 1:1114375-1119739 | -16.0381 | 2290 | 2317 | 31 | 4 | Leucine-rich repeat protein kinase family protein Encodes a putative Raf-related kinase. Leucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G31170.3); Has 130301 Blast hits to 104916 proteins in 2869 species: Archae - 120; Bacteria - 15185; Metazoa - 50195; Fungi - 9983; Plants - 37286; Viruses - 367; Other Eukaryotes - 17165 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G06450.1 | protein_coding | 1:1965840-1967219 | -16.0374 | 532 | 563 | 1245 | 1212 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein Polynucleotidyl transferase, ribonuclease H-like superfamily protein;FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, ribonuclease H fold (InterPro:IPR012337); Polynucleotidyl transferase, ribonuclease H-like superfamily protein (TAIR:AT3G44240.1); Has 884 Blast hits to 883 proteins in 223 species: Archae - 0; Bacteria - 0; Metazoa - 252; Fungi - 148; Plants - 363; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). | |
| XLOC_013042 | AT2G45315.1 | Ch2:18682089-18684072 | AT1G50280.1 | protein_coding | 1:18623698-18626441 | -16.0335 | 250 | 290 | 1205 | 1154 | Phototropic-responsive NPH3 family protein Phototropic-responsive NPH3 family protein;FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: cellular_componentunknown; EXPRESSED IN: shoot, leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible, 4 leaf senescence stage;CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); Phototropic-responsive NPH3 family protein (TAIR:AT3G19850.1); Has 794 Blast hits to 779 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 789; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT5G40760.1 | protein_coding | 5:16310663-16314811 | -16.0314 | 154 | 171 | 127 | 110 | glucose-6-phosphate dehydrogenase 6Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. glucose-6-phosphate dehydrogenase 6 (G6PD6);CONTAINS InterPro DOMAIN/s: Glucose-6-phosphate dehydrogenase, C-terminal (InterPro:IPR022675), Glucose-6-phosphate dehydrogenase, active site (InterPro:IPR019796), NAD(P)-binding domain (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282), Glucose-6-phosphate dehydrogenase, NAD-binding (InterPro:IPR022674); glucose-6-phosphate dehydrogenase 5 (TAIR:AT3G27300.3); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_025669 | AT5G05015.1 | Ch5:12268393-12268631 | AT5G53800.1 | protein_coding | 5:21848035-21850111 | -16.0282 | 6 | 26 | 490 | 470 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_008791 | AT2G06485.1 | Ch2:6876163-6876750 | AT4G02070.1 | protein_coding | 4:905865-913290 | -16.0268 | 133 | 170 | 121 | 81 | MUTS homolog 6 encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. MUTS homolog 6 (MSH6);FUNCTIONS IN: damaged DNA binding; INVOLVED IN: mismatch repair; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: DNA mismatch repair protein Msh6 (InterPro:IPR017261), DNA mismatch repair protein MutS, clamp (InterPro:IPR007861), DNA mismatch repair protein MutS, connector (InterPro:IPR007860), DNA mismatch repair protein MutS, core (InterPro:IPR007696), DNA mismatch repair protein MutS-like, N-terminal (InterPro:IPR007695), DNA mismatch repair protein MutS, N-terminal (InterPro:IPR016151), DNA mismatch repair protein MutS, C-terminal (InterPro:IPR000432), DNA mismatch repair protein MutS-homologue MSH6 (InterPro:IPR015536), Tudor domain (InterPro:IPR002999); homolog of DNA mismatch repair protein MSH3 (TAIR:AT4G25540.1); Has 29702 Blast hits to 21889 proteins in 2967 species: Archae - 234; Bacteria - 11721; Metazoa - 3243; Fungi - 2118; Plants - 3658; Viruses - 802; Other Eukaryotes - 7926 (source: NCBI BLink). | |
| XLOC_001887 | AT1G33415.2 | Ch1:12118990-12124001 | AT1G54170.1 | protein_coding | 1:20221029-20226055 | -16.0259 | 81 | 104 | 1084 | 1061 | CTC-interacting domain 3 ataxin-2-related, similar to SCA2 (GI:1770390) (Homo sapiens); similar to ataxin-2 (GI:3005020) (Mus musculus). Member of a family of PAM2 motif containing proteins. CTC-interacting domain 3 (CID3);CONTAINS InterPro DOMAIN/s: LsmAD domain (InterPro:IPR009604), Ataxin-2, C-terminal (InterPro:IPR009818); CTC-interacting domain 4 (TAIR:AT3G14010.3); Has 939 Blast hits to 759 proteins in 220 species: Archae - 0; Bacteria - 26; Metazoa - 423; Fungi - 216; Plants - 125; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT5G13760.1 | protein_coding | 5:4441858-4445014 | -16.0248 | 1019 | 1047 | 187 | 156 | Plasma-membrane choline transporter family protein Plasma-membrane choline transporter family protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF580 (InterPro:IPR007603); Plasma-membrane choline transporter family protein (TAIR:AT3G04440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_004025 | AT1G78265.1 | Ch1:29450551-29452415 | AT1G54640.1 | protein_coding | 1:20403892-20404807 | -16.0243 | 269 | 320 | 639 | 602 | F-box family protein-related F-box family protein-related;CONTAINS InterPro DOMAIN/s: F-box associated interaction domain (InterPro:IPR017451); F-box associated ubiquitination effector family protein (TAIR:AT1G32600.1); Has 66 Blast hits to 64 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
| XLOC_005446 | AT1G22403.1 | Ch1:7908568-7909708 | AT3G61570.1 | protein_coding | 3:22779441-22783938 | -16.0235 | 39 | 69 | 1246 | 1209 | GRIP-related ARF-binding domain-containing protein 1 This gene is predicted to encode a protein thatFUNCTIONS as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein. GRIP-related ARF-binding domain-containing protein 1 (GDAP1); golgin candidate 4 (TAIR:AT2G46180.1); Has 126642 Blast hits to 68271 proteins in 2953 species: Archae - 1677; Bacteria - 19686; Metazoa - 56998; Fungi - 11244; Plants - 6158; Viruses - 661; Other Eukaryotes - 30218 (source: NCBI BLink). | |
| XLOC_007872 | AT1G75295.1 | Ch1:28254820-28257236 | AT5G48330.1 | protein_coding | 5:19585924-19587857 | -16.0197 | 159 | 195 | 1370 | 1339 | Regulator of chromosome condensation (RCC1) family protein Regulator of chromosome condensation (RCC1) family protein;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); Regulator of chromosome condensation (RCC1) family protein (TAIR:AT5G63860.1); Has 20331 Blast hits to 5924 proteins in 464 species: Archae - 100; Bacteria - 2715; Metazoa - 6825; Fungi - 1055; Plants - 2791; Viruses - 2; Other Eukaryotes - 6843 (source: NCBI BLink). | |
| XLOC_012712 | AT2G09090.1 | Ch2:16671195-16672443 | AT2G37035.1 | protein_coding | 2:15554917-15556835 | -16.0177 | 1052 | 1070 | 1568 | 1550 | unknown protein; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
| XLOC_001435 | AT1G26558.2 | Ch1:9175611-9177556 | AT3G05270.1 | protein_coding | 3:1500368-1503481 | -16.0156 | 689 | 712 | 1519 | 1494 | Plant protein ofunknown function (DUF869) Plant protein ofunknown function (DUF869);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF869, plant (InterPro:IPR008587); Plant protein ofunknown function (DUF869) (TAIR:AT1G21810.1); Has 124843 Blast hits to 65585 proteins in 3211 species: Archae - 1867; Bacteria - 22851; Metazoa - 56517; Fungi - 10971; Plants - 7183; Viruses - 508; Other Eukaryotes - 24946 (source: NCBI BLink). | |
| XLOC_004023 | AT1G09797.1 | Ch1:29427802-29428566 | AT2G34970.1 | protein_coding | 2:14746236-14748783 | -16.0104 | 734 | 761 | 2221 | 2198 | Trimeric LpxA-like enzymeTrimeric LpxA-like enzyme;FUNCTIONS IN: binding, transferase activity, translation initiation factor activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process, regulation of translational initiation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024), Nucleotidyl transferase (InterPro:IPR005835); Trimeric LpxA-like enzyme (TAIR:AT4G18300.1); Has 8121 Blast hits to 7961 proteins in 1548 species: Archae - 574; Bacteria - 3735; Metazoa - 1296; Fungi - 469; Plants - 387; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT3G20650.1 | protein_coding | 3:7220733-7224090 | -16.0103 | 954 | 978 | 823 | 799 | mRNA capping enzyme family protein mRNA capping enzyme family protein;FUNCTIONS IN: catalytic activity; INVOLVED IN: mRNA capping; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: mRNA (guanine-N(7))-methyltransferase (InterPro:IPR016899), mRNA capping enzyme, large subunit (InterPro:IPR004971); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G52210.1); Has 916 Blast hits to 903 proteins in 291 species: Archae - 0; Bacteria - 22; Metazoa - 149; Fungi - 179; Plants - 106; Viruses - 144; Other Eukaryotes - 316 (source: NCBI BLink). | |
| XLOC_005726 | AT1G27921.2 | Ch1:9726607-9730185 | AT1G05380.1 | protein_coding | 1:1576822-1582672 | -16.009 | 1383 | 1417 | 65 | 36 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger proteinAcyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Acyl-CoA N-acyltransferase (InterPro:IPR016181), Zinc finger, PHD-finger (InterPro:IPR019787); Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein (TAIR:AT4G14920.1); Has 4682 Blast hits to 3960 proteins in 222 species: Archae - 3; Bacteria - 7; Metazoa - 2969; Fungi - 456; Plants - 787; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). | |
| XLOC_002356 | AT1G49832.2 | Ch1:18447615-18448335 | AT4G29860.1 | protein_coding | 4:14601698-14605810 | -16.0087 | 121 | 153 | 518 | 491 | Transducin/WD40 repeat-like superfamily protein Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. EMBRYO DEFECTIVE 2757 (EMB2757);FUNCTIONS IN: nucleotide binding; INVOLVED IN: acquisition of desiccation tolerance, embryo development, embryo development ending in seed dormancy; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: stem, rosette leaf, fruit, root, cultured cell; EXPRESSED DURING: F mature embryo stage, D bilateral stage, E expanded cotyledon stage;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT1G11160.1); Has 24053 Blast hits to 12842 proteins in 620 species: Archae - 42; Bacteria - 6408; Metazoa - 6694; Fungi - 5230; Plants - 2600; Viruses - 0; Other Eukaryotes - 3079 (source: NCBI BLink). | |
| XLOC_018668 | AT3G52072.1 | Ch3:19312062-19314685 | AT4G15110.1 | protein_coding | 4:8629647-8633118 | -16.0043 | 973 | 1012 | 47 | 5 | cytochrome P450, family 97, subfamily B, polypeptide 3 member of CYP97B "cytochrome P450, family 97, subfamily B, polypeptide 3" (CYP97B3);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 97, subfamily A, polypeptide 3 (TAIR:AT1G31800.1); Has 31568 Blast hits to 31460 proteins in 1570 species: Archae - 46; Bacteria - 3266; Metazoa - 11509; Fungi - 6986; Plants - 8573; Viruses - 6; Other Eukaryotes - 1182 (source: NCBI BLink). | |
| XLOC_006850 | AT1G56612.1 | Ch1:21213625-21215407 | AT4G27470.1 | protein_coding | 4:13734922-13736518 | -16.0037 | 1267 | 1292 | 912 | 888 | RING membrane-anchor 3 Encodes a RING finger E3 ubiquitin ligase. RING membrane-anchor 3 (RMA3);CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING membrane-anchor 1 (TAIR:AT4G03510.2); Has 2828 Blast hits to 2826 proteins in 265 species: Archae - 0; Bacteria - 0; Metazoa - 1348; Fungi - 459; Plants - 695; Viruses - 22; Other Eukaryotes - 304 (source: NCBI BLink). | |
| XLOC_005629 | AT1G26208.1 | Ch1:9065955-9071457 | AT5G18520.1 | protein_coding | 5:6144855-6146603 | -16.0013 | 2952 | 2972 | 813 | 793 | Lung seven transmembrane receptor family proteinEncodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. Lung seven transmembrane receptor family protein; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); Lung seven transmembrane receptor family protein (TAIR:AT3G09570.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | |
| XLOC_023897 | AT4G37432.2 | Ch4:17596973-17598929 | AT5G57380.1 | protein_coding | 5:23246395-23249504 | -16.0007 | 518 | 555 | 130 | 96 | Fibronectin type III domain-containing protein Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). In planta VIN3 and VRN2, VERNALIZATION 2, are part of a large protein complex that can include the polycomb group (PcG) proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE), CURLY LEAF (CLF), and SWINGER (SWN or EZA1). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. VERNALIZATION INSENSITIVE 3 (VIN3);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1423, plant (InterPro:IPR004082), Zinc finger, PHD-type (InterPro:IPR001965), Fibronectin, type III-like fold (InterPro:IPR008957), Fibronectin, type III (InterPro:IPR003961); vernalization5/VIN3-like (TAIR:AT4G30200.3); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | |
| XLOC_005057 | Ch1:5265681-5268418 | AT4G10250.1 | protein_coding | 4:6370338-6371372 | -16.0019 | 568 | 602 | 530 | 493 | HSP20-like chaperones superfamily protein Columbia endomembrane-localized small heat shock protein ATHSP22.0;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to heat; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); HSP20-like chaperones superfamily protein (TAIR:AT1G07400.1); Has 7552 Blast hits to 7552 proteins in 1747 species: Archae - 200; Bacteria - 4479; Metazoa - 74; Fungi - 263; Plants - 1560; Viruses - 4; Other Eukaryotes - 972 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT5G55300.2 | protein_coding | 5:22424502-22429514 | -16.0432 | 341 | 367 | 1944 | 1915 | DNA topoisomerase I alpha Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition.FUNCTIONS in stem cell maintenance at all stages of shoot and floral meristems and in the regulation of gene silencing. DNA topoisomerase I alpha (TOP1ALPHA);FUNCTIONS IN: protein binding, DNA topoisomerase type I activity; INVOLVED IN: in 8 processes; LOCATED IN: chromosome; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: DNA topoisomerase I, DNA binding, mixed alpha/beta motif, eukaryotic-type (InterPro:IPR013030), DNA topoisomerase I, DNA binding, eukaryotic-type (InterPro:IPR008336), DNA topoisomerase I, C-terminal (InterPro:IPR001631), DNA topoisomerase I, catalytic core, eukaryotic-type (InterPro:IPR013500), DNA topoisomerase I, active site (InterPro:IPR018521), DNA topoisomerase I, catalytic core, alpha/beta subdomain, eukaryotic-type (InterPro:IPR014727), DNA topoisomerase I, catalytic core, alpha-helical subdomain, eukaryotic-type (InterPro:IPR014711), DNA breaking-rejoining enzyme, catalytic core (InterPro:IPR011010), DNA topoisomerase I, C-terminal, eukaryotic-type (InterPro:IPR013499); DNA topoisomerase 1 beta (TAIR:AT5G55310.1). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT1G53300.1 | protein_coding | 1:19879405-19882895 | -16.0579 | 390 | 443 | 1036 | 985 | tetratricopetide-repeat thioredoxin-like 1 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. tetratricopetide-repeat thioredoxin-like 1 (TTL1);FUNCTIONS IN: binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Tetratricopeptide TPR-1 (InterPro:IPR001440), Thioredoxin fold (InterPro:IPR012335), Tetratricopeptide-like helical (InterPro:IPR011990), Thioredoxin domain (InterPro:IPR013766), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734), Thioredoxin-like fold (InterPro:IPR012336); tetratricopetide-repeat thioredoxin-like 2 (TAIR:AT3G14950.1); Has 32097 Blast hits to 15852 proteins in 1300 species: Archae - 552; Bacteria - 6287; Metazoa - 8110; Fungi - 3609; Plants - 2668; Viruses - 128; Other Eukaryotes - 10743 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT5G45640.1 | protein_coding | 5:18507489-18511616 | -16.0647 | 1109 | 1151 | 941 | 904 | Subtilisin-like serine endopeptidase family protein Subtilisin-like serine endopeptidase family protein;FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); subtilase family protein (TAIR:AT5G45650.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G37130.1 | protein_coding | 4:17489355-17492012 | -16.067 | 125 | 163 | 1413 | 1380 | hydroxyproline-rich glycoprotein family protein Encodes a member of the Nup62 subcomplex of the Arabidopsis NPC. hydroxyproline-rich glycoprotein family protein; Has 29299 Blast hits to 11722 proteins in 694 species: Archae - 13; Bacteria - 1010; Metazoa - 7996; Fungi - 3634; Plants - 2592; Viruses - 347; Other Eukaryotes - 13707 (source: NCBI BLink). | ||
| XLOC_012146 | Ch2:13049320-13052386 | AT1G74330.1 | protein_coding | 1:27943243-27947886 | -16.0874 | 278 | 299 | 187 | 165 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase superfamily protein (TAIR:AT1G18670.1); Has 123005 Blast hits to 121589 proteins in 4349 species: Archae - 90; Bacteria - 13409; Metazoa - 46270; Fungi - 12908; Plants - 29866; Viruses - 453; Other Eukaryotes - 20009 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT5G04400.1 | protein_coding | 5:1242500-1243358 | -16.0936 | 567 | 587 | 992 | 972 | NAC domain containing protein 77 NAC domain containing protein 77 (NAC077);FUNCTIONS IN: DNA binding; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_componentunknown; EXPRESSED IN: shoot, flower, leaf; EXPRESSED DURING: petal differentiation and expansion stage, LP.08 eight leaves visible;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC domain containing protein 52 (TAIR:AT3G10490.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT3G18362.1 | ncRNA | 3:6302112-6304457 | -16.0986 | 323 | 356 | 685 | 658 | other RNA unknown gene | ||
| XLOC_031128 | Ch5:11731993-11732743 | AT1G70950.1 | protein_coding | 1:26752597-26755407 | -16.1057 | 612 | 647 | 53 | 2 | TPX2 (targeting protein for Xklp2) protein familyTPX2 (targeting protein for Xklp2) protein family;CONTAINS InterPro DOMAIN/s: Xklp2 targeting protein (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G23060.1); Has 1245 Blast hits to 1139 proteins in 232 species: Archae - 0; Bacteria - 257; Metazoa - 305; Fungi - 75; Plants - 372; Viruses - 3; Other Eukaryotes - 233 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G04940.1 | protein_coding | 5:1454131-1457141 | -16.124 | 598 | 647 | 61 | 30 | SU(VAR)3-9 homolog 1 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SU(VAR)3-9 homolog 1 (SUVH1);CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214), SRA-YDG (InterPro:IPR003105), Pre-SET zinc-binding sub-group (InterPro:IPR003606), Post-SET domain (InterPro:IPR003616), Pre-SET domain (InterPro:IPR007728); SU(VAR)3-9 homolog 3 (TAIR:AT1G73100.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G14910.1 | protein_coding | 3:5015411-5017861 | -16.1312 | 612 | 669 | 1325 | 1283 | unknown protein; Has 158 Blast hits to 158 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT5G48010.2 | protein_coding | 5:19456837-19461706 | -16.1478 | 333 | 360 | 2373 | 2343 | thalianol synthase 1 Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid ofunknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. thalianol synthase 1 (THAS1);CONTAINS InterPro DOMAIN/s: Terpene synthase, conserved site (InterPro:IPR002365), Squalene cyclase (InterPro:IPR018333), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); baruol synthase 1 (TAIR:AT4G15370.1); Has 1966 Blast hits to 1917 proteins in 564 species: Archae - 4; Bacteria - 840; Metazoa - 80; Fungi - 239; Plants - 603; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT5G05530.1 | protein_coding | 5:1635478-1636278 | -16.1544 | 475 | 493 | 77 | 59 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); AtL5 (TAIR:AT3G62690.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_024098 | Ch4:16891225-16892077 | AT3G02970.1 | protein_coding | 3:668998-670567 | -16.173 | 342 | 365 | 425 | 399 | EXORDIUM like 6 EXORDIUM like 6 (EXL6);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 (InterPro:IPR006766); Phosphate-responsive 1 family protein (TAIR:AT1G35140.1); Has 398 Blast hits to 398 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT5G20940.1 | protein_coding | 5:7103927-7106834 | -16.1786 | 269 | 302 | 2077 | 2044 | Glycosyl hydrolase family proteinGlycosyl hydrolase family protein;FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); Glycosyl hydrolase family protein (TAIR:AT5G20950.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024073 | Ch4:3283968-3284755 | AT1G21100.1 | protein_coding | 1:7386762-7388512 | -16.1831 | 509 | 527 | 422 | 404 | O-methyltransferase family protein O-methyltransferase family protein;FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible;CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); O-methyltransferase family protein (TAIR:AT1G21130.1); Has 3375 Blast hits to 3370 proteins in 588 species: Archae - 3; Bacteria - 947; Metazoa - 107; Fungi - 659; Plants - 1542; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT4G18700.1 | protein_coding | 4:10288798-10291058 | -16.1866 | 209 | 234 | 1273 | 1248 | CBL-interacting protein kinase 12 Encodes CBL-interacting protein kinase 12 (CIPK12).CBL-interacting protein kinase 12 (CIPK12);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: signal transduction, protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), NAF domain (InterPro:IPR004041), CBL-interacting protein kinase (InterPro:IPR020660), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); CBL-interacting protein kinase 19 (TAIR:AT5G45810.1); Has 132740 Blast hits to 130588 proteins in 4556 species: Archae - 205; Bacteria - 15732; Metazoa - 48597; Fungi - 13262; Plants - 32355; Viruses - 523; Other Eukaryotes - 22066 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G13228.1 | protein_coding | 3:4266964-4268251 | -16.1928 | 744 | 781 | 1181 | 1146 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); Zinc finger, C3HC4 type (RING finger) family protein (TAIR:AT1G18760.1); Has 5838 Blast hits to 5825 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 1731; Fungi - 340; Plants - 2980; Viruses - 20; Other Eukaryotes - 767 (source: NCBI BLink). | ||
| XLOC_002219 | Ch1:17443179-17444203 | AT5G65360.1 | protein_coding | 5:26119859-26120581 | -16.1997 | 502 | 535 | 684 | 643 | Histone superfamily protein Histone superfamily protein;FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: chloroplast, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); Histone superfamily protein (TAIR:AT5G10400.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT1G77340.1 | protein_coding | 1:29068343-29070037 | -16.207 | 300 | 325 | 106 | 79 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G65560.1); Has 44266 Blast hits to 12730 proteins in 287 species: Archae - 5; Bacteria - 39; Metazoa - 433; Fungi - 553; Plants - 42031; Viruses - 0; Other Eukaryotes - 1205 (source: NCBI BLink). | ||
| XLOC_008209 | Ch1:7537079-7537644 | AT4G37210.1 | protein_coding | 4:17512254-17514723 | -16.2107 | 441 | 463 | 708 | 684 | Tetratricopeptide repeat (TPR)-like superfamily protein Tetratricopeptide repeat (TPR)-like superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT4G14160.1 | protein_coding | 4:8167351-8173417 | -16.2212 | 1341 | 1363 | 140 | 118 | Sec23/Sec24 protein transport family protein Sec23/Sec24 protein transport family protein;FUNCTIONS IN: transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sec23/Sec24, helical domain (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24, trunk domain (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin domain (InterPro:IPR007123); Sec23/Sec24 protein transport family protein (TAIR:AT3G23660.1); Has 1490 Blast hits to 1472 proteins in 242 species: Archae - 0; Bacteria - 0; Metazoa - 529; Fungi - 429; Plants - 324; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). | ||
| XLOC_008110 | Ch1:29804666-29809500 | AT4G28890.1 | protein_coding | 4:14256243-14257965 | -16.2334 | 37 | 68 | 35 | 8 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: root stele, root endodermis, hypocotyl, root, primary root differentiation zone;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G20030.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G39753.1 | protein_coding | 4:18440112-18441445 | -16.2365 | 266 | 304 | 395 | 357 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT4G39756.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT2G01800.1 | protein_coding | 2:343562-345254 | -16.2373 | 508 | 528 | 788 | 768 | COP1-interacting protein-related COP1-interacting protein-related; COP1-interacting protein-related (TAIR:AT4G00580.1); Has 777 Blast hits to 692 proteins in 155 species: Archae - 4; Bacteria - 61; Metazoa - 249; Fungi - 76; Plants - 111; Viruses - 5; Other Eukaryotes - 271 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT5G08000.1 | protein_coding | 5:2563366-2565547 | -16.2375 | 681 | 697 | 54 | 38 | glucan endo-1,3-beta-glucosidase-like protein 3 Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. "glucan endo-1,3-beta-glucosidase-like protein 3" (E13L3);FUNCTIONS IN: callose binding, polysaccharide binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasmodesma, anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); plasmodesmata callose-binding protein 1 (TAIR:AT5G61130.1); Has 1582 Blast hits to 1532 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 10; Fungi - 147; Plants - 1404; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT1G03200.1 | protein_coding | 1:780519-782946 | -16.2389 | 1097 | 1119 | 46 | 26 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_026123 | Ch5:17045372-17047152 | AT5G04390.1 | protein_coding | 5:1238820-1240517 | -16.2412 | 211 | 227 | 623 | 607 | C2H2-type zinc finger family protein C2H2-type zinc finger family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); C2H2-type zinc finger family protein (TAIR:AT3G10470.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT2G18193.1 | protein_coding | 2:7917413-7919345 | -16.242 | 223 | 265 | 1557 | 1508 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus;CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT2G18190.1); Has 23461 Blast hits to 21735 proteins in 2869 species: Archae - 1360; Bacteria - 7764; Metazoa - 3767; Fungi - 3122; Plants - 2740; Viruses - 37; Other Eukaryotes - 4671 (source: NCBI BLink). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT4G14390.1 | protein_coding | 4:8289610-8292203 | -16.2613 | 707 | 735 | 1467 | 1439 | Ankyrin repeat family protein Ankyrin repeat family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); ankyrin repeat family protein (TAIR:AT4G14400.1); Has 23458 Blast hits to 11336 proteins in 519 species: Archae - 46; Bacteria - 1569; Metazoa - 13305; Fungi - 1747; Plants - 2323; Viruses - 62; Other Eukaryotes - 4406 (source: NCBI BLink). | ||
| XLOC_008209 | Ch1:7537079-7537644 | AT5G45090.1 | protein_coding | 5:18202617-18205000 | -16.2691 | 449 | 466 | 53 | 36 | phloem protein 2-A7 phloem protein 2-A7 (PP2-A7);FUNCTIONS IN: carbohydrate binding; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, 4 leaf senescence stage;CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); phloem protein 2-A6 (TAIR:AT5G45080.1); Has 657 Blast hits to 638 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 657; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_024076 | Ch4:3950404-3951724 | AT1G69190.1 | protein_coding | 1:26013012-26015018 | -16.2703 | 250 | 283 | 192 | 165 | Dihydropterin pyrophosphokinase / Dihydropteroate synthase encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress.Dihydropterin pyrophosphokinase / Dihydropteroate synthase;CONTAINS InterPro DOMAIN/s: Dihydropteroate synthase-like (InterPro:IPR011005), 7,8-Dihydro-6-hydroxymethylpterin-pyrophosphokinase, HPPK (InterPro:IPR000550), Dihydropteroate synthase (InterPro:IPR006390), Pterin-binding (InterPro:IPR000489); Dihydropterin pyrophosphokinase / Dihydropteroate synthase (TAIR:AT4G30000.1); Has 15022 Blast hits to 14981 proteins in 2537 species: Archae - 158; Bacteria - 9759; Metazoa - 8; Fungi - 169; Plants - 69; Viruses - 0; Other Eukaryotes - 4859 (source: NCBI BLink). | ||
| XLOC_013209 | Ch2:5715100-5715636 | AT5G47530.1 | protein_coding | 5:19281374-19283061 | -16.2747 | 258 | 284 | 273 | 240 | Auxin-responsive family protein Auxin-responsive family protein;CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein ofunknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); Auxin-responsive family protein (TAIR:AT4G17280.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_012146 | Ch2:13049320-13052386 | AT1G55370.2 | protein_coding | 1:20673768-20676449 | -16.2769 | 1040 | 1058 | 858 | 840 | NDH-dependent cyclic electron flow 5 NDH-dependent cyclic electron flow 5 (NDF5);FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); NDH-dependent cyclic electron flow 1 (TAIR:AT1G64770.1); Has 166 Blast hits to 165 proteins in 21 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 158; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_016650 | Ch3:2189530-2192451 | AT1G70790.2 | protein_coding | 1:26699321-26702544 | -16.2788 | 173 | 202 | 626 | 591 | Calcium-dependent lipid-binding (CaLB domain) family protein Calcium-dependent lipid-binding (CaLB domain) family protein;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); Calcium-dependent lipid-binding (CaLB domain) family protein (TAIR:AT2G01540.1); Has 4172 Blast hits to 3576 proteins in 253 species: Archae - 0; Bacteria - 0; Metazoa - 2406; Fungi - 526; Plants - 879; Viruses - 0; Other Eukaryotes - 361 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT2G04039.3 | protein_coding | 2:1333133-1334566 | -16.283 | 1435 | 1460 | 288 | 259 | unknown protein;FUNCTIONS IN: molecular_functionunknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2996 (InterPro:IPR021374); Has 38 Blast hits to 38 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_003925 | Ch1:28787818-28789937 | AT5G25560.2 | protein_coding | 5:8897797-8901740 | -16.2836 | 362 | 388 | 132 | 101 | CHY-type/CTCHY-type/RING-type Zinc finger proteinCHY-type/CTCHY-type/RING-type Zinc finger protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CTCHY-type (InterPro:IPR017921), Zinc finger, CHY-type (InterPro:IPR008913), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); CHY-type/CTCHY-type/RING-type Zinc finger protein (TAIR:AT5G22920.1); Has 943 Blast hits to 942 proteins in 169 species: Archae - 2; Bacteria - 0; Metazoa - 357; Fungi - 128; Plants - 310; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT1G53540.1 | protein_coding | 1:19980299-19981199 | -16.2854 | 820 | 861 | 350 | 311 | HSP20-like chaperones superfamily proteinHSP20-like chaperones superfamily protein;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); heat shock protein 17.4 (TAIR:AT3G46230.1); Has 7090 Blast hits to 7089 proteins in 1610 species: Archae - 175; Bacteria - 4287; Metazoa - 66; Fungi - 302; Plants - 1606; Viruses - 0; Other Eukaryotes - 654 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT1G68550.1 | protein_coding | 1:25725455-25727701 | -16.2871 | 238 | 254 | 49 | 33 | Integrase-type DNA-binding superfamily protein encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The proteinCONTAINS one AP2 domain. There are 12 members in this subfamily including RAP2.11.Integrase-type DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: sperm cell;CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); Integrase-type DNA-binding superfamily protein (TAIR:AT3G25890.2); Has 4835 Blast hits to 4832 proteins in 228 species: Archae - 0; Bacteria - 2; Metazoa - 14; Fungi - 3; Plants - 4809; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT5G62310.1 | protein_coding | 5:25023155-25028686 | -16.2958 | 226 | 258 | 212 | 179 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein Encodes a protein with a serine/threonine kinase domain. There are two other closely related members in Arabidopsis. Knock-out mutation results in incomplete root hair elongation. Expression is found all organs examined but is especially strong in elongating root hairs. INCOMPLETE ROOT HAIR ELONGATION (IRE);CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G17850.1); Has 126848 Blast hits to 125224 proteins in 4803 species: Archae - 165; Bacteria - 15038; Metazoa - 47504; Fungi - 12892; Plants - 29759; Viruses - 507; Other Eukaryotes - 20983 (source: NCBI BLink). | ||
| XLOC_006844 | Ch1:21150376-21151505 | AT1G56040.1 | protein_coding | 1:20960356-20961870 | -16.2962 | 209 | 244 | 1002 | 974 | HEAT/U-box domain-containing protein HEAT/U-box domain-containing protein;FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: RNA metabolic process, protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: egg cell;CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-type fold (InterPro:IPR016024), MIF4G-like, type 3 (InterPro:IPR003890), MIF4-like, type 1/2/3 (InterPro:IPR016021); RING/U-box superfamily protein (TAIR:AT1G56030.1); Has 48380 Blast hits to 31280 proteins in 1863 species: Archae - 590; Bacteria - 5184; Metazoa - 24219; Fungi - 3107; Plants - 3498; Viruses - 126; Other Eukaryotes - 11656 (source: NCBI BLink). | ||
| XLOC_022789 | Ch4:10093250-10095083 | AT1G05790.1 | protein_coding | 1:1732802-1737583 | -16.297 | 1038 | 1083 | 51 | 3 | lipase class 3 family protein lipase class 3 family protein;FUNCTIONS IN: triglyceride lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); alpha/beta-Hydrolases superfamily protein (TAIR:AT2G42450.1); Has 496 Blast hits to 490 proteins in 107 species: Archae - 0; Bacteria - 1; Metazoa - 175; Fungi - 34; Plants - 194; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT1G02540.1 | protein_coding | 1:534827-535699 | -16.347 | 508 | 528 | 532 | 507 | unknown protein; Has 3327 Blast hits to 2216 proteins in 265 species: Archae - 18; Bacteria - 202; Metazoa - 802; Fungi - 283; Plants - 84; Viruses - 187; Other Eukaryotes - 1751 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT1G70180.2 | protein_coding | 1:26426269-26429409 | -16.3697 | 472 | 504 | 269 | 233 | Sterile alpha motif (SAM) domain-containing protein Sterile alpha motif (SAM) domain-containing protein;CONTAINS InterPro DOMAIN/s: Sterile alpha motif-type (InterPro:IPR013761), Sterile alpha motif (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993), Sterile alpha motif, type 1 (InterPro:IPR021129); Sterile alpha motif (SAM) domain-containing protein (TAIR:AT3G07170.1); Has 6486 Blast hits to 4294 proteins in 377 species: Archae - 0; Bacteria - 358; Metazoa - 2617; Fungi - 961; Plants - 670; Viruses - 147; Other Eukaryotes - 1733 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT1G34270.1 | protein_coding | 1:12492321-12494584 | -16.3807 | 636 | 661 | 147 | 115 | Exostosin family protein Exostosin family protein;FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); Exostosin family protein (TAIR:AT2G35100.1); Has 1266 Blast hits to 1263 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 4; Plants - 1015; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). | ||
| XLOC_008209 | Ch1:7537079-7537644 | AT5G37350.1 | protein_coding | 5:14792819-14796045 | -16.3916 | 435 | 461 | 1485 | 1462 | Serine/threonine-protein kinase Rio1 Serine/threonine-protein kinase Rio1;FUNCTIONS IN: protein serine/threonine kinase activity, catalytic activity, ATP binding;CONTAINS InterPro DOMAIN/s: RIO-like kinase (InterPro:IPR018934), Serine/threonine-protein kinase Rio1 (InterPro:IPR017407), RIO kinase (InterPro:IPR000687), RIO kinase, conserved site (InterPro:IPR018935), Protein kinase-like domain (InterPro:IPR011009); Serine/threonine-protein kinase Rio1 (TAIR:AT2G24990.1); Has 12159 Blast hits to 6760 proteins in 774 species: Archae - 403; Bacteria - 825; Metazoa - 4615; Fungi - 1188; Plants - 588; Viruses - 131; Other Eukaryotes - 4409 (source: NCBI BLink). | ||
| XLOC_004509 | Ch1:1996494-1998661 | AT5G05220.1 | protein_coding | 5:1550251-1551022 | -16.3931 | 302 | 350 | 269 | 224 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_018025 | Ch3:11860631-11861595 | AT2G05914.1 | lncRNA | 2:2263124-2264543 | -16.3967 | 623 | 653 | 296 | 264 | Potential natural antisense gene, locus overlaps with AT2G05915 | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT4G11830.2 | protein_coding | 4:7115681-7121919 | -16.4042 | 931 | 948 | 18 | 1 | phospholipase D gamma 2 Encodes one of three phospholipase D enzymes of the gamma class. phospholipase D gamma 2 (PLDGAMMA2);FUNCTIONS IN: phospholipase D activity; INVOLVED IN: phospholipid catabolic process; LOCATED IN: cytosolic ribosome, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), Phospholipase D (InterPro:IPR015679), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Phospholipase D, plant (InterPro:IPR011402), Phospholipase D/Transphosphatidylase (InterPro:IPR001736), C2 calcium-dependent membrane targeting (InterPro:IPR000008); phospholipase D gamma 3 (TAIR:AT4G11840.1); Has 2065 Blast hits to 1596 proteins in 399 species: Archae - 2; Bacteria - 528; Metazoa - 398; Fungi - 435; Plants - 545; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). | ||
| XLOC_013199 | Ch2:2384422-2385073 | AT5G18636.1 | protein_coding | 5:6211111-6212372 | -16.4055 | 24 | 54 | 362 | 334 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G25200.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G33880.1 | protein_coding | 2:14341355-14343796 | -16.4093 | 248 | 293 | 940 | 905 | homeobox-3 Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling.homeobox-3 (HB-3);CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057); WUSCHEL related homeobox 8 (TAIR:AT5G45980.1); Has 671 Blast hits to 615 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 22; Plants - 589; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). | ||
| XLOC_016650 | Ch3:2189530-2192451 | AT5G02060.1 | protein_coding | 5:404465-405947 | -16.4121 | 2315 | 2340 | 130 | 107 | Uncharacterised protein family (UPF0497) Uncharacterised protein family (UPF0497);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED DURING: seedling growth;CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702); Uncharacterised protein family (UPF0497) (TAIR:AT3G53850.1); Has 207 Blast hits to 207 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_013202 | Ch2:3641880-3642687 | AT1G05680.1 | protein_coding | 1:1703002-1704838 | -16.4147 | 327 | 354 | 245 | 205 | Uridine diphosphate glycosyltransferase 74E2 Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. Uridine diphosphate glycosyltransferase 74E2 (UGT74E2);CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT1G05675.1); Has 8397 Blast hits to 8309 proteins in 513 species: Archae - 0; Bacteria - 605; Metazoa - 2499; Fungi - 31; Plants - 5061; Viruses - 123; Other Eukaryotes - 78 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT3G16090.1 | protein_coding | 3:5456093-5459006 | -16.4187 | 391 | 423 | 1924 | 1896 | RING/U-box superfamily protein Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). RING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT1G65040.2); Has 7341 Blast hits to 7321 proteins in 267 species: Archae - 0; Bacteria - 4; Metazoa - 2254; Fungi - 727; Plants - 3286; Viruses - 21; Other Eukaryotes - 1049 (source: NCBI BLink). | ||
| XLOC_019387 | Ch3:11428472-11429170 | AT5G40680.1 | protein_coding | 5:16288754-16290001 | -16.4348 | 632 | 657 | 665 | 642 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT3G27150.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT5G09310.1 | protein_coding | 5:2886897-2888553 | -16.4456 | 1431 | 1457 | 515 | 489 | CONTAINS InterPro DOMAIN/s: Gamma-secretase aspartyl protease complex, presenilin enhancer-2 subunit (InterPro:IPR019379); Has 168 Blast hits to 168 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT5G15080.1 | protein_coding | 5:4886029-4888817 | -16.4483 | 586 | 613 | 769 | 742 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G01300.1); Has 114476 Blast hits to 113108 proteins in 3886 species: Archae - 103; Bacteria - 13473; Metazoa - 41986; Fungi - 9512; Plants - 32487; Viruses - 375; Other Eukaryotes - 16540 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G23270.1 | protein_coding | 3:8316218-8320487 | -16.4554 | 242 | 284 | 3060 | 3020 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation, RCC1 (InterPro:IPR000408), Disease resistance/zinc finger/chromosome condensation-like region (InterPro:IPR013591), Pleckstrin homology (InterPro:IPR001849), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Pleckstrin homology-type (InterPro:IPR011993), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Regulator of chromosome condensation (RCC1) family protein (TAIR:AT4G14368.1); Has 25157 Blast hits to 10467 proteins in 596 species: Archae - 58; Bacteria - 2385; Metazoa - 9739; Fungi - 1750; Plants - 3215; Viruses - 10; Other Eukaryotes - 8000 (source: NCBI BLink). | ||
| XLOC_013016 | Ch2:18460464-18461201 | AT1G32361.1 | protein_coding | 1:11675531-11676748 | -16.4602 | 303 | 326 | 52 | 15 | RING/U-box superfamily protein Putative RING-H2 finger protein ATL1F precursor. ATL1F;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G35420.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT5G48130.1 | protein_coding | 5:19516102-19518513 | -16.4617 | 638 | 668 | 1284 | 1251 | Phototropic-responsive NPH3 family protein Phototropic-responsive NPH3 family protein;FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); Phototropic-responsive NPH3 family protein (TAIR:AT4G31820.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT3G54210.1 | protein_coding | 3:20067540-20068614 | -16.4634 | 519 | 546 | 203 | 176 | Ribosomal protein L17 family protein Ribosomal protein L17 family protein;FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); Ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 8019 Blast hits to 8019 proteins in 2737 species: Archae - 0; Bacteria - 5501; Metazoa - 121; Fungi - 128; Plants - 120; Viruses - 0; Other Eukaryotes - 2149 (source: NCBI BLink). | ||
| XLOC_011691 | Ch2:9930659-9932381 | AT5G40810.1 | protein_coding | 5:16339863-16342927 | -16.4648 | 1379 | 1422 | 73 | 29 | Cytochrome C1 family Cytochrome C1 family;FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c1, transmembrane anchor, C-terminal (InterPro:IPR021157), Cytochrome c domain (InterPro:IPR009056); Cytochrome C1 family (TAIR:AT3G27240.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G22275.1 | protein_coding | 3:7878807-7879810 | -16.4666 | 728 | 766 | 512 | 481 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 22 Blast hits to 22 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G28350.1 | protein_coding | 5:10320114-10327374 | -16.471 | 643 | 675 | 68 | 38 | Quinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factorQuinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factor;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Ribosome control protein 1 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); Quinoprotein amine dehydrogenase, beta chain-like; RIC1-like guanyl-nucleotide exchange factor (TAIR:AT3G61480.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031138 | Ch5:12401239-12401866 | AT1G68210.1 | protein_coding | 1:25565983-25569302 | -16.4713 | 531 | 574 | 673 | 620 | pseudo-response regulator 6Similar to ARR response regulator proteins that function in two-component signal transduction but lacking a conserved D-D-K motif in the receiver domain pseudo-response regulator 6 (APRR6);FUNCTIONS IN: two-component response regulator activity, transcription regulator activity; INVOLVED IN: regulation of transcription, DNA-dependent, two-component signal transduction system (phosphorelay), regulation of transcription; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: CheY-like (InterPro:IPR011006), Homeodomain-like (InterPro:IPR009057), Signal transduction response regulator, receiver domain (InterPro:IPR001789), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); response regulator 2 (TAIR:AT4G16110.1); Has 1791 Blast hits to 1778 proteins in 154 species: Archae - 0; Bacteria - 186; Metazoa - 1; Fungi - 2; Plants - 1541; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT1G75210.1 | protein_coding | 1:28223836-28229082 | -16.4824 | 1435 | 1460 | 310 | 285 | HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase;FUNCTIONS IN: 5'-nucleotidase activity; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase (InterPro:IPR008380), Purine 5'-nucleotidase (InterPro:IPR016695); HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase (TAIR:AT5G48960.1); Has 679 Blast hits to 675 proteins in 116 species: Archae - 0; Bacteria - 48; Metazoa - 445; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G38920.1 | protein_coding | 2:16248146-16251017 | -16.4864 | 245 | 285 | 1156 | 1119 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-relatedSPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-related;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: male gametophyte, flower, pollen tube; EXPRESSED DURING: M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), SPX, N-terminal (InterPro:IPR004331); SPX (SYG1/Pho81/XPR1) domain-containing protein (TAIR:AT1G02860.1); Has 1650 Blast hits to 1628 proteins in 199 species: Archae - 0; Bacteria - 0; Metazoa - 1103; Fungi - 156; Plants - 232; Viruses - 1; Other Eukaryotes - 158 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G23610.2 | protein_coding | 5:7957249-7960446 | -16.4946 | 608 | 638 | 142 | 114 | INVOLVED IN: biological_processunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; SWITCH1 (TAIR:AT5G51330.1); Has 173 Blast hits to 168 proteins in 34 species: Archae - 3; Bacteria - 10; Metazoa - 6; Fungi - 2; Plants - 115; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT5G20810.2 | protein_coding | 5:7043758-7045830 | -16.4949 | 220 | 262 | 150 | 107 | SAUR-like auxin-responsive protein familySAUR-like auxin-responsive protein family ;FUNCTIONS IN: calmodulin binding; INVOLVED IN: response to auxin stimulus; LOCATED IN: peroxisome; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); SAUR-like auxin-responsive protein family (TAIR:AT3G43120.1); Has 1495 Blast hits to 1481 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1494; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G36800.1 | protein_coding | 2:15423172-15425129 | -16.4965 | 273 | 289 | 1409 | 1393 | don-glucosyltransferase 1 Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. don-glucosyltransferase 1 (DOGT1);CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-glucosyl transferase 73C6 (TAIR:AT2G36790.1); Has 7663 Blast hits to 7564 proteins in 401 species: Archae - 0; Bacteria - 196; Metazoa - 2172; Fungi - 32; Plants - 5134; Viruses - 64; Other Eukaryotes - 65 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT1G50820.1 | protein_coding | 1:18827706-18834861 | -16.4982 | 610 | 628 | 1068 | 1050 | Aminotransferase-like, plant mobile domain family proteinAminotransferase-like, plant mobile domain family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Aminotransferase-like, plant mobile domain (InterPro:IPR019557); Plant mobile domain protein family (TAIR:AT1G50790.1); Has 564 Blast hits to 557 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 564; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT3G50590.1 | protein_coding | 3:18770872-18779502 | -16.5206 | 750 | 773 | 3158 | 3137 | Transducin/WD40 repeat-like superfamily protein Transducin/WD40 repeat-like superfamily protein;FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); Has 1315 Blast hits to 1225 proteins in 269 species: Archae - 0; Bacteria - 270; Metazoa - 540; Fungi - 221; Plants - 139; Viruses - 13; Other Eukaryotes - 132 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT2G39510.1 | protein_coding | 2:16491143-16493343 | -16.5303 | 353 | 386 | 584 | 550 | nodulin MtN21 /EamA-like transporter family proteinnodulin MtN21-like transporter family protein nodulin MtN21 /EamA-like transporter family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF6, transmembrane (InterPro:IPR000620); nodulin MtN21 /EamA-like transporter family protein (TAIR:AT2G37460.1); Has 4772 Blast hits to 4753 proteins in 819 species: Archae - 36; Bacteria - 2386; Metazoa - 4; Fungi - 0; Plants - 1228; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G26470.1 | protein_coding | 4:13370951-13372460 | -16.5549 | 270 | 290 | 823 | 804 | Calcium-binding EF-hand family proteinCalcium-binding EF-hand family protein;FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytoplasm; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand-like domain (InterPro:IPR011992); Calcium-binding EF-hand family protein (TAIR:AT3G24110.1); Has 9300 Blast hits to 7546 proteins in 1004 species: Archae - 0; Bacteria - 25; Metazoa - 3748; Fungi - 1101; Plants - 3090; Viruses - 0; Other Eukaryotes - 1336 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT5G56750.1 | protein_coding | 5:22957629-22960916 | -16.5556 | 541 | 569 | 29 | 0 | N-MYC downregulated-like 1 N-MYC downregulated-like 1 (NDL1);CONTAINS InterPro DOMAIN/s: Pollen specific protein SF21 (InterPro:IPR015511), Ndr (InterPro:IPR004142); N-MYC downregulated-like 3 (TAIR:AT2G19620.1); Has 776 Blast hits to 775 proteins in 111 species: Archae - 2; Bacteria - 48; Metazoa - 563; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). | ||
| XLOC_008425 | Ch2:1391923-1393064 | AT2G22660.2 | protein_coding | 2:9627342-9631283 | -16.5603 | 249 | 286 | 2465 | 2428 | Protein ofunknown function (duplicated DUF1399) Protein ofunknown function (duplicated DUF1399);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1399 (InterPro:IPR009836); Protein ofunknown function (duplicated DUF1399) (TAIR:AT4G37900.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G24180.1 | protein_coding | 2:10281718-10283735 | -16.5642 | 602 | 656 | 150 | 111 | cytochrome p450 71b6 cytochrome P450 monooxygenase cytochrome p450 71b6 (CYP71B6);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: mitochondrion, endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 71, subfamily B, polypeptide 37 (TAIR:AT3G26330.1); Has 32387 Blast hits to 32166 proteins in 1619 species: Archae - 48; Bacteria - 2986; Metazoa - 11709; Fungi - 7043; Plants - 9512; Viruses - 3; Other Eukaryotes - 1086 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT1G54350.1 | protein_coding | 1:20286856-20290401 | -16.5718 | 1435 | 1459 | 733 | 703 | ABC transporter family proteinABC transporter family protein;FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter, N-terminal (InterPro:IPR010509), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, conserved site (InterPro:IPR017871); peroxisomal ABC transporter 1 (TAIR:AT4G39850.3); Has 196809 Blast hits to 191927 proteins in 3574 species: Archae - 3050; Bacteria - 158969; Metazoa - 4367; Fungi - 3288; Plants - 2549; Viruses - 3; Other Eukaryotes - 24583 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT3G09300.1 | protein_coding | 3:2857847-2860668 | -16.5747 | 1427 | 1462 | 176 | 142 | OSBP(oxysterol binding protein)-related protein 3B OSBP(oxysterol binding protein)-related protein 3B (ORP3B);FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); Oxysterol-binding family protein (TAIR:AT5G02100.1); Has 2352 Blast hits to 2318 proteins in 216 species: Archae - 0; Bacteria - 0; Metazoa - 1124; Fungi - 669; Plants - 282; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). | ||
| XLOC_019399 | Ch3:13634011-13635110 | AT2G40370.1 | protein_coding | 2:16857959-16860779 | -16.5929 | 263 | 287 | 1269 | 1244 | laccase 5 putative laccase, a member of laccase family of genes (17 members in Arabidopsis). laccase 5 (LAC5);FUNCTIONS IN: laccase activity; INVOLVED IN: response to copper ion; LOCATED IN: endomembrane system, apoplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Laccase (InterPro:IPR017761), Multicopper oxidase, type 2 (InterPro:IPR011706), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, copper-binding site (InterPro:IPR002355), Multicopper oxidase, type 1 (InterPro:IPR001117); laccase 12 (TAIR:AT5G05390.1); Has 10120 Blast hits to 8186 proteins in 1337 species: Archae - 37; Bacteria - 4008; Metazoa - 431; Fungi - 3685; Plants - 1575; Viruses - 0; Other Eukaryotes - 384 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT2G33740.2 | protein_coding | 2:14269461-14271723 | -16.5976 | 1096 | 1116 | 123 | 97 | Nitrogen regulatory PII-like, alpha/betaEncodes a copper binding protein that forms tetramers in vitro. Gene is expressed in all tissues examined and protein is localized to the chloroplast. CUTA;FUNCTIONS IN: copper ion binding; INVOLVED IN: response to metal ion; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Divalent ion tolerance protein, CutA1 (InterPro:IPR004323), Nitrogen regulatory PII-like, alpha/beta (InterPro:IPR011322); Has 2474 Blast hits to 2474 proteins in 915 species: Archae - 144; Bacteria - 1534; Metazoa - 199; Fungi - 5; Plants - 49; Viruses - 0; Other Eukaryotes - 543 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT1G30670.1 | protein_coding | 1:10879173-10880188 | -16.6196 | 681 | 732 | 261 | 197 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G34820.1); Has 1015 Blast hits to 1013 proteins in 53 species: Archae - 0; Bacteria - 8; Metazoa - 1; Fungi - 4; Plants - 1002; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT5G61560.1 | protein_coding | 5:24752783-24756768 | -16.6233 | 1824 | 1890 | 1378 | 1305 | U-box domain-containing protein kinase family protein U-box domain-containing protein kinase family protein;FUNCTIONS IN: ubiquitin-protein ligase activity, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, protein ubiquitination, response to stress; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Protein kinase, ATP binding site (InterPro:IPR017441), U box domain (InterPro:IPR003613), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); U-box domain-containing protein kinase family protein (TAIR:AT4G25160.1); Has 112471 Blast hits to 110615 proteins in 4538 species: Archae - 130; Bacteria - 13122; Metazoa - 41054; Fungi - 8748; Plants - 32669; Viruses - 288; Other Eukaryotes - 16460 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT4G02070.1 | protein_coding | 4:905865-913290 | -16.6365 | 631 | 671 | 127 | 81 | MUTS homolog 6 encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. MUTS homolog 6 (MSH6);FUNCTIONS IN: damaged DNA binding; INVOLVED IN: mismatch repair; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: DNA mismatch repair protein Msh6 (InterPro:IPR017261), DNA mismatch repair protein MutS, clamp (InterPro:IPR007861), DNA mismatch repair protein MutS, connector (InterPro:IPR007860), DNA mismatch repair protein MutS, core (InterPro:IPR007696), DNA mismatch repair protein MutS-like, N-terminal (InterPro:IPR007695), DNA mismatch repair protein MutS, N-terminal (InterPro:IPR016151), DNA mismatch repair protein MutS, C-terminal (InterPro:IPR000432), DNA mismatch repair protein MutS-homologue MSH6 (InterPro:IPR015536), Tudor domain (InterPro:IPR002999); homolog of DNA mismatch repair protein MSH3 (TAIR:AT4G25540.1); Has 29702 Blast hits to 21889 proteins in 2967 species: Archae - 234; Bacteria - 11721; Metazoa - 3243; Fungi - 2118; Plants - 3658; Viruses - 802; Other Eukaryotes - 7926 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT4G38890.1 | protein_coding | 4:18135796-18139266 | -16.648 | 819 | 837 | 32 | 14 | FMN-linked oxidoreductases superfamily proteinFMN-linked oxidoreductases superfamily protein;FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity, zinc ion binding, nucleic acid binding; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); Aldolase-type TIM barrel family protein (TAIR:AT3G49640.1); Has 11364 Blast hits to 11268 proteins in 2588 species: Archae - 15; Bacteria - 7817; Metazoa - 496; Fungi - 531; Plants - 173; Viruses - 0; Other Eukaryotes - 2332 (source: NCBI BLink). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT4G25800.1 | protein_coding | 4:13124898-13128045 | -16.6482 | 1044 | 1065 | 503 | 477 | Calmodulin-binding protein Calmodulin-binding protein;CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); Calmodulin-binding protein (TAIR:AT5G57580.1); Has 340 Blast hits to 325 proteins in 25 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 333; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT5G50170.1 | protein_coding | 5:20420951-20425604 | -16.6666 | 1435 | 1459 | 66 | 41 | C2 calcium/lipid-binding and GRAM domain containing protein C2 calcium/lipid-binding and GRAM domain containing protein;CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); C2 calcium/lipid-binding and GRAM domain containing protein (TAIR:AT1G03370.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT4G08510.1 | protein_coding | 4:5410253-5413453 | -16.6773 | 719 | 754 | 192 | 146 | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G36990.1); Has 888 Blast hits to 321 proteins in 121 species: Archae - 0; Bacteria - 120; Metazoa - 86; Fungi - 24; Plants - 79; Viruses - 0; Other Eukaryotes - 579 (source: NCBI BLink). | ||
| XLOC_001726 | Ch1:10966845-10968845 | AT1G26630.1 | protein_coding | 1:9205800-9207417 | -16.6811 | 978 | 1011 | 115 | 81 | Eukaryotic translation initiation factor 5A-1 (eIF-5A 1) protein Eukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. FUMONISIN B1-RESISTANT12 (FBR12);FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: in 7 processes; LOCATED IN: nucleus; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, IF5A, hypusine site (InterPro:IPR019769), Translation protein SH3-like, subgroup (InterPro:IPR014722), Translation elongation factor, IF5A (InterPro:IPR001884), Translation elongation factor, IF5A C-terminal (InterPro:IPR020189), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), KOW (InterPro:IPR005824); eukaryotic elongation factor 5A-3 (TAIR:AT1G69410.1); Has 1331 Blast hits to 1330 proteins in 409 species: Archae - 256; Bacteria - 0; Metazoa - 365; Fungi - 242; Plants - 261; Viruses - 0; Other Eukaryotes - 207 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT2G01050.1 | protein_coding | 2:68337-69884 | -16.6881 | 288 | 353 | 1402 | 1350 | zinc ion binding;nucleic acid binding zinc ion binding;nucleic acid binding;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G31430.1); Has 369 Blast hits to 365 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 367; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_018021 | Ch3:11751847-11757079 | AT2G34880.1 | protein_coding | 2:14711880-14716634 | -16.7062 | 2015 | 2037 | 1419 | 1397 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family proteinA maternally expressed imprinted gene. maternal effect embryo arrest 27 (MEE27);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: embryo development ending in seed dormancy, regulation of transcription, pollen development; LOCATED IN: nucleus; EXPRESSED IN: sperm cell;CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein (TAIR:AT1G30810.2); Has 2070 Blast hits to 1543 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 1091; Fungi - 459; Plants - 363; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G21370.1 | protein_coding | 3:7524054-7527677 | -16.723 | 247 | 284 | 465 | 432 | beta glucosidase 19 beta glucosidase 19 (BGLU19);FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: seed;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); beta glucosidase 18 (TAIR:AT1G52400.3); Has 11327 Blast hits to 10978 proteins in 1474 species: Archae - 140; Bacteria - 7823; Metazoa - 717; Fungi - 202; Plants - 1443; Viruses - 0; Other Eukaryotes - 1002 (source: NCBI BLink). | ||
| XLOC_013209 | Ch2:5715100-5715636 | AT5G24410.1 | protein_coding | 5:8332420-8334129 | -16.7303 | 175 | 204 | 44 | 5 | 6-phosphogluconolactonase 4 6-phosphogluconolactonase 4 (PGL4);FUNCTIONS IN: 6-phosphogluconolactonase activity; INVOLVED IN: pentose-phosphate shunt, pentose-phosphate shunt, oxidative branch, carbohydrate metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: 6-phosphogluconolactonase, DevB-type (InterPro:IPR005900); 6-phosphogluconolactonase 2 (TAIR:AT3G49360.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT1G29020.1 | protein_coding | 1:10120300-10122973 | -16.7308 | 1029 | 1056 | 1047 | 1017 | Calcium-binding EF-hand family proteinCalcium-binding EF-hand family protein;FUNCTIONS IN: calcium ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: root, callus;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); Calcium-binding EF-hand family protein (TAIR:AT1G29025.1); Has 483 Blast hits to 315 proteins in 72 species: Archae - 8; Bacteria - 1; Metazoa - 61; Fungi - 5; Plants - 330; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT1G79250.1 | protein_coding | 1:29810134-29812683 | -16.734 | 919 | 937 | 1595 | 1577 | AGC kinase 1.7AGC kinase 1.7 (AGC1.7);CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); root hair specific 3 (TAIR:AT1G16440.1); Has 116038 Blast hits to 88213 proteins in 3437 species: Archae - 33; Bacteria - 13615; Metazoa - 46306; Fungi - 13131; Plants - 20164; Viruses - 405; Other Eukaryotes - 22384 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT1G59550.1 | protein_coding | 1:21879649-21880788 | -16.7605 | 589 | 631 | 237 | 198 | UBX domain-containing protein This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. UBX domain-containing protein;CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); structural constituent of ribosome (TAIR:AT4G14250.1); Has 281 Blast hits to 255 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 86; Fungi - 69; Plants - 102; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT1G65550.1 | protein_coding | 1:24367694-24370800 | -16.7634 | 526 | 562 | 682 | 650 | Xanthine/uracil permease family protein Xanthine/uracil permease family protein;FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: membrane;CONTAINS InterPro DOMAIN/s: Xanthine/uracil/vitamin C permease (InterPro:IPR006043); Xanthine/uracil/vitamin C permease (TAIR:AT5G25420.1); Has 8520 Blast hits to 8482 proteins in 1844 species: Archae - 65; Bacteria - 6911; Metazoa - 346; Fungi - 119; Plants - 452; Viruses - 1; Other Eukaryotes - 626 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT5G62310.1 | protein_coding | 5:25023155-25028686 | -16.7689 | 500 | 528 | 3384 | 3362 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein Encodes a protein with a serine/threonine kinase domain. There are two other closely related members in Arabidopsis. Knock-out mutation results in incomplete root hair elongation. Expression is found all organs examined but is especially strong in elongating root hairs. INCOMPLETE ROOT HAIR ELONGATION (IRE);CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT3G17850.1); Has 126848 Blast hits to 125224 proteins in 4803 species: Archae - 165; Bacteria - 15038; Metazoa - 47504; Fungi - 12892; Plants - 29759; Viruses - 507; Other Eukaryotes - 20983 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT2G45590.1 | protein_coding | 2:18785990-18789113 | -16.7794 | 541 | 573 | 1449 | 1417 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G25390.1); Has 91863 Blast hits to 73683 proteins in 3539 species: Archae - 59; Bacteria - 6920; Metazoa - 25471; Fungi - 5140; Plants - 45446; Viruses - 121; Other Eukaryotes - 8706 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT5G10625.1 | protein_coding | 5:3358787-3359817 | -16.8131 | 114 | 154 | 432 | 396 | flowering promoting factor 1 (TAIR:AT5G24860.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_026123 | Ch5:17045372-17047152 | AT4G23410.1 | protein_coding | 4:12223953-12225508 | -16.8227 | 212 | 237 | 611 | 584 | tetraspanin5 Member of TETRASPANIN family tetraspanin5 (TET5); INVOLVED IN: aging; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); tetraspanin6 (TAIR:AT3G12090.1); Has 435 Blast hits to 433 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 36; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT2G33730.1 | protein_coding | 2:14265281-14268003 | -16.8236 | 66 | 88 | 559 | 536 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT1G28180.1); Has 125674 Blast hits to 72393 proteins in 3317 species: Archae - 1039; Bacteria - 55089; Metazoa - 31149; Fungi - 11223; Plants - 5926; Viruses - 327; Other Eukaryotes - 20921 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT1G26520.1 | protein_coding | 1:9163211-9165900 | -16.8297 | 234 | 266 | 341 | 314 | Cobalamin biosynthesis CobW-like protein Cobalamin biosynthesis CobW-like protein;CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); Cobalamin biosynthesis CobW-like protein (TAIR:AT1G15730.1); Has 8517 Blast hits to 8427 proteins in 1716 species: Archae - 88; Bacteria - 6047; Metazoa - 151; Fungi - 280; Plants - 232; Viruses - 0; Other Eukaryotes - 1719 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G11570.1 | protein_coding | 2:4634251-4635203 | -16.8339 | 275 | 334 | 917 | 860 | unknown protein; Has 33 Blast hits to 31 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 11; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G28790.1 | protein_coding | 3:10813224-10815699 | -16.8359 | 279 | 306 | 1093 | 1068 | Protein ofunknown function (DUF1216) Protein ofunknown function (DUF1216);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1216 (InterPro:IPR009605); Protein ofunknown function (DUF1216) (TAIR:AT3G28830.1); Has 177545 Blast hits to 90545 proteins in 3397 species: Archae - 691; Bacteria - 36593; Metazoa - 57458; Fungi - 33385; Plants - 8167; Viruses - 3173; Other Eukaryotes - 38078 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT5G58920.1 | protein_coding | 5:23793129-23794245 | -16.8502 | 69 | 95 | 524 | 499 | unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031128 | Ch5:11731993-11732743 | AT2G34020.1 | protein_coding | 2:14371075-14373901 | -16.8522 | 620 | 653 | 224 | 180 | Calcium-binding EF-hand family proteinCalcium-binding EF-hand family protein;FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); Calcium-binding EF-hand family protein (TAIR:AT2G34030.1); Has 248 Blast hits to 226 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 23; Fungi - 2; Plants - 158; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). | ||
| XLOC_013016 | Ch2:18460464-18461201 | AT2G31850.1 | protein_coding | 2:13540199-13540540 | -16.8773 | 292 | 329 | 242 | 209 | unknown protein; Has 18 Blast hits to 18 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 7; Fungi - 4; Plants - 3; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT4G22980.1 | protein_coding | 4:12043869-12045840 | -16.8803 | 459 | 483 | 1669 | 1645 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; Pyridoxal phosphate (PLP)-dependent transferases superfamily protein (TAIR:AT5G51920.1); Has 520 Blast hits to 468 proteins in 130 species: Archae - 5; Bacteria - 23; Metazoa - 99; Fungi - 131; Plants - 231; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT4G11380.2 | protein_coding | 4:6919817-6925969 | -16.8893 | 616 | 647 | 36 | 1 | Adaptin family proteinAdaptin family protein;FUNCTIONS IN: protein transporter activity, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); Adaptin family protein (TAIR:AT4G23460.1). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G25760.2 | protein_coding | 2:10984304-10989117 | -16.898 | 390 | 407 | 456 | 439 | Protein kinase family protein Protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009); Protein kinase family protein (TAIR:AT3G13670.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT1G73603.1 | protein_coding | 1:27674288-27674976 | -16.9105 | 312 | 351 | 72 | 32 | low-molecular-weight cysteine-rich 64Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. low-molecular-weight cysteine-rich 64 (LCR64); LOCATED IN: endomembrane system; low-molecular-weight cysteine-rich 65 (TAIR:AT1G73607.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT1G13607.1 | protein_coding | 1:4660778-4661331 | -16.9132 | 631 | 683 | 286 | 249 | Defensin-like (DEFL) family proteinEncodes a defensin-like (DEFL) family protein. Defensin-like (DEFL) family protein; LOCATED IN: endomembrane system; Defensin-like (DEFL) family protein (TAIR:AT1G13609.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_019727 | Ch4:2593945-2594534 | AT5G43880.1 | protein_coding | 5:17639776-17643982 | -16.9267 | 240 | 273 | 854 | 812 | Protein ofunknown function (DUF3741) Protein ofunknown function (DUF3741);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3741 (InterPro:IPR022212); Protein ofunknown function (DUF3741) (TAIR:AT4G28760.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT2G36670.1 | protein_coding | 2:15364776-15368169 | -16.9348 | 1097 | 1117 | 27 | 5 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Twin-arginine translocation pathway, signal sequence (InterPro:IPR006311); Eukaryotic aspartyl protease family protein (TAIR:AT5G22850.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_024070 | Ch4:3092474-3093625 | AT1G62610.4 | protein_coding | 1:23181463-23183227 | -16.9363 | 150 | 191 | 810 | 765 | NAD(P)-binding Rossmann-fold superfamily protein NAD(P)-binding Rossmann-fold superfamily protein;FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), NAD(P)-binding domain (InterPro:IPR016040), Polyketide synthase/Fatty acid synthase, KR (InterPro:IPR020842), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT1G63380.1). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT3G16270.1 | protein_coding | 3:5513267-5517606 | -16.9564 | 740 | 774 | 2574 | 2541 | ENTH/VHS family protein ENTH/VHS family protein; INVOLVED IN: intracellular protein transport; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Epsin, N-terminal (InterPro:IPR001026), ENTH/VHS (InterPro:IPR008942); Has 168 Blast hits to 159 proteins in 72 species: Archae - 0; Bacteria - 9; Metazoa - 51; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT2G41170.1 | protein_coding | 2:17159074-17161294 | -16.9658 | 412 | 436 | 434 | 414 | F-box family protein F-box family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); F-box family protein (TAIR:AT2G26850.1); Has 87 Blast hits to 86 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_013209 | Ch2:5715100-5715636 | AT5G11660.1 | protein_coding | 5:3748880-3750317 | -16.9712 | 250 | 269 | 499 | 480 | Protein ofunknown Function (DUF239) Protein ofunknown Function (DUF239);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF239, plant (InterPro:IPR004314); Protein ofunknown Function (DUF239) (TAIR:AT5G05030.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G24700.1 | protein_coding | 2:10512884-10515411 | -17.0013 | 552 | 628 | 1719 | 1659 | Transcriptional factor B3 family protein Transcriptional factor B3 family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); Transcriptional factor B3 family protein (TAIR:AT4G00260.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_013202 | Ch2:3641880-3642687 | AT1G66950.1 | protein_coding | 1:24978121-24984619 | -17.0145 | 209 | 254 | 4129 | 4096 | pleiotropic drug resistance 11 Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat. pleiotropic drug resistance 11 (PDR11);FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: drug transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525); pleiotropic drug resistance 6 (TAIR:AT2G36380.1); Has 357151 Blast hits to 273757 proteins in 3981 species: Archae - 7090; Bacteria - 287486; Metazoa - 9208; Fungi - 6204; Plants - 5777; Viruses - 4; Other Eukaryotes - 41382 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G66656.1 | protein_coding | 3:2091262-2091798 | -17.0253 | 236 | 253 | 238 | 221 | AGAMOUS-like 91 AGAMOUS-like 91 (AGL91);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: endosperm;CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100); AGAMOUS-like 29 (TAIR:AT2G34440.1); Has 5776 Blast hits to 5776 proteins in 666 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 305; Plants - 4780; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). | ||
| XLOC_013016 | Ch2:18460464-18461201 | AT3G05390.1 | protein_coding | 3:1546443-1548679 | -17.0262 | 303 | 328 | 266 | 237 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF248, methyltransferase putative (InterPro:IPR004159); S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT4G01240.1); Has 507 Blast hits to 498 proteins in 33 species: Archae - 4; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 493; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_011023 | Ch2:2893864-2896523 | AT4G34480.1 | protein_coding | 4:16480887-16484231 | -17.0388 | 182 | 199 | 794 | 777 | O-Glycosyl hydrolases family 17 protein O-Glycosyl hydrolases family 17 protein;FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); O-Glycosyl hydrolases family 17 protein (TAIR:AT2G16230.1); Has 576 Blast hits to 566 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 570; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_001726 | Ch1:10966845-10968845 | AT4G29890.1 | protein_coding | 4:14608833-14610998 | -17.0405 | 1858 | 1888 | 1176 | 1146 | choline monooxygenase, putative (CMO-like) choline monooxygenase, putative (CMO-like);FUNCTIONS IN: electron carrier activity, oxidoreductase activity, iron ion binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction, cellular aromatic compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Aromatic-ring-hydroxylating dioxygenase, alpha subunit (InterPro:IPR001663); Has 7402 Blast hits to 7400 proteins in 1015 species: Archae - 31; Bacteria - 4374; Metazoa - 10; Fungi - 153; Plants - 102; Viruses - 0; Other Eukaryotes - 2732 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G25710.1 | protein_coding | 4:13098102-13099625 | -17.0748 | 268 | 290 | 65 | 44 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT5G51250.1); Has 986 Blast hits to 967 proteins in 50 species: Archae - 4; Bacteria - 5; Metazoa - 105; Fungi - 0; Plants - 870; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G44530.1 | protein_coding | 3:16115498-16121534 | -17.0826 | 600 | 644 | 2549 | 2518 | homolog of histone chaperone HIRA Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2.homolog of histone chaperone HIRA (HIRA);CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), TUP1-like enhancer of split (InterPro:IPR011494), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Transducin/WD40 repeat-like superfamily protein (TAIR:AT5G64630.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_004509 | Ch1:1996494-1998661 | AT5G39380.1 | protein_coding | 5:15758717-15761747 | -17.0857 | 213 | 246 | 1368 | 1333 | Plant calmodulin-binding protein-related Plant calmodulin-binding protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: plasma membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Calmodulin-binding protein, plant (InterPro:IPR012417); Plant calmodulin-binding protein-related (TAIR:AT5G15430.1); Has 1562 Blast hits to 1366 proteins in 187 species: Archae - 0; Bacteria - 45; Metazoa - 751; Fungi - 101; Plants - 192; Viruses - 10; Other Eukaryotes - 463 (source: NCBI BLink). | ||
| XLOC_003925 | Ch1:28787818-28789937 | AT5G37710.1 | protein_coding | 5:14978566-14981620 | -17.0922 | 128 | 159 | 1088 | 1061 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: triglyceride lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono-/di-acylglycerol lipase, N-terminal (InterPro:IPR005592); alpha/beta-Hydrolases superfamily protein (TAIR:AT3G49050.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT1G17370.1 | protein_coding | 1:5951542-5955143 | -17.0939 | 930 | 960 | 1693 | 1666 | oligouridylate binding protein 1B Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA.oligouridylate binding protein 1B (UBP1B);FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT3G14100.1); Has 681 Blast hits to 681 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 681; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G07650.1 | protein_coding | 3:2441565-2444532 | -17.0983 | 223 | 268 | 77 | 37 | CONSTANS-like 9 This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.CONSTANS-like 9 (COL9);CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); B-box type zinc finger protein with CCT domain (TAIR:AT5G48250.1); Has 3101 Blast hits to 2272 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 3022; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G43070.1 | protein_coding | 2:17910523-17915009 | -17.1058 | 643 | 674 | 71 | 41 | SIGNAL PEPTIDE PEPTIDASE-LIKE 3 SIGNAL PEPTIDE PEPTIDASE-LIKE 3 (SPPL3);FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures;CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); SIGNAL PEPTIDE PEPTIDASE-LIKE 5 (TAIR:AT1G05820.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT3G17940.1 | protein_coding | 3:6143414-6145374 | -17.113 | 387 | 417 | 981 | 954 | Galactose mutarotase-like superfamily protein Galactose mutarotase-like superfamily protein;FUNCTIONS IN: isomerase activity, carbohydrate binding, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, hexose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Aldose 1-epimerase, subgroup (InterPro:IPR015443), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); Galactose mutarotase-like superfamily protein (TAIR:AT3G47800.1); Has 4707 Blast hits to 4700 proteins in 1470 species: Archae - 28; Bacteria - 3220; Metazoa - 276; Fungi - 257; Plants - 219; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT3G28550.1 | protein_coding | 3:10700562-10704018 | -17.1273 | 450 | 493 | 3042 | 3008 | Proline-rich extensin-like family proteinProline-rich extensin-like family protein;FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Extensin-like repeat (InterPro:IPR006706); Proline-rich extensin-like family protein (TAIR:AT3G54580.1); Has 433536 Blast hits to 44790 proteins in 1795 species: Archae - 956; Bacteria - 66952; Metazoa - 162710; Fungi - 67978; Plants - 67619; Viruses - 11578; Other Eukaryotes - 55743 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G42670.2 | protein_coding | 2:17771697-17774647 | -17.1304 | 125 | 162 | 268 | 235 | Protein ofunknown function (DUF1637) Protein ofunknown function (DUF1637);FUNCTIONS IN: cysteamine dioxygenase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1637 (InterPro:IPR012864); Protein ofunknown function (DUF1637) (TAIR:AT3G58670.3); Has 366 Blast hits to 366 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G79350.1 | protein_coding | 1:29844621-29853466 | -17.1495 | 267 | 290 | 779 | 756 | RING/FYVE/PHD zinc finger superfamily protein embryo defective 1135 (EMB1135);FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent, embryo development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Zinc finger, PHD-finger (InterPro:IPR019787); Has 4247 Blast hits to 3784 proteins in 326 species: Archae - 2; Bacteria - 520; Metazoa - 2572; Fungi - 347; Plants - 469; Viruses - 36; Other Eukaryotes - 301 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G43432.1 | protein_coding | 3:15359783-15360090 | -17.1511 | 233 | 274 | 234 | 194 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT1G27340.1 | protein_coding | 1:9495344-9498085 | -17.1531 | 237 | 254 | 25 | 8 | Galactose oxidase/kelch repeat superfamily protein Encodes a putative F-box protein that is involved in the regulation of leaf morphology. Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT5G15710.1); Has 1110 Blast hits to 1104 proteins in 52 species: Archae - 0; Bacteria - 1; Metazoa - 2; Fungi - 0; Plants - 1106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT1G51190.1 | protein_coding | 1:18977176-18980618 | -17.1556 | 499 | 533 | 1518 | 1465 | Integrase-type DNA-binding superfamily protein Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. PLETHORA 2 (PLT2);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); Integrase-type DNA-binding superfamily protein (TAIR:AT3G20840.1); Has 7787 Blast hits to 5250 proteins in 253 species: Archae - 0; Bacteria - 8; Metazoa - 4; Fungi - 0; Plants - 7694; Viruses - 2; Other Eukaryotes - 79 (source: NCBI BLink). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT1G68830.1 | protein_coding | 1:25872412-25875662 | -17.1629 | 1105 | 1142 | 612 | 556 | STT7 homolog STN7 STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation STT7 homolog STN7 (STN7);FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of photosynthesis, light reaction, circadian rhythm; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); cyclin-dependent kinase B1;2 (TAIR:AT2G38620.2); Has 29571 Blast hits to 29413 proteins in 1565 species: Archae - 57; Bacteria - 3753; Metazoa - 11524; Fungi - 3757; Plants - 4496; Viruses - 50; Other Eukaryotes - 5934 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT2G07775.1 | protein_coding | 2:3483035-3484062 | -17.1705 | 634 | 658 | 351 | 327 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT3G26940.1 | protein_coding | 3:9936582-9939305 | -17.1954 | 215 | 255 | 436 | 399 | Protein kinase superfamily protein Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation.CONSTITUTIVE DIFFERENTIAL GROWTH 1 (CDG1);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: growth; EXPRESSED IN: flower; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT5G13160.1); Has 115206 Blast hits to 113810 proteins in 4116 species: Archae - 109; Bacteria - 12984; Metazoa - 42968; Fungi - 9463; Plants - 32819; Viruses - 350; Other Eukaryotes - 16513 (source: NCBI BLink). | ||
| XLOC_016650 | Ch3:2189530-2192451 | AT1G53490.1 | protein_coding | 1:19963267-19966952 | -17.2003 | 1258 | 1302 | 2115 | 2082 | RING/U-box superfamily protein Encodes HEI10, a RING finger-containing protein. HEI10 belongs to a group of proteins well conserved among species known as ZMM. Required for class I crossover formation. RING/U-box superfamily protein; Has 175 Blast hits to 173 proteins in 83 species: Archae - 2; Bacteria - 14; Metazoa - 69; Fungi - 24; Plants - 38; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT3G47530.1 | protein_coding | 3:17517303-17519305 | -17.2167 | 1091 | 1119 | 184 | 152 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21065.1); Has 30892 Blast hits to 13336 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 60; Plants - 30406; Viruses - 0; Other Eukaryotes - 376 (source: NCBI BLink). | ||
| XLOC_008228 | Ch1:16867970-16868420 | AT3G25790.1 | protein_coding | 3:9413052-9415240 | -17.2299 | 375 | 411 | 647 | 610 | myb-like transcription factor family protein myb-like transcription factor family protein;CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); myb-like transcription factor family protein (TAIR:AT1G13300.1); Has 1651 Blast hits to 1636 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1625; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT2G25680.1 | protein_coding | 2:10933005-10934604 | -17.2377 | 806 | 853 | 658 | 597 | molybdate transporter 1 Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. molybdate transporter 1 (MOT1);FUNCTIONS IN: molybdate ion transmembrane transporter activity, sulfate transmembrane transporter activity; INVOLVED IN: molybdate ion transport; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; sulfate transmembrane transporters (TAIR:AT1G80310.1); Has 761 Blast hits to 750 proteins in 291 species: Archae - 26; Bacteria - 503; Metazoa - 6; Fungi - 58; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT2G40250.1 | protein_coding | 2:16813297-16815331 | -17.2743 | 726 | 810 | 328 | 254 | SGNH hydrolase-type esterase superfamily protein SGNH hydrolase-type esterase superfamily protein;FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, sepal, pedicel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT2G31540.1); Has 3497 Blast hits to 3457 proteins in 215 species: Archae - 0; Bacteria - 337; Metazoa - 0; Fungi - 15; Plants - 3125; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT4G28811.1 | protein_coding | 4:14225208-14228071 | -17.2902 | 656 | 686 | 235 | 208 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT4G28800.1); Has 3934 Blast hits to 3888 proteins in 271 species: Archae - 0; Bacteria - 6; Metazoa - 507; Fungi - 186; Plants - 3207; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G23140.1 | protein_coding | 3:8250519-8251483 | -17.2903 | 196 | 241 | 310 | 263 | C2H2 and C2HC zinc fingers superfamily protein Encodes UPRIGHT ROSETTE (URO). Overexpression of URO alters indole-3-acetic acid (IAA) homeostasis. UPRIGHT ROSETTE (URO);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: auxin homeostasis, regulation of transcription; LOCATED IN: intracellular;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); C2H2 and C2HC zinc fingers superfamily protein (TAIR:AT5G43540.1); Has 720 Blast hits to 720 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 698; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G45315.1 | lncRNA | 2:18682089-18684072 | -17.2923 | 270 | 291 | 1236 | 1213 | other RNA Potential natural antisense gene, locus overlaps with AT2G45310 | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G25090.1 | protein_coding | 3:9140039-9141094 | -17.323 | 193 | 231 | 966 | 929 | F-box associated ubiquitination effector family protein F-box associated ubiquitination effector family protein;CONTAINS InterPro DOMAIN/s: F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); F-box associated ubiquitination effector family protein (TAIR:AT3G23685.1); Has 853 Blast hits to 814 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 853; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT3G51810.1 | protein_coding | 3:19214722-19215831 | -17.3244 | 240 | 295 | 506 | 453 | Stress induced protein Encodes a ABA-inducible protein that accumulates during seed maturation, in parallel with its corresponding mRNA but with a 3 d delay. During germination, AtEm1 protein undergoes two successive cleavages before being degraded. Both proteins are more stable than the corresponding mRNA. The gene can be activated by the basic leucine zipper transcription factor ABI5. Expressed predominantly in provascular tissues with the strongest expression in the root tip. LATE EMBRYOGENESIS ABUNDANT 1 (EM1);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to abscisic acid stimulus, embryo development ending in seed dormancy; LOCATED IN: cellular_componentunknown; EXPRESSED IN: embryo, seed; EXPRESSED DURING: dry seed stage, seedling growth, seed maturation stage;CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 5, conserved site (InterPro:IPR022377), Stress induced protein (InterPro:IPR000389); Stress induced protein (TAIR:AT2G40170.1); Has 1194 Blast hits to 542 proteins in 139 species: Archae - 84; Bacteria - 323; Metazoa - 232; Fungi - 23; Plants - 322; Viruses - 14; Other Eukaryotes - 196 (source: NCBI BLink). | ||
| XLOC_008209 | Ch1:7537079-7537644 | AT5G20635.1 | protein_coding | 5:6979157-6982163 | -17.3685 | 132 | 151 | 45 | 26 | Encodes an atypical heterotrimeric G-protein gamma-subunit involved in guard cell K+-channel regulation and morphological development. FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: keratin filament, chloroplast;CONTAINS InterPro DOMAIN/s: Keratin, high sulphur B2 protein (InterPro:IPR002494); Has 6153 Blast hits to 2882 proteins in 265 species: Archae - 6; Bacteria - 47; Metazoa - 4777; Fungi - 68; Plants - 187; Viruses - 30; Other Eukaryotes - 1038 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | ATMG00730.1 | protein_coding | M:217631-219077 | -17.3723 | 642 | 704 | 981 | 930 | cytochrome c oxidase subunit 3 Encodes cytochrome c oxidase subunit 3. cytochrome c oxidase subunit 3 (COX3);CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit III (InterPro:IPR000298); Cytochrome c oxidase, subunit III (TAIR:AT2G07687.1). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT1G07680.1 | protein_coding | 1:2376012-2377186 | -17.392 | 579 | 596 | 155 | 138 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G23903.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT1G04950.1 | protein_coding | 1:1403085-1407531 | -17.3922 | 813 | 834 | 1687 | 1660 | TATA BOX ASSOCIATED FACTOR II 59Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. TATA BOX ASSOCIATED FACTOR II 59 (TAFII59);FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity, DNA binding; INVOLVED IN: pollen tube growth, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1546 (InterPro:IPR011442), Histone-fold (InterPro:IPR009072), TATA box binding protein associated factor (TAF) (InterPro:IPR004823); TBP-ASSOCIATED FACTOR 6B (TAIR:AT1G54360.1); Has 496 Blast hits to 490 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 144; Plants - 74; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). | ||
| XLOC_019399 | Ch3:13634011-13635110 | AT4G33870.1 | protein_coding | 4:16234519-16236492 | -17.3947 | 397 | 440 | 871 | 821 | Peroxidase superfamily proteinPeroxidase superfamily protein;FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress, oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Peroxidase, active site (InterPro:IPR019794), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); Peroxidase superfamily protein (TAIR:AT2G41480.1); Has 3863 Blast hits to 3848 proteins in 198 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 67; Plants - 3768; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT4G38600.1 | protein_coding | 4:18040623-18049700 | -17.4011 | 609 | 652 | 5982 | 5936 | HEAT repeat ;HECT-domain (ubiquitin-transferase)Encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. KAKTUS (KAK);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: trichome branching, DNA endoreduplication; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024), HECT (InterPro:IPR000569); ubiquitin-protein ligase 4 (TAIR:AT5G02880.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT3G25700.1 | protein_coding | 3:9358719-9360582 | -17.4142 | 931 | 961 | 261 | 222 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); Eukaryotic aspartyl protease family protein (TAIR:AT2G42980.1); Has 2947 Blast hits to 2928 proteins in 232 species: Archae - 0; Bacteria - 0; Metazoa - 679; Fungi - 106; Plants - 1964; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). | ||
| XLOC_008209 | Ch1:7537079-7537644 | AT5G61770.2 | protein_coding | 5:24815541-24817728 | -17.4184 | 445 | 466 | 1101 | 1080 | PETER PAN-like proteinPETER PAN-like protein (PPAN);CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); Has 1471 Blast hits to 1151 proteins in 223 species: Archae - 0; Bacteria - 34; Metazoa - 730; Fungi - 196; Plants - 73; Viruses - 37; Other Eukaryotes - 401 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G11005.1 | protein_coding | 2:4348511-4349577 | -17.4214 | 393 | 445 | 473 | 426 | glycine-rich protein glycine-rich protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT3G18520.2 | protein_coding | 3:6361159-6365705 | -17.431 | 351 | 374 | 277 | 254 | histone deacetylase 15 Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. histone deacetylase 15 (HDA15);FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: DNA mediated transformation, histone deacetylation; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876), Histone deacetylase superfamily (InterPro:IPR000286); histone deacetylase 5 (TAIR:AT5G61060.1); Has 9308 Blast hits to 9105 proteins in 1476 species: Archae - 223; Bacteria - 3234; Metazoa - 1500; Fungi - 655; Plants - 551; Viruses - 0; Other Eukaryotes - 3145 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT1G73200.1 | protein_coding | 1:27523043-27526818 | -17.4472 | 743 | 784 | 35 | 8 | Putative integral membrane protein conserved region (DUF2404) Putative integral membrane protein conserved region (DUF2404);FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF2404, transmembrane (InterPro:IPR019411), Pleckstrin homology (InterPro:IPR001849); Putative integral membrane protein conserved region (DUF2404) (TAIR:AT1G17820.1); Has 453 Blast hits to 336 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 247; Plants - 53; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT3G43153.1 | protein_coding | 3:15150104-15150916 | -17.4508 | 262 | 281 | 505 | 486 | cAMP-dependent protein kinase inhibitor-related cAMP-dependent protein kinase inhibitor-related; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT4G38430.1 | protein_coding | 4:17986384-17988869 | -17.4532 | 922 | 949 | 58 | 28 | rho guanyl-nucleotide exchange factor 1 Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity.rho guanyl-nucleotide exchange factor 1 (ROPGEF1);CONTAINS InterPro DOMAIN/s: Rop nucleotide exchanger, PRONE (InterPro:IPR005512); RHO guanyl-nucleotide exchange factor 7 (TAIR:AT5G02010.1); Has 308 Blast hits to 304 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 308; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G03290.1 | protein_coding | 5:793974-796218 | -17.464 | 612 | 669 | 1270 | 1210 | isocitrate dehydrogenase V Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. isocitrate dehydrogenase V (IDH-V);FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, zinc ion binding, ATP binding; INVOLVED IN: isocitrate metabolic process, tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434), Isocitrate/isopropylmalate dehydrogenase, conserved site (InterPro:IPR019818); isocitrate dehydrogenase VI (TAIR:AT3G09810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024098 | Ch4:16891225-16892077 | AT2G21620.2 | protein_coding | 2:9248525-9250311 | -17.4701 | 338 | 369 | 301 | 275 | Adenine nucleotide alpha hydrolases-like superfamily protein Encodes gene that is induced in response to dessication; mRNA expression is seen 10 and 24 hrs after start of dessication treatment. RD2;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to desiccation, response to stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT3G11930.1); Has 1098 Blast hits to 1097 proteins in 198 species: Archae - 70; Bacteria - 241; Metazoa - 121; Fungi - 60; Plants - 588; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G60750.1 | protein_coding | 3:22453668-22457458 | -17.49 | 604 | 632 | 267 | 239 | Transketolase Transketolase;FUNCTIONS IN: catalytic activity, transketolase activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Transketolase, bacterial-like (InterPro:IPR005478), Transketolase, N-terminal (InterPro:IPR005474), Transketolase, C-terminal (InterPro:IPR005476), Transketolase-like, C-terminal (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase-like, pyrimidine-binding domain (InterPro:IPR005475), Transketolase binding site (InterPro:IPR020826); Transketolase (TAIR:AT2G45290.1); Has 19296 Blast hits to 19203 proteins in 2759 species: Archae - 202; Bacteria - 11440; Metazoa - 321; Fungi - 314; Plants - 204; Viruses - 0; Other Eukaryotes - 6815 (source: NCBI BLink). | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT5G12350.1 | protein_coding | 5:3995310-4000801 | -17.5089 | 924 | 961 | 30 | 2 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain;FUNCTIONS IN: chromatin binding, zinc ion binding, Ran GTPase binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation, RCC1 (InterPro:IPR000408), Disease resistance/zinc finger/chromosome condensation-like region (InterPro:IPR013591), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Pleckstrin homology-type (InterPro:IPR011993), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain (TAIR:AT5G19420.1); Has 23773 Blast hits to 8858 proteins in 456 species: Archae - 73; Bacteria - 2346; Metazoa - 9625; Fungi - 1299; Plants - 3027; Viruses - 3; Other Eukaryotes - 7400 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT2G28480.1 | protein_coding | 2:12176483-12178498 | -17.5377 | 67 | 93 | 589 | 561 | RNA-binding CRS1 / YhbY (CRM) domain protein RNA-binding CRS1 / YhbY (CRM) domain protein;FUNCTIONS IN: RNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); RNA-binding CRS1 / YhbY (CRM) domain protein (TAIR:AT4G13070.1); Has 308 Blast hits to 279 proteins in 29 species: Archae - 0; Bacteria - 5; Metazoa - 22; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT1G03365.1 | protein_coding | 1:826523-830393 | -17.5723 | 341 | 384 | 2301 | 2262 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT4G03000.2). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G48060.1 | protein_coding | 3:17742989-17748785 | -17.5936 | 754 | 792 | 38 | 5 | BAH domain ;TFIIS helical bundle-like domain BAH domain ;TFIIS helical bundle-like domain;FUNCTIONS IN: transcription regulator activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: cultured cell;CONTAINS InterPro DOMAIN/s: Transcription factor IIS, N-terminal (InterPro:IPR017923), Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (InterPro:IPR003617), Bromo adjacent homology (BAH) domain (InterPro:IPR001025), Transcription elongation factor, TFIIS/elongin A/CRSP70, N-terminal (InterPro:IPR010990); BAH domain ;TFIIS helical bundle-like domain (TAIR:AT3G48050.2); Has 5615 Blast hits to 3296 proteins in 434 species: Archae - 6; Bacteria - 1034; Metazoa - 2145; Fungi - 615; Plants - 463; Viruses - 15; Other Eukaryotes - 1337 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G59910.1 | protein_coding | 1:22053863-22057268 | -17.6072 | 263 | 303 | 115 | 79 | Actin-binding FH2 (formin homology 2) family protein Actin-binding FH2 (formin homology 2) family protein;FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Actin-binding FH2/DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); formin 8 (TAIR:AT1G70140.1); Has 156785 Blast hits to 84417 proteins in 2586 species: Archae - 222; Bacteria - 29191; Metazoa - 66130; Fungi - 20882; Plants - 16945; Viruses - 3579; Other Eukaryotes - 19836 (source: NCBI BLink). | ||
| XLOC_019413 | Ch3:18243407-18243709 | AT1G49740.1 | protein_coding | 1:18407400-18410022 | -17.6131 | 82 | 116 | 1841 | 1808 | PLC-like phosphodiesterases superfamily protein PLC-like phosphodiesterases superfamily protein;FUNCTIONS IN: phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: intracellular signaling pathway, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphatidylinositol-specific , X domain (InterPro:IPR000909), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946); PLC-like phosphodiesterases superfamily protein (TAIR:AT3G19310.1); Has 451 Blast hits to 448 proteins in 104 species: Archae - 0; Bacteria - 81; Metazoa - 8; Fungi - 159; Plants - 152; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G06570.1 | protein_coding | 2:2622603-2624902 | -17.6134 | 316 | 358 | 833 | 791 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G06645.1); Has 18 Blast hits to 18 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019399 | Ch3:13634011-13635110 | AT5G37160.1 | protein_coding | 5:14705426-14706981 | -17.6287 | 63 | 96 | 586 | 545 | P-loop containing nucleoside triphosphate hydrolases superfamily protein P-loop containing nucleoside triphosphate hydrolases superfamily protein;FUNCTIONS IN: hydrolase activity, DNA binding, ATP binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.12 twelve leaves visible, D bilateral stage;CONTAINS InterPro DOMAIN/s: Restriction endonuclease, type I, R subunit/Type III, Res subunit (InterPro:IPR006935); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT5G37150.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT2G15710.1 | protein_coding | 2:6842648-6845103 | -17.6407 | 452 | 530 | 337 | 283 | TRAF-like family protein TRAF-like family protein;CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); TRAF-like family protein (TAIR:AT3G22080.1); Has 595 Blast hits to 491 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 14; Plants - 567; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT3G01280.1 | protein_coding | 3:85551-88070 | -17.6737 | 1056 | 1090 | 1202 | 1172 | voltage dependent anion channel 1 Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. voltage dependent anion channel 1 (VDAC1);FUNCTIONS IN: voltage-gated anion channel activity; INVOLVED IN: response to bacterium, anion transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Porin, eukaryotic type (InterPro:IPR001925); voltage dependent anion channel 3 (TAIR:AT5G15090.2); Has 888 Blast hits to 888 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 413; Fungi - 146; Plants - 300; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT5G02730.1 | protein_coding | 5:615550-616227 | -17.6823 | 578 | 608 | 77 | 33 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily proteinCAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: pollen tube;CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related, conserved site (InterPro:IPR018244), Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein (TAIR:AT3G09590.1); Has 3082 Blast hits to 2992 proteins in 385 species: Archae - 0; Bacteria - 66; Metazoa - 1668; Fungi - 333; Plants - 887; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT1G43730.1 | protein_coding | 1:16508723-16509784 | -17.7044 | 599 | 640 | 238 | 195 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein RNA-directed DNA polymerase (reverse transcriptase)-related family protein;CONTAINS InterPro DOMAIN/s: RNA-directed DNA polymerase (reverse transcriptase), related (InterPro:IPR015706); RNA-directed DNA polymerase (reverse transcriptase)-related family protein (TAIR:AT4G04650.1); Has 737 Blast hits to 724 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 737; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G37730.1 | protein_coding | 4:17723639-17725037 | -17.716 | 267 | 294 | 740 | 705 | basic leucine-zipper 7basic leucine-zipper 7 (bZIP7);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); basic leucine-zipper 6 (TAIR:AT2G22850.2); Has 1802 Blast hits to 1800 proteins in 126 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 25; Plants - 1671; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT5G41090.1 | protein_coding | 5:16445655-16446673 | -17.7389 | 267 | 284 | 553 | 536 | NAC domain containing protein 95 NAC domain containing protein 95 (NAC095);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); NAC (No Apical Meristem) domain transcriptional regulator superfamily protein (TAIR:AT3G56520.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G28780.1 | protein_coding | 2:12339851-12343443 | -17.739 | 217 | 304 | 2466 | 2393 | unknown protein; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G11325.1 | protein_coding | 3:3549771-3551800 | -17.7533 | 343 | 399 | 153 | 110 | Phospholipid/glycerol acyltransferase family protein Phospholipid/glycerol acyltransferase family protein;FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); glycerol-3-phosphate acyltransferase 5 (TAIR:AT3G11430.1); Has 520 Blast hits to 349 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 518; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT3G05830.2 | protein_coding | 3:1736307-1738749 | -17.7594 | 217 | 234 | 1016 | 999 | Encodes alpha-helical IF (intermediate filament)-like protein. FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G26770.1). | ||
| XLOC_024098 | Ch4:16891225-16892077 | AT3G53040.1 | protein_coding | 3:19664629-19666497 | -17.7835 | 342 | 381 | 1266 | 1227 | late embryogenesis abundant protein, putative / LEA protein, putative late embryogenesis abundant protein, putative / LEA protein, putative; INVOLVED IN: embryo development ending in seed dormancy; EXPRESSED IN: seed;CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 4 (InterPro:IPR004238); embryonic cell protein 63 (TAIR:AT2G36640.1); Has 58153 Blast hits to 33178 proteins in 2866 species: Archae - 714; Bacteria - 20429; Metazoa - 14816; Fungi - 4800; Plants - 4772; Viruses - 420; Other Eukaryotes - 12202 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G03580.1 | protein_coding | 4:1596985-1599091 | -17.8096 | 267 | 291 | 94 | 61 | Cysteine proteinases superfamily protein (TAIR:AT5G17080.1); Has 155 Blast hits to 136 proteins in 31 species: Archae - 0; Bacteria - 11; Metazoa - 28; Fungi - 14; Plants - 17; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT2G24360.1 | protein_coding | 2:10364451-10366902 | -17.8297 | 725 | 784 | 91 | 50 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-like, ATMRK (InterPro:IPR015783), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Protein kinase superfamily protein (TAIR:AT4G31170.3); Has 132546 Blast hits to 130322 proteins in 4939 species: Archae - 142; Bacteria - 14767; Metazoa - 50018; Fungi - 12226; Plants - 34060; Viruses - 645; Other Eukaryotes - 20688 (source: NCBI BLink). | ||
| XLOC_031134 | Ch5:12011873-12013155 | AT2G01360.1 | protein_coding | 2:167931-168479 | -17.8353 | 804 | 829 | 324 | 301 | pentatricopeptide (PPR) repeat-containing proteinpentatricopeptide (PPR) repeat-containing protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G01390.1); Has 425 Blast hits to 414 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 420; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT5G06490.1 | protein_coding | 5:1977776-1978987 | -17.8505 | 528 | 570 | 186 | 142 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT2G35910.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT3G03440.1 | protein_coding | 3:815550-818876 | -17.8534 | 1435 | 1454 | 36 | 17 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); ARM repeat superfamily protein (TAIR:AT4G12710.1); Has 4476 Blast hits to 2974 proteins in 239 species: Archae - 0; Bacteria - 8; Metazoa - 931; Fungi - 611; Plants - 2534; Viruses - 0; Other Eukaryotes - 392 (source: NCBI BLink). | ||
| XLOC_022789 | Ch4:10093250-10095083 | AT1G08600.3 | protein_coding | 1:2723677-2733613 | -17.8597 | 1045 | 1084 | 399 | 350 | P-loop containing nucleoside triphosphate hydrolases superfamily protein ATRX;FUNCTIONS IN: helicase activity, DNA binding, nucleic acid binding, ATP binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); homolog of RAD54 (TAIR:AT3G19210.1). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT5G14410.1 | protein_coding | 5:4646702-4647503 | -17.875 | 1106 | 1154 | 261 | 212 | unknown protein; Has 23 Blast hits to 23 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT5G05930.1 | protein_coding | 5:1779870-1783465 | -17.8814 | 264 | 291 | 52 | 16 | guanylyl cyclase 1 guanylyl cyclase 1 (GC1);CONTAINS InterPro DOMAIN/s: Guanylyl cyclase (InterPro:IPR018616); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031151 | Ch5:20148160-20148830 | AT5G41990.1 | protein_coding | 5:16794967-16798006 | -17.8864 | 391 | 441 | 372 | 310 | with no lysine (K) kinase 8Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase. with no lysine (K) kinase 8 (WNK8);CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); with no lysine (K) kinase 10 (TAIR:AT1G64630.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT4G20470.1 | protein_coding | 4:11032332-11032754 | -17.8878 | 1435 | 1454 | 244 | 225 | unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_025624 | Ch5:10489675-10490145 | AT5G37260.1 | protein_coding | 5:14751344-14753088 | -17.8915 | 228 | 251 | 66 | 41 | Homeodomain-like superfamily protein Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. REVEILLE 2 (RVE2);CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); Homeodomain-like superfamily protein (TAIR:AT5G17300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT1G47765.1 | protein_coding | 1:17574906-17576092 | -17.8999 | 177 | 208 | 29 | 0 | F-box and associated interaction domains-containing protein F-box and associated interaction domains-containing protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); F-box and associated interaction domains-containing protein (TAIR:AT1G47790.1); Has 1791 Blast hits to 1741 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1791; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_008753 | Ch2:6523751-6525971 | AT1G59580.1 | protein_coding | 1:21884018-21886051 | -17.9307 | 144 | 183 | 108 | 71 | mitogen-activated protein kinase homolog 2 encodes a mitogen-activated kinase involved in innate immunity mitogen-activated protein kinase homolog 2 (MPK2);CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), MAP kinase, conserved site (InterPro:IPR003527), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); mitogen-activated protein kinase 1 (TAIR:AT1G10210.2); Has 121192 Blast hits to 119674 proteins in 4402 species: Archae - 98; Bacteria - 12397; Metazoa - 46062; Fungi - 12260; Plants - 29633; Viruses - 469; Other Eukaryotes - 20273 (source: NCBI BLink). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT1G33990.1 | protein_coding | 1:12355557-12358031 | -17.9465 | 1098 | 1117 | 218 | 198 | methyl esterase 14 Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. methyl esterase 14 (MES14);FUNCTIONS IN: hydrolase activity; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); methyl esterase 12 (TAIR:AT4G09900.1); Has 2201 Blast hits to 2201 proteins in 482 species: Archae - 0; Bacteria - 1205; Metazoa - 3; Fungi - 45; Plants - 622; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G07040.1 | protein_coding | 2:2916416-2919392 | -17.9722 | 267 | 291 | 1947 | 1923 | Leucine-rich repeat protein kinase family protein Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth. PRK2A;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, transmembrane receptor protein tyrosine kinase signaling pathway, pollen tube growth; LOCATED IN: plasma membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT5G35390.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G42960.1 | protein_coding | 5:17235092-17236679 | -17.9747 | 601 | 659 | 80 | 17 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G45170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G01460.1 | protein_coding | 1:168559-171386 | -17.9861 | 272 | 305 | 1242 | 1209 | Phosphatidylinositol-4-phosphate 5-kinase, core Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. PIPK11;FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: sperm cell, sepal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); phosphatidylinositol phosphate kinase 10 (TAIR:AT4G01190.1); Has 2109 Blast hits to 1621 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 980; Fungi - 317; Plants - 416; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT1G69440.1 | protein_coding | 1:26101407-26105328 | -18.0009 | 1052 | 1089 | 294 | 256 | Argonaute family proteinEncodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds.ARGONAUTE7 (AGO7);FUNCTIONS IN: nucleic acid binding; INVOLVED IN: production of ta-siRNAs involved in RNA interference, vegetative phase change, production of lsiRNA involved in RNA interference, regulation of development, heterochronic, gene silencing by miRNA; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Domain ofunknown function DUF1785 (InterPro:IPR014811), Stem cell self-renewal protein Piwi (InterPro:IPR003165), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Polynucleotidyl transferase, ribonuclease H fold (InterPro:IPR012337); Stabilizer of iron transporter SufD / Polynucleotidyl transferase (TAIR:AT1G48410.1); Has 2067 Blast hits to 2008 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1082; Fungi - 299; Plants - 502; Viruses - 5; Other Eukaryotes - 179 (source: NCBI BLink). | ||
| XLOC_011691 | Ch2:9930659-9932381 | AT1G79190.1 | protein_coding | 1:29788466-29794251 | -18.001 | 361 | 380 | 3831 | 3812 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 200 Blast hits to 184 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 76; Plants - 39; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | ||
| XLOC_019399 | Ch3:13634011-13635110 | AT4G13240.1 | protein_coding | 4:7679950-7682622 | -18.0322 | 526 | 576 | 566 | 515 | RHO guanyl-nucleotide exchange factor 9 Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. RHO guanyl-nucleotide exchange factor 9 (ROPGEF9);CONTAINS InterPro DOMAIN/s: Rop nucleotide exchanger, PRONE (InterPro:IPR005512); RHO guanyl-nucleotide exchange factor 8 (TAIR:AT3G24620.1); Has 308 Blast hits to 304 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 306; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT5G34870.1 | protein_coding | 5:13185521-13187946 | -18.0349 | 234 | 296 | 784 | 733 | zinc knuckle (CCHC-type) family protein zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); zinc ion binding;nucleic acid binding (TAIR:AT4G06479.1); Has 12 Blast hits to 12 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 7; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | ||
| XLOC_010960 | Ch2:1780865-1781783 | AT3G62790.1 | protein_coding | 3:23223030-23224326 | -18.0525 | 222 | 250 | 106 | 68 | NADH-ubiquinone oxidoreductase-relatedNADH-ubiquinone oxidoreductase-related;CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase, iron-sulphur subunit 5 (InterPro:IPR019342); NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 129 Blast hits to 129 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 62; Plants - 56; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | ||
| XLOC_024070 | Ch4:3092474-3093625 | AT5G38200.1 | protein_coding | 5:15256243-15258814 | -18.0535 | 1003 | 1047 | 1230 | 1180 | Class I glutamine amidotransferase-like superfamily protein Class I glutamine amidotransferase-like superfamily protein;FUNCTIONS IN: hydrolase activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Peptidase C26 (InterPro:IPR011697), Glutamine amidotransferase type 1 (InterPro:IPR017926); Class I glutamine amidotransferase-like superfamily protein (TAIR:AT1G66860.1); Has 3533 Blast hits to 3529 proteins in 1172 species: Archae - 17; Bacteria - 2871; Metazoa - 1; Fungi - 3; Plants - 53; Viruses - 0; Other Eukaryotes - 588 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G38410.1 | protein_coding | 2:16086514-16090274 | -18.1 | 267 | 292 | 1302 | 1277 | ENTH/VHS/GAT family protein ENTH/VHS/GAT family protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); ENTH/VHS/GAT family protein (TAIR:AT5G01760.1); Has 42231 Blast hits to 23362 proteins in 1216 species: Archae - 12; Bacteria - 2643; Metazoa - 15006; Fungi - 7319; Plants - 4169; Viruses - 367; Other Eukaryotes - 12715 (source: NCBI BLink). | ||
| XLOC_024098 | Ch4:16891225-16892077 | AT2G37290.2 | protein_coding | 2:15656427-15661735 | -18.1409 | 37 | 89 | 973 | 921 | Ypt/Rab-GAP domain of gyp1p superfamily protein Ypt/Rab-GAP domain of gyp1p superfamily protein;FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity;CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT3G55020.1). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT5G32613.1 | protein_coding | 5:12263255-12265041 | -18.1481 | 704 | 730 | 651 | 626 | Zinc knuckle (CCHC-type) family protein Zinc knuckle (CCHC-type) family protein;FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast;CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); Zinc knuckle (CCHC-type) family protein (TAIR:AT2G07760.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_018021 | Ch3:11751847-11757079 | AT1G16860.1 | protein_coding | 1:5767300-5770602 | -18.1509 | 776 | 834 | 128 | 74 | Ubiquitin-specific protease family C19-related proteinUbiquitin-specific protease family C19-related protein; LOCATED IN: plasma membrane; Ubiquitin-specific protease family C19-related protein (TAIR:AT1G78880.1); Has 605 Blast hits to 295 proteins in 85 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 28; Plants - 169; Viruses - 0; Other Eukaryotes - 360 (source: NCBI BLink). | ||
| XLOC_011691 | Ch2:9930659-9932381 | AT1G73430.1 | protein_coding | 1:27603655-27611120 | -18.166 | 1380 | 1432 | 144 | 102 | sec34-like family proteinsec34-like family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 353 Blast hits to 340 proteins in 172 species: Archae - 0; Bacteria - 4; Metazoa - 117; Fungi - 139; Plants - 43; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT2G13370.1 | protein_coding | 2:5544054-5556560 | -18.1883 | 341 | 364 | 4058 | 4034 | chromatin remodeling 5chromatin remodeling 5 (CHR5);FUNCTIONS IN: chromatin binding, helicase activity, DNA binding, nucleic acid binding, ATP binding; INVOLVED IN: chromatin assembly or disassembly; LOCATED IN: chromatin, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Chromo domain (InterPro:IPR000953), SNF2-related (InterPro:IPR000330), Homeodomain-like (InterPro:IPR009057), DEAD-like helicase, N-terminal (InterPro:IPR014001), Chromo domain-like (InterPro:IPR016197), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); chromatin remodeling factor CHD3 (PICKLE) (TAIR:AT2G25170.1); Has 38529 Blast hits to 28045 proteins in 2467 species: Archae - 189; Bacteria - 9973; Metazoa - 8887; Fungi - 6205; Plants - 2508; Viruses - 447; Other Eukaryotes - 10320 (source: NCBI BLink). | ||
| XLOC_013214 | Ch2:9922669-9923603 | AT3G18480.1 | protein_coding | 3:6336692-6341788 | -18.1906 | 767 | 784 | 242 | 225 | CCAAT-displacement protein alternatively spliced product This gene is predicted to encode a protein thatFUNCTIONS as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation.CCAAT-displacement protein alternatively spliced product (CASP); INVOLVED IN: intra-Golgi vesicle-mediated transport; LOCATED IN: integral to membrane, Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: CASP, C-terminal (InterPro:IPR012955); Has 108439 Blast hits to 62245 proteins in 2877 species: Archae - 1242; Bacteria - 16953; Metazoa - 49041; Fungi - 8922; Plants - 5181; Viruses - 394; Other Eukaryotes - 26706 (source: NCBI BLink). | ||
| XLOC_012146 | Ch2:13049320-13052386 | AT5G01620.3 | protein_coding | 5:232565-234916 | -18.1954 | 344 | 360 | 1310 | 1294 | TRICHOME BIREFRINGENCE-LIKE 35 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain ofunknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TRICHOME BIREFRINGENCE-LIKE 35 (TBL35); LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF231, plant (InterPro:IPR004253); TRICHOME BIREFRINGENCE-LIKE 34 (TAIR:AT2G38320.1). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT2G40500.1 | protein_coding | 2:16916330-16917217 | -18.2128 | 316 | 367 | 817 | 765 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: pollen tube;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Protein kinase superfamily protein (TAIR:AT2G40560.1); Has 57525 Blast hits to 57045 proteins in 2217 species: Archae - 143; Bacteria - 6743; Metazoa - 24467; Fungi - 6984; Plants - 8604; Viruses - 186; Other Eukaryotes - 10398 (source: NCBI BLink). | ||
| XLOC_003925 | Ch1:28787818-28789937 | AT3G09840.1 | protein_coding | 3:3019249-3023052 | -18.2359 | 113 | 158 | 2362 | 2299 | cell division cycle 48 Encodes a cell division cycle protein, a member of AAA-type ATPases gene family. Expressed throughout the plant in regions of cell division. Within the cell, sub-cellular localization varies depending on the stage of the cell cycle.Mutants in which the expression of CDC48A is altered show defects in cytokinesis, cell expansion and cell differentiation. cell division cycle 48 (CDC48);FUNCTIONS IN: ATPase activity, identical protein binding; INVOLVED IN: response to cadmium ion, pollen germination, pollen tube growth, cell division, phosphorylation; LOCATED IN: in 9 components; EXPRESSED IN: 33 plant structures; EXPRESSED DURING: 16 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); ATPase, AAA-type, CDC48 protein (TAIR:AT5G03340.1); Has 66378 Blast hits to 39099 proteins in 3298 species: Archae - 1713; Bacteria - 29252; Metazoa - 8676; Fungi - 6302; Plants - 5800; Viruses - 77; Other Eukaryotes - 14558 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G07150.1 | protein_coding | 1:2193941-2195996 | -18.2387 | 259 | 291 | 960 | 932 | mitogen-activated protein kinase kinase kinase 13 member of MEKK subfamily mitogen-activated protein kinase kinase kinase 13 (MAPKKK13);FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); mitogen-activated protein kinase kinase kinase 14 (TAIR:AT2G30040.1); Has 115480 Blast hits to 114239 proteins in 3527 species: Archae - 169; Bacteria - 12227; Metazoa - 43932; Fungi - 11802; Plants - 28183; Viruses - 583; Other Eukaryotes - 18584 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G53230.1 | protein_coding | 3:19723350-19727128 | -18.2431 | 601 | 643 | 49 | 2 | ATPase, AAA-type, CDC48 protein ATPase, AAA-type, CDC48 protein;FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, binding, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, nucleolus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Aspartate decarboxylase-like fold (InterPro:IPR009010), Cell division protein 48, CDC48, domain 2 (InterPro:IPR004201), ATPase, AAA-type, VAT, N-terminal (InterPro:IPR003338), ATPase, AAA-type, CDC48 (InterPro:IPR005938); ATPase, AAA-type, CDC48 protein (TAIR:AT5G03340.1); Has 66274 Blast hits to 38860 proteins in 3301 species: Archae - 1748; Bacteria - 29009; Metazoa - 8678; Fungi - 6310; Plants - 5885; Viruses - 85; Other Eukaryotes - 14559 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT1G15040.1 | protein_coding | 1:5179887-5181402 | -18.2465 | 653 | 691 | 216 | 182 | Class I glutamine amidotransferase-like superfamily proteinEncodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. Class I glutamine amidotransferase-like superfamily protein;FUNCTIONS IN: hydrolase activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: hypocotyl, root;CONTAINS InterPro DOMAIN/s: Peptidase C26 (InterPro:IPR011697), Glutamine amidotransferase type 1 (InterPro:IPR017926); Class I glutamine amidotransferase-like superfamily protein (TAIR:AT1G66860.1); Has 3704 Blast hits to 3700 proteins in 1207 species: Archae - 28; Bacteria - 2948; Metazoa - 3; Fungi - 7; Plants - 53; Viruses - 0; Other Eukaryotes - 665 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G38900.1 | protein_coding | 5:15573505-15575712 | -18.25 | 602 | 643 | 923 | 890 | Thioredoxin superfamily protein Thioredoxin superfamily protein;FUNCTIONS IN: protein disulfide oxidoreductase activity; INVOLVED IN: defense response to fungus, incompatible interaction; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: DSBA oxidoreductase (InterPro:IPR001853), Thioredoxin-like fold (InterPro:IPR012336); Has 2126 Blast hits to 2126 proteins in 739 species: Archae - 17; Bacteria - 1478; Metazoa - 14; Fungi - 129; Plants - 62; Viruses - 0; Other Eukaryotes - 426 (source: NCBI BLink). | ||
| XLOC_013202 | Ch2:3641880-3642687 | AT1G30670.1 | protein_coding | 1:10879173-10880188 | -18.2581 | 520 | 553 | 91 | 46 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G34820.1); Has 1015 Blast hits to 1013 proteins in 53 species: Archae - 0; Bacteria - 8; Metazoa - 1; Fungi - 4; Plants - 1002; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_023074 | Ch4:12152276-12153519 | AT4G23210.3 | protein_coding | 4:12148673-12151638 | -18.2765 | 979 | 1006 | 212 | 185 | cysteine-rich RLK (RECEPTOR-like protein kinase) 13Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. cysteine-rich RLK (RECEPTOR-like protein kinase) 13 (CRK13);FUNCTIONS IN: kinase activity; INVOLVED IN: defense response to bacterium, response to molecule of bacterial origin, plant-type hypersensitive response; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Protein ofunknown function DUF26 (InterPro:IPR002902), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); cysteine-rich RLK (RECEPTOR-like protein kinase) 22 (TAIR:AT4G23300.1); Has 115691 Blast hits to 114357 proteins in 4390 species: Archae - 92; Bacteria - 13299; Metazoa - 42539; Fungi - 9809; Plants - 32940; Viruses - 418; Other Eukaryotes - 16594 (source: NCBI BLink). | ||
| XLOC_019399 | Ch3:13634011-13635110 | AT4G28811.1 | protein_coding | 4:14225208-14228071 | -18.2788 | 46 | 112 | 743 | 690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT4G28800.1); Has 3934 Blast hits to 3888 proteins in 271 species: Archae - 0; Bacteria - 6; Metazoa - 507; Fungi - 186; Plants - 3207; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). | ||
| XLOC_001726 | Ch1:10966845-10968845 | AT1G34110.1 | protein_coding | 1:12417012-12421792 | -18.3156 | 976 | 1003 | 548 | 527 | Leucine-rich receptor-like protein kinase family protein Leucine-rich receptor-like protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); Leucine-rich repeat receptor-like protein kinase family protein (TAIR:AT3G24240.1); Has 229810 Blast hits to 121355 proteins in 3638 species: Archae - 147; Bacteria - 18757; Metazoa - 70622; Fungi - 9447; Plants - 104379; Viruses - 381; Other Eukaryotes - 26077 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT3G58310.1 | protein_coding | 3:21583863-21585133 | -18.3399 | 364 | 387 | 336 | 315 | Domain ofunknown function (DUF26) FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF26 (InterPro:IPR002902); Receptor-like protein kinase-related family protein (TAIR:AT3G22060.1); Has 1449 Blast hits to 1404 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1449; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT4G29370.1 | protein_coding | 4:14455602-14456852 | -18.3553 | 659 | 718 | 221 | 163 | Galactose oxidase/kelch repeat superfamily protein Galactose oxidase/kelch repeat superfamily protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); Galactose oxidase/kelch repeat superfamily protein (TAIR:AT5G49000.2); Has 2255 Blast hits to 2075 proteins in 174 species: Archae - 19; Bacteria - 136; Metazoa - 830; Fungi - 22; Plants - 1164; Viruses - 24; Other Eukaryotes - 60 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT2G31210.1 | protein_coding | 2:13296143-13298277 | -18.3667 | 527 | 556 | 1101 | 1074 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein basic helix-loop-helix (bHLH) DNA-binding superfamily protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: leaf whorl, sepal, flower; EXPRESSED DURING: petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT1G06170.2); Has 1830 Blast hits to 1818 proteins in 133 species: Archae - 2; Bacteria - 0; Metazoa - 18; Fungi - 11; Plants - 1605; Viruses - 5; Other Eukaryotes - 189 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT2G21780.1 | protein_coding | 2:9290705-9291669 | -18.42 | 261 | 328 | 381 | 320 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G39360.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G29810.1 | protein_coding | 3:11728024-11730350 | -18.4206 | 745 | 773 | 34 | 0 | COBRA-like protein 2 precursorCOBRA-like protein 2 precursor (COBL2);FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycosyl-phosphatidyl inositol-anchored, plant (InterPro:IPR006918), COBRA-like (InterPro:IPR017391); COBRA-like protein 1 precursor (TAIR:AT3G02210.1); Has 381 Blast hits to 370 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 381; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT5G20690.1 | protein_coding | 5:7002453-7004775 | -18.4328 | 553 | 579 | 1629 | 1592 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT3G42880.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_011023 | Ch2:2893864-2896523 | AT5G50010.1 | protein_coding | 5:20348615-20350830 | -18.4443 | 167 | 190 | 159 | 136 | sequence-specific DNA binding transcription factors;transcription regulators sequence-specific DNA binding transcription factors;transcription regulators; sequence-specific DNA binding transcription factors;transcription regulators (TAIR:AT5G64340.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G13125.1 | protein_coding | 2:5415891-5416317 | -18.4521 | 236 | 290 | 361 | 326 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT1G34010.1 | protein_coding | 1:12359454-12361313 | -18.4937 | 1434 | 1459 | 40 | 14 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G22790.2); Has 74 Blast hits to 74 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT2G34370.1 | protein_coding | 2:14510482-14511944 | -18.556 | 272 | 354 | 139 | 73 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G29710.1); Has 20194 Blast hits to 10208 proteins in 162 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 23; Plants - 20031; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT1G22403.1 | ncRNA | 1:7908568-7909708 | -18.5848 | 189 | 238 | 46 | 3 | other RNA | ||
| XLOC_013016 | Ch2:18460464-18461201 | AT4G08395.1 | protein_coding | 4:5319634-5320712 | -18.5861 | 481 | 518 | 399 | 371 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT5G19410.1 | protein_coding | 5:6545123-6547177 | -18.6219 | 512 | 548 | 1772 | 1734 | ABC-2 type transporter family protein ABC-2 type transporter family protein;FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast, membrane;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); ABC-2 type transporter family protein (TAIR:AT5G52860.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT1G66500.1 | protein_coding | 1:24811080-24812661 | -18.6429 | 301 | 341 | 1141 | 1101 | Pre-mRNA cleavage complex II Pre-mRNA cleavage complex II;FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_processunknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); Pre-mRNA cleavage complex II (TAIR:AT5G43620.1); Has 382 Blast hits to 380 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 132; Plants - 64; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). | ||
| XLOC_010920 | Ch2:1382580-1383626 | AT1G33480.1 | protein_coding | 1:12148515-12150617 | -18.6477 | 412 | 451 | 881 | 836 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT4G10150.1); Has 8909 Blast hits to 8880 proteins in 293 species: Archae - 0; Bacteria - 9; Metazoa - 2258; Fungi - 649; Plants - 4733; Viruses - 65; Other Eukaryotes - 1195 (source: NCBI BLink). | ||
| XLOC_019727 | Ch4:2593945-2594534 | AT1G69830.1 | protein_coding | 1:26288228-26293173 | -18.6613 | 246 | 285 | 66 | 4 | alpha-amylase-like 3 Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. alpha-amylase-like 3 (AMY3);FUNCTIONS IN: alpha-amylase activity; INVOLVED IN: circadian rhythm, starch catabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic domain (InterPro:IPR006047), Alpha-amylase, C-terminal beta-sheet (InterPro:IPR012850); alpha-amylase-like 2 (TAIR:AT1G76130.1); Has 11240 Blast hits to 11194 proteins in 2094 species: Archae - 95; Bacteria - 8555; Metazoa - 677; Fungi - 729; Plants - 646; Viruses - 0; Other Eukaryotes - 538 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT3G54100.1 | protein_coding | 3:20033951-20038200 | -18.717 | 1427 | 1458 | 44 | 9 | O-fucosyltransferase family protein O-fucosyltransferase family protein;CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); O-fucosyltransferase family protein (TAIR:AT2G37980.1); Has 847 Blast hits to 824 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 847; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_008425 | Ch2:1391923-1393064 | AT1G70190.1 | protein_coding | 1:26430498-26432270 | -18.7183 | 214 | 269 | 466 | 408 | Ribosomal protein L7/L12, oligomerisation;Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like Ribosomal protein L7/L12, oligomerisation;Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like;FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); Ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 8429 Blast hits to 8429 proteins in 2754 species: Archae - 0; Bacteria - 5654; Metazoa - 195; Fungi - 132; Plants - 253; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). | ||
| XLOC_022789 | Ch4:10093250-10095083 | AT3G52280.2 | protein_coding | 3:19388970-19391424 | -18.7199 | 1022 | 1075 | 1199 | 1158 | general transcription factor group E6 Bromodomain containing nuclear-localized protein involved in leaf development. GTE6 binds to the promoter and intron of AS1 and regulates its expression via histone acetylation. general transcription factor group E6 (GTE6);FUNCTIONS IN: histone acetyltransferase activity, DNA binding; INVOLVED IN: chromatin remodeling; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); Transcription factor GTE6 (TAIR:AT2G34900.1). | ||
| XLOC_008624 | Ch2:4005879-4008250 | AT1G18950.1 | protein_coding | 1:6546177-6552108 | -18.7741 | 1083 | 1119 | 34 | 1 | DDT domain superfamilyDDT domain superfamily;CONTAINS InterPro DOMAIN/s: DDT domain (InterPro:IPR004022); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G25580.1); Has 20293 Blast hits to 13585 proteins in 823 species: Archae - 41; Bacteria - 1919; Metazoa - 8043; Fungi - 2539; Plants - 1031; Viruses - 220; Other Eukaryotes - 6500 (source: NCBI BLink). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT2G40180.1 | protein_coding | 2:16782366-16784147 | -18.7827 | 507 | 534 | 183 | 156 | phosphatase 2C5 Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. phosphatase 2C5 (PP2C5);CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); Protein phosphatase 2C family protein (TAIR:AT1G07160.1); Has 6862 Blast hits to 6800 proteins in 519 species: Archae - 10; Bacteria - 469; Metazoa - 1632; Fungi - 782; Plants - 2690; Viruses - 9; Other Eukaryotes - 1270 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT5G42260.1 | protein_coding | 5:16898712-16900317 | -18.7845 | 107 | 136 | 595 | 563 | beta glucosidase 12 beta glucosidase 12 (BGLU12);FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); beta glucosidase 13 (TAIR:AT5G44640.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT5G12480.1 | protein_coding | 5:4047513-4050643 | -18.8257 | 433 | 459 | 534 | 511 | calmodulin-domain protein kinase 7 calmodulin-domain protein kinase CDPK isoform 7 (CPK7) calmodulin-domain protein kinase 7 (CPK7);FUNCTIONS IN: in 6FUNCTIONS; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), EF-Hand 1, calcium-binding site (InterPro:IPR018247), Serine/threonine-protein kinase domain (InterPro:IPR002290), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand-like domain (InterPro:IPR011992), EF-hand (InterPro:IPR018248), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), EF-HAND 2 (InterPro:IPR018249), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); calcium-dependent protein kinase 19 (TAIR:AT5G19450.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G02960.5 | protein_coding | 2:862029-864452 | -18.8304 | 591 | 641 | 1005 | 961 | RING/FYVE/PHD zinc finger superfamily protein RING/FYVE/PHD zinc finger superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF3675 (InterPro:IPR022143), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, RING-CH-type (InterPro:IPR011016); RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT1G14260.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_019408 | Ch3:15426764-15427680 | AT1G23320.1 | protein_coding | 1:8273423-8275350 | -18.8595 | 647 | 689 | 720 | 686 | tryptophan aminotransferase related 1Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. This gene appears to be expressed at a very low level during seedling development. Triple mutant analyses implicate this gene in embryonic development. tryptophan aminotransferase related 1 (TAR1);CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Allinase, C-terminal (InterPro:IPR006948); tryptophan aminotransferase of Arabidopsis 1 (TAIR:AT1G70560.1); Has 469 Blast hits to 469 proteins in 155 species: Archae - 22; Bacteria - 229; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT4G32850.8 | protein_coding | 4:15849711-15855194 | -18.8977 | 1427 | 1468 | 96 | 57 | nuclear poly(a) polymerase Encodes a nuclear poly(A) polymerase. Located in the nucleus. nuclear poly(a) polymerase (nPAP);CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Poly(A) polymerase, central domain (InterPro:IPR007012), Nucleotidyl transferase domain (InterPro:IPR002934), Poly(A) polymerase, RNA-binding domain (InterPro:IPR007010); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT3G19990.1 | protein_coding | 3:6965595-6967321 | -18.9208 | 67 | 96 | 841 | 809 | unknown protein; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 118 Blast hits to 118 proteins in 41 species: Archae - 0; Bacteria - 42; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT4G31320.1 | protein_coding | 4:15193709-15194665 | -18.925 | 540 | 566 | 285 | 263 | SAUR-like auxin-responsive protein familySAUR-like auxin-responsive protein family ;CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); SAUR-like auxin-responsive protein family (TAIR:AT2G24400.1); Has 1341 Blast hits to 1332 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1340; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G61780.1 | protein_coding | 5:24821203-24826969 | -18.9333 | 587 | 635 | 3389 | 3352 | TUDOR-SN protein 2 Involved in the regulation of AtGA20ox3 expression, as well as seed germination. TUDOR-SN protein 2 (Tudor2);FUNCTIONS IN: RNA binding, nuclease activity, nucleic acid binding; INVOLVED IN: response to cadmium ion, protein secretion, gibberellin biosynthetic process, seed germination, response to stress; LOCATED IN: cytosol, nuclear envelope, endoplasmic reticulum; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 17 growth stages;CONTAINS InterPro DOMAIN/s: Staphylococcal nuclease (SNase-like) (InterPro:IPR006021), RNA-induced silencing complex, nuclease component Tudor-SN (InterPro:IPR016685), Staphylococcal nuclease (SNase-like), OB-fold (InterPro:IPR016071), Tudor subgroup (InterPro:IPR018351), Tudor domain (InterPro:IPR002999), Maternal tudor protein (InterPro:IPR008191); TUDOR-SN protein 1 (TAIR:AT5G07350.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_013202 | Ch2:3641880-3642687 | AT1G66640.1 | protein_coding | 1:24857438-24859011 | -18.9425 | 402 | 444 | 1059 | 1024 | RNI-like superfamily protein RNI-like superfamily protein;CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); F-box/RNI-like superfamily protein (TAIR:AT1G66320.1); Has 817 Blast hits to 803 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT2G35615.1 | protein_coding | 2:14959386-14960828 | -18.9668 | 743 | 778 | 40 | 13 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); Eukaryotic aspartyl protease family protein (TAIR:AT1G31450.1); Has 2848 Blast hits to 2831 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 342; Fungi - 487; Plants - 1854; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT3G28720.1 | protein_coding | 3:10782095-10784634 | -18.9797 | 522 | 546 | 94 | 71 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G58100.1); Has 1610 Blast hits to 344 proteins in 85 species: Archae - 0; Bacteria - 567; Metazoa - 95; Fungi - 71; Plants - 145; Viruses - 0; Other Eukaryotes - 732 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT5G51160.1 | protein_coding | 5:20792073-20793841 | -18.9901 | 744 | 778 | 54 | 24 | Ankyrin repeat family protein Ankyrin repeat family protein;CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); Ankyrin repeat family protein (TAIR:AT4G10720.1); Has 23468 Blast hits to 11643 proteins in 579 species: Archae - 38; Bacteria - 1696; Metazoa - 12874; Fungi - 1168; Plants - 2550; Viruses - 45; Other Eukaryotes - 5097 (source: NCBI BLink). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT5G44360.1 | protein_coding | 5:17871924-17873829 | -19.0137 | 608 | 656 | 410 | 363 | FAD-binding Berberine family protein FAD-binding Berberine family protein;FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); FAD-binding Berberine family protein (TAIR:AT4G20860.1); Has 4918 Blast hits to 4788 proteins in 768 species: Archae - 52; Bacteria - 2097; Metazoa - 4; Fungi - 1714; Plants - 788; Viruses - 0; Other Eukaryotes - 263 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT5G01980.1 | protein_coding | 5:375208-377603 | -19.0528 | 69 | 96 | 1498 | 1472 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT5G08139.1); Has 7827 Blast hits to 7813 proteins in 270 species: Archae - 0; Bacteria - 9; Metazoa - 2445; Fungi - 565; Plants - 3731; Viruses - 72; Other Eukaryotes - 1005 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT4G20850.1 | protein_coding | 4:11160721-11170071 | -19.0935 | 543 | 571 | 3853 | 3825 | tripeptidyl peptidase ii Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant.tripeptidyl peptidase ii (TPP2);FUNCTIONS IN: tripeptidyl-peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Peptidase S8A, tripeptidyl peptidase II (InterPro:IPR022229); Has 6394 Blast hits to 6195 proteins in 1270 species: Archae - 226; Bacteria - 4362; Metazoa - 666; Fungi - 272; Plants - 126; Viruses - 0; Other Eukaryotes - 742 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT4G11720.1 | protein_coding | 4:7063255-7066878 | -19.1227 | 266 | 298 | 2048 | 2016 | hapless 2 Encodes HAP2 with the following predicted motifs: an N-terminal secretion signal, a single transmembrane domain and a C-terminal histidine-rich domain. HAP2 is expressed only in the haploid sperm and is required for pollen tube guidance and fertilization. Predominantly localized to sperm endoplasmic reticulum membranes. May also reside in other endomembranes, including the plasma membrane. Target promoter of the male germline-specific transcription factor DUO1. HAPLESS 2 (HAP2);CONTAINS InterPro DOMAIN/s: Generative cell specific-1, HAP2-GCS1 (InterPro:IPR018928); Has 2122 Blast hits to 1565 proteins in 270 species: Archae - 6; Bacteria - 421; Metazoa - 806; Fungi - 82; Plants - 227; Viruses - 5; Other Eukaryotes - 575 (source: NCBI BLink). | ||
| XLOC_013016 | Ch2:18460464-18461201 | AT5G17080.1 | protein_coding | 5:5619594-5620949 | -19.222 | 139 | 207 | 61 | 1 | Cysteine proteinases superfamily protein Cysteine proteinases superfamily protein;FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_componentunknown; EXPRESSED IN: embryo, seed; EXPRESSED DURING: F mature embryo stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Peptidase C1A, papain C-terminal (InterPro:IPR000668); Cysteine proteinases superfamily protein (TAIR:AT5G17140.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT3G53280.1 | protein_coding | 3:19755689-19757613 | -19.2502 | 209 | 261 | 1465 | 1413 | cytochrome p450 71b5 cytochrome P450 monooxygenase cytochrome p450 71b5 (CYP71B5);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, conserved site (InterPro:IPR017972); cytochrome P450, family 71, subfamily B, polypeptide 38 (TAIR:AT3G44250.1); Has 33134 Blast hits to 32894 proteins in 1695 species: Archae - 47; Bacteria - 3311; Metazoa - 12038; Fungi - 6892; Plants - 9686; Viruses - 3; Other Eukaryotes - 1157 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT3G51870.1 | protein_coding | 3:19243902-19246936 | -19.2523 | 610 | 680 | 108 | 46 | Mitochondrial substrate carrier family proteinMitochondrial substrate carrier family protein;FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, response to nematode; LOCATED IN: mitochondrial inner membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); thylakoid ATP/ADP carrier (TAIR:AT5G01500.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_022789 | Ch4:10093250-10095083 | AT1G75990.1 | protein_coding | 1:28524404-28526848 | -19.2885 | 1018 | 1067 | 1477 | 1429 | PAM domain (PCI/PINT associated module) protein PAM domain (PCI/PINT associated module) protein;FUNCTIONS IN: enzyme regulator activity; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome complex, plasma membrane, proteasome regulatory particle, lid subcomplex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Proteasome component (PCI) domain (InterPro:IPR000717), PCI/PINT associated module (InterPro:IPR013143), 26S proteasome regulatory subunit, C-terminal (InterPro:IPR013586); PAM domain (PCI/PINT associated module) protein (TAIR:AT1G20200.1); Has 740 Blast hits to 739 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 313; Fungi - 146; Plants - 168; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT4G11380.2 | protein_coding | 4:6919817-6925969 | -19.2953 | 1425 | 1459 | 40 | 10 | Adaptin family proteinAdaptin family protein;FUNCTIONS IN: protein transporter activity, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); Adaptin family protein (TAIR:AT4G23460.1). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT2G07020.1 | protein_coding | 2:2908473-2911198 | -19.2959 | 671 | 694 | 507 | 471 | Protein kinase protein with adenine nucleotide alpha hydrolases-like domain Protein kinase protein with adenine nucleotide alpha hydrolases-like domain;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: pollen tube growth; EXPRESSED IN: pollen tube; EXPRESSED DURING: M germinated pollen stage;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); Protein kinase protein with adenine nucleotide alpha hydrolases-like domain (TAIR:AT5G35380.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G25700.1 | protein_coding | 3:9358719-9360582 | -19.3192 | 598 | 647 | 261 | 221 | Eukaryotic aspartyl protease family protein Eukaryotic aspartyl protease family protein;FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis;CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); Eukaryotic aspartyl protease family protein (TAIR:AT2G42980.1); Has 2947 Blast hits to 2928 proteins in 232 species: Archae - 0; Bacteria - 0; Metazoa - 679; Fungi - 106; Plants - 1964; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT1G54470.2 | protein_coding | 1:20344698-20348097 | -19.3632 | 403 | 462 | 1257 | 1209 | RNI-like superfamily protein Encodes a Cf-like gene in Arabidopsis that confers downy mildew resistance to several isolates of Peronospora parasitica. resistance to Peronospora parasitica 27 (RPP27); LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 21 (TAIR:AT2G25470.1). | ||
| XLOC_017765 | Ch3:9570313-9572031 | AT3G48310.1 | protein_coding | 3:17887996-17889942 | -19.38 | 431 | 455 | 1265 | 1241 | cytochrome P450, family 71, subfamily A, polypeptide 22 putative cytochrome P450 "cytochrome P450, family 71, subfamily A, polypeptide 22" (CYP71A22);FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 71, subfamily A, polypeptide 21 (TAIR:AT3G48320.1); Has 32713 Blast hits to 32486 proteins in 1636 species: Archae - 45; Bacteria - 3163; Metazoa - 11763; Fungi - 7101; Plants - 9557; Viruses - 3; Other Eukaryotes - 1081 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G13227.1 | protein_coding | 3:4257882-4258648 | -19.3979 | 266 | 321 | 67 | 0 | serine-rich protein-related serine-rich protein-related; serine-rich protein-related (TAIR:AT5G55980.1); Has 173 Blast hits to 173 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_031121 | Ch5:10933765-10934769 | AT4G32760.2 | protein_coding | 4:15799077-15804199 | -19.4236 | 917 | 960 | 2420 | 2368 | ENTH/VHS/GAT family protein ENTH/VHS/GAT family protein;FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); ENTH/VHS/GAT family protein (TAIR:AT3G08790.1). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT1G05490.1 | protein_coding | 1:1618504-1623489 | -19.4368 | 171 | 204 | 3434 | 3407 | chromatin remodeling 31 chromatin remodeling 31 (chr31);FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; INVOLVED IN: biological_processunknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); chromatin remodeling 40 (TAIR:AT3G24340.1); Has 38115 Blast hits to 26256 proteins in 2107 species: Archae - 207; Bacteria - 10267; Metazoa - 11226; Fungi - 5719; Plants - 1929; Viruses - 244; Other Eukaryotes - 8523 (source: NCBI BLink). | ||
| XLOC_011023 | Ch2:2893864-2896523 | AT4G36870.1 | protein_coding | 4:17368915-17374011 | -19.447 | 176 | 200 | 1177 | 1155 | BEL1-like homeodomain 2 Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. BEL1-like homeodomain 2 (BLH2);CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), POX (InterPro:IPR006563), Homeodomain-related (InterPro:IPR012287); BEL1-like homeodomain 4 (TAIR:AT2G23760.3); Has 5744 Blast hits to 5713 proteins in 356 species: Archae - 0; Bacteria - 3; Metazoa - 2532; Fungi - 390; Plants - 2517; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G55530.1 | protein_coding | 1:20729125-20731356 | -19.4773 | 261 | 291 | 1254 | 1227 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); RING/U-box superfamily protein (TAIR:AT3G13430.3); Has 11045 Blast hits to 10950 proteins in 292 species: Archae - 0; Bacteria - 8; Metazoa - 3210; Fungi - 1082; Plants - 5106; Viruses - 41; Other Eukaryotes - 1598 (source: NCBI BLink). | ||
| XLOC_025629 | Ch5:10615185-10617881 | AT5G19320.1 | protein_coding | 5:6505092-6507645 | -19.5219 | 129 | 181 | 1753 | 1693 | RAN GTPase activating protein 2 Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. RAN GTPase activating protein 2 (RANGAP2);FUNCTIONS IN: RAN GTPase activator activity; INVOLVED IN: response to salt stress, nucleocytoplasmic transport; LOCATED IN: nuclear envelope, endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; RAN GTPase activating protein 1 (TAIR:AT3G63130.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT1G49860.1 | protein_coding | 1:18458526-18459969 | -19.5292 | 475 | 511 | 200 | 167 | glutathione S-transferase (class phi) 14Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). glutathione S-transferase (class phi) 14 (GSTF14);CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); glutathione S-transferase phi 8 (TAIR:AT2G47730.1); Has 13689 Blast hits to 13671 proteins in 1440 species: Archae - 0; Bacteria - 7396; Metazoa - 2236; Fungi - 608; Plants - 1504; Viruses - 0; Other Eukaryotes - 1945 (source: NCBI BLink). | ||
| XLOC_003925 | Ch1:28787818-28789937 | AT3G49210.1 | protein_coding | 3:18238044-18241524 | -19.5643 | 449 | 485 | 535 | 501 | O-acyltransferase (WSD1-like) family protein O-acyltransferase (WSD1-like) family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: O-acyltransferase, WSD1, C-terminal (InterPro:IPR009721), O-acyltransferase, WSD1, N-terminal (InterPro:IPR004255); O-acyltransferase (WSD1-like) family protein (TAIR:AT3G49200.1); Has 1044 Blast hits to 1032 proteins in 166 species: Archae - 2; Bacteria - 797; Metazoa - 8; Fungi - 0; Plants - 224; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT4G38000.1 | protein_coding | 4:17858351-17859325 | -19.584 | 788 | 813 | 412 | 379 | DNA binding with one finger 4.7 DNA binding with one finger 4.7 (DOF4.7);CONTAINS InterPro DOMAIN/s: Zinc finger, Dof-type (InterPro:IPR003851); DOF zinc finger protein 1 (TAIR:AT1G51700.1); Has 1084 Blast hits to 1079 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1079; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | ||
| XLOC_024098 | Ch4:16891225-16892077 | AT3G16170.1 | protein_coding | 3:5475855-5480349 | -19.5934 | 351 | 381 | 1640 | 1610 | AMP-dependent synthetase and ligase family protein AMP-dependent synthetase and ligase family protein;FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: metabolic process; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); AMP-dependent synthetase and ligase family protein (TAIR:AT3G48990.1); Has 81919 Blast hits to 74550 proteins in 3809 species: Archae - 1169; Bacteria - 53765; Metazoa - 3235; Fungi - 4485; Plants - 2227; Viruses - 1; Other Eukaryotes - 17037 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT5G44120.3 | protein_coding | 5:17756238-17758336 | -19.6279 | 231 | 258 | 878 | 845 | RmlC-like cupins superfamily protein Encodes a 12S seed storage protein. The Landsberg erecta genomeCONTAINS another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. CRUCIFERINA (CRA1);FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: response to abscisic acid stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell, seed; EXPRESSED DURING: seedling growth, seed development stages;CONTAINS InterPro DOMAIN/s: 11-S seed storage protein, conserved site (InterPro:IPR022379), Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S seed storage protein, plant (InterPro:IPR006044); cruciferin 2 (TAIR:AT1G03880.1); Has 1047 Blast hits to 1009 proteins in 168 species: Archae - 0; Bacteria - 115; Metazoa - 2; Fungi - 0; Plants - 930; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_001726 | Ch1:10966845-10968845 | AT5G54830.1 | protein_coding | 5:22272989-22276346 | -19.6433 | 472 | 507 | 455 | 424 | DOMON domain-containing protein / dopamine beta-monooxygenase N-terminal domain-containing protein DOMON domain-containing protein / dopamine beta-monooxygenase N-terminal domain-containing protein;FUNCTIONS IN: dopamine beta-monooxygenase activity, monooxygenase activity; INVOLVED IN: histidine catabolic process, metabolic process; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages;CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Electron transfer DM13 (InterPro:IPR019545), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593), DOMON (InterPro:IPR013050); Cytochrome b561/ferric reductase transmembrane with DOMON related domain (TAIR:AT3G61750.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT1G28170.1 | protein_coding | 1:9841269-9842435 | -19.6679 | 235 | 286 | 787 | 746 | sulphotransferase 7 sulphotransferase 7 (SOT7);FUNCTIONS IN: sulfotransferase activity; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown;CONTAINS InterPro DOMAIN/s: Sulfotransferase domain (InterPro:IPR000863); P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT3G45070.1); Has 2760 Blast hits to 2722 proteins in 189 species: Archae - 0; Bacteria - 204; Metazoa - 1687; Fungi - 1; Plants - 539; Viruses - 0; Other Eukaryotes - 329 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT3G55100.1 | protein_coding | 3:20420279-20423114 | -19.678 | 658 | 708 | 1411 | 1355 | ABC-2 type transporter family protein ABC-2 type transporter family protein;FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: petal, leaf whorl, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); white-brown complex homolog 19 (TAIR:AT3G55130.1); Has 392721 Blast hits to 356813 proteins in 4114 species: Archae - 7219; Bacteria - 309703; Metazoa - 8988; Fungi - 6487; Plants - 5627; Viruses - 12; Other Eukaryotes - 54685 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT1G53270.1 | protein_coding | 1:19862821-19864650 | -19.7094 | 275 | 293 | 540 | 522 | ABC-2 type transporter family protein ABC-2 type transporter family protein;FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); ABC-2 type transporter family protein (TAIR:AT2G13610.1); Has 412109 Blast hits to 371848 proteins in 4161 species: Archae - 7411; Bacteria - 324065; Metazoa - 9151; Fungi - 7073; Plants - 5804; Viruses - 6; Other Eukaryotes - 58599 (source: NCBI BLink). | ||
| XLOC_019408 | Ch3:15426764-15427680 | AT4G20650.1 | protein_coding | 4:11090758-11091761 | -19.7401 | 449 | 481 | 1218 | 1183 | receptor-like protein kinase-related receptor-like protein kinase-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF26 (InterPro:IPR002902), Protein ofunknown function DUF1204 (InterPro:IPR009596); Protein with domains ofunknown function (DUF26 and DUF1204) (TAIR:AT4G20630.1); Has 1323 Blast hits to 1300 proteins in 55 species: Archae - 8; Bacteria - 25; Metazoa - 41; Fungi - 8; Plants - 1236; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G32240.1 | protein_coding | 2:13684299-13691155 | -19.7474 | 262 | 291 | 302 | 276 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G05320.3); Has 470429 Blast hits to 168274 proteins in 4282 species: Archae - 6896; Bacteria - 131956; Metazoa - 175525; Fungi - 33166; Plants - 25441; Viruses - 2243; Other Eukaryotes - 95202 (source: NCBI BLink). | ||
| XLOC_031128 | Ch5:11731993-11732743 | AT1G59740.1 | protein_coding | 1:21967986-21972503 | -19.7633 | 620 | 653 | 57 | 24 | Major facilitator superfamily protein Major facilitator superfamily protein;FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages;CONTAINS InterPro DOMAIN/s: PTR2 family proton/oligopeptide symporter, conserved site (InterPro:IPR018456), Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Major facilitator superfamily protein (TAIR:AT1G33440.1); Has 6789 Blast hits to 6649 proteins in 1324 species: Archae - 0; Bacteria - 3372; Metazoa - 487; Fungi - 362; Plants - 2181; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink). | ||
| XLOC_006844 | Ch1:21150376-21151505 | AT5G47740.2 | protein_coding | 5:19338511-19339775 | -19.7933 | 209 | 243 | 274 | 242 | Adenine nucleotide alpha hydrolases-like superfamily protein Adenine nucleotide alpha hydrolases-like superfamily protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to stress; LOCATED IN: cellular_componentunknown; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016); U-box domain-containing protein kinase family protein (TAIR:AT2G45910.1). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT2G18360.1 | protein_coding | 2:7976700-7979430 | -19.8115 | 638 | 678 | 128 | 78 | alpha/beta-Hydrolases superfamily proteinalpha/beta-Hydrolases superfamily protein;FUNCTIONS IN: hydrolase activity; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, hypocotyl, root, leaf;CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); alpha/beta-Hydrolases superfamily protein (TAIR:AT4G36610.1); Has 8797 Blast hits to 8792 proteins in 1517 species: Archae - 89; Bacteria - 6094; Metazoa - 449; Fungi - 67; Plants - 445; Viruses - 0; Other Eukaryotes - 1653 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT4G30200.2 | protein_coding | 4:14786532-14790501 | -19.8147 | 743 | 785 | 111 | 79 | vernalization5/VIN3-likeEncodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. vernalization5/VIN3-like (VEL1);CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1423, plant (InterPro:IPR004082), Fibronectin, type III-like fold (InterPro:IPR008957), Fibronectin, type III (InterPro:IPR003961); Fibronectin type III domain-containing protein (TAIR:AT5G57380.1); Has 283 Blast hits to 258 proteins in 40 species: Archae - 0; Bacteria - 10; Metazoa - 3; Fungi - 23; Plants - 240; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT5G53130.1 | protein_coding | 5:21537721-21541029 | -19.8622 | 432 | 471 | 1662 | 1627 | cyclic nucleotide gated channel 1 member of Cyclic nucleotide gated channel family cyclic nucleotide gated channel 1 (CNGC1);FUNCTIONS IN: inward rectifier potassium channel activity, cyclic nucleotide binding, intracellular cyclic nucleotide activated cation channel activity, calmodulin binding, cation channel activity; INVOLVED IN: potassium ion transport, calcium ion transport; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Ion transport (InterPro:IPR005821), Cyclic nucleotide-binding-like (InterPro:IPR018490), RmlC-like jelly roll fold (InterPro:IPR014710); cyclic nucleotide-gated channel 13 (TAIR:AT4G01010.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT5G58880.1 | protein_coding | 5:23775891-23779855 | -19.882 | 571 | 609 | 3011 | 2983 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G29620.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G01650.1 | protein_coding | 3:241739-245284 | -19.9596 | 741 | 781 | 37 | 1 | RING domain ligase1Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. RING domain ligase1 (RGLG1);FUNCTIONS IN: zinc ion binding; INVOLVED IN: N-terminal protein myristoylation, cytokinin metabolic process, auxin metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); RING domain ligase2 (TAIR:AT5G14420.2); Has 24426 Blast hits to 13505 proteins in 916 species: Archae - 24; Bacteria - 3147; Metazoa - 7235; Fungi - 3380; Plants - 4548; Viruses - 743; Other Eukaryotes - 5349 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT4G28480.1 | protein_coding | 4:14073008-14075271 | -20.0196 | 261 | 296 | 274 | 233 | DNAJ heat shock family proteinDNAJ heat shock family protein;FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 28075 Blast hits to 27586 proteins in 3414 species: Archae - 196; Bacteria - 10500; Metazoa - 4718; Fungi - 2638; Plants - 2903; Viruses - 17; Other Eukaryotes - 7103 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G09930.1 | protein_coding | 3:3053237-3055510 | -20.0345 | 544 | 572 | 579 | 551 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: petal, leaf whorl, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT5G03610.1); Has 3152 Blast hits to 3125 proteins in 151 species: Archae - 0; Bacteria - 220; Metazoa - 0; Fungi - 3; Plants - 2916; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). | ||
| XLOC_008425 | Ch2:1391923-1393064 | AT2G31590.1 | protein_coding | 2:13446829-13448133 | -20.0986 | 213 | 268 | 713 | 657 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G04730.1); Has 30 Blast hits to 30 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_001726 | Ch1:10966845-10968845 | AT5G20050.1 | protein_coding | 5:6774102-6775935 | -20.162 | 1819 | 1862 | 701 | 658 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); S-domain-2 5 (TAIR:AT4G32300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_011690 | Ch2:9927709-9929531 | ATMG00820.1 | protein_coding | M:228573-229085 | -20.1889 | 1277 | 1330 | 458 | 405 | Reverse transcriptase (RNA-dependent DNA polymerase) Reverse transcriptase (RNA-dependent DNA polymerase);CONTAINS InterPro DOMAIN/s: Reverse transcriptase, RNA-dependent DNA polymerase (InterPro:IPR013103); cysteine-rich RLK (RECEPTOR-like protein kinase) 8 (TAIR:AT4G23160.1). | ||
| XLOC_024070 | Ch4:3092474-3093625 | AT2G18420.1 | protein_coding | 2:7993801-7994554 | -20.2124 | 465 | 534 | 128 | 80 | Gibberellin-regulated family protein Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein Gibberellin-regulated family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); GAST1 protein homolog 1 (TAIR:AT1G75750.1); Has 468 Blast hits to 468 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 468; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT3G62100.1 | protein_coding | 3:22995686-22996809 | -20.2127 | 276 | 341 | 62 | 10 | indole-3-acetic acid inducible 30 Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. indole-3-acetic acid inducible 30 (IAA30);FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: gravitropism, response to auxin stimulus, response to cyclopentenone, somatic embryogenesis, root development; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Aux/IAA-ARF-dimerisation (InterPro:IPR011525), AUX/IAA protein (InterPro:IPR003311); indole-3-acetic acid inducible 20 (TAIR:AT2G46990.1); Has 1798 Blast hits to 1798 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1797; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT3G56600.1 | protein_coding | 3:20968444-20971021 | -20.2294 | 301 | 346 | 93 | 47 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: biological_processunknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403); phosphoinositide 4-kinase gamma 1 (TAIR:AT2G40850.1); Has 560 Blast hits to 550 proteins in 149 species: Archae - 0; Bacteria - 2; Metazoa - 131; Fungi - 73; Plants - 265; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). | ||
| XLOC_013209 | Ch2:5715100-5715636 | AT1G34520.1 | protein_coding | 1:12623434-12624508 | -20.2421 | 256 | 286 | 203 | 169 | MBOAT (membrane bound O-acyl transferase) family protein MBOAT (membrane bound O-acyl transferase) family protein;CONTAINS InterPro DOMAIN/s: Wax synthase (InterPro:IPR017088); MBOAT (membrane bound O-acyl transferase) family protein (TAIR:AT1G34490.1); Has 1089 Blast hits to 1085 proteins in 421 species: Archae - 0; Bacteria - 800; Metazoa - 0; Fungi - 8; Plants - 227; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G64460.2 | protein_coding | 5:25772848-25775635 | -20.2824 | 620 | 676 | 61 | 11 | Phosphoglycerate mutase family proteinPhosphoglycerate mutase family protein;CONTAINS InterPro DOMAIN/s: Histidine phosphatase superfamily, clade-1 (InterPro:IPR013078); Phosphoglycerate mutase family protein (TAIR:AT1G58280.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_012215 | Ch2:13505539-13507058 | AT4G31351.1 | protein_coding | 4:15217257-15217884 | -20.3405 | 35 | 70 | 197 | 162 | This gene encodes a small protein and has either evidence of transcription or purifying selection.unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G31354.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_013837 | Ch3:3867698-3868357 | AT2G44470.3 | protein_coding | 2:18354186-18358679 | -20.3821 | 260 | 296 | 1767 | 1728 | beta glucosidase 29 beta glucosidase 29 (BGLU29);FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); beta glucosidase 28 (TAIR:AT2G44460.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT1G51190.1 | protein_coding | 1:18977176-18980618 | -20.3945 | 703 | 775 | 1571 | 1494 | Integrase-type DNA-binding superfamily protein Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. PLETHORA 2 (PLT2);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); Integrase-type DNA-binding superfamily protein (TAIR:AT3G20840.1); Has 7787 Blast hits to 5250 proteins in 253 species: Archae - 0; Bacteria - 8; Metazoa - 4; Fungi - 0; Plants - 7694; Viruses - 2; Other Eukaryotes - 79 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT2G21560.1 | protein_coding | 2:9230208-9231580 | -20.5353 | 236 | 282 | 752 | 704 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT4G39190.1); Has 3685 Blast hits to 2305 proteins in 270 species: Archae - 0; Bacteria - 156; Metazoa - 1145; Fungi - 322; Plants - 177; Viruses - 6; Other Eukaryotes - 1879 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT5G58040.1 | protein_coding | 5:23488745-23494259 | -20.5389 | 1433 | 1459 | 60 | 34 | homolog of yeast FIP1 [V] Encodes a subunit of the polyadenylation apparatus that interacts with and stimulates the activity of poly(A) polymerase. Additionally , it interacts with several polyadenylation factor subunits and is an RNA-binding protein. It is suggested that this protein coordinates a number of polyadenylation factor subunits with PAP and with RNA. homolog of yeast FIP1 [V] (FIP1[V]);FUNCTIONS IN: protein binding, RNA binding; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Fip1 (InterPro:IPR007854); fip1 motif-containing protein (TAIR:AT3G66652.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024093 | Ch4:6209483-6211439 | AT1G78420.1 | protein_coding | 1:29504532-29507680 | -20.7959 | 1435 | 1459 | 38 | 14 | RING/U-box superfamily proteinRING/U-box superfamily protein;FUNCTIONS IN: zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); RING/U-box superfamily protein (TAIR:AT1G17145.1); Has 267 Blast hits to 267 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 154; Plants - 74; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G17010.1 | protein_coding | 3:5800272-5802468 | -20.8247 | 227 | 285 | 574 | 527 | AP2/B3-like transcriptional factor family protein transcriptional factor B3 family protein,CONTAINS Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary. AP2/B3-like transcriptional factor family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); VERDANDI (TAIR:AT5G18000.1); Has 398 Blast hits to 368 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 378; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | ||
| XLOC_018021 | Ch3:11751847-11757079 | AT3G22250.1 | protein_coding | 3:7867753-7870229 | -20.8551 | 785 | 836 | 1366 | 1323 | UDP-Glycosyltransferase superfamily protein UDP-Glycosyltransferase superfamily protein;FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; EXPRESSED IN: pedicel; EXPRESSED DURING: 4 anthesis;CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT1G22400.1); Has 6488 Blast hits to 6427 proteins in 402 species: Archae - 0; Bacteria - 208; Metazoa - 1301; Fungi - 24; Plants - 4818; Viruses - 90; Other Eukaryotes - 47 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT5G64750.1 | protein_coding | 5:25891449-25893888 | -20.8596 | 740 | 783 | 65 | 8 | Integrase-type DNA-binding superfamily protein Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. ABA REPRESSOR1 (ABR1);CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); Integrase-type DNA-binding superfamily protein (TAIR:AT5G61890.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_022789 | Ch4:10093250-10095083 | AT4G23850.1 | protein_coding | 4:12403454-12408421 | -21.0071 | 1017 | 1084 | 68 | 18 | AMP-dependent synthetase and ligase family protein long-chain acyl-CoA synthetase 4 (LACS4);FUNCTIONS IN: catalytic activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: AMP-binding, conserved site (InterPro:IPR020845), AMP-dependent synthetase/ligase (InterPro:IPR000873); AMP-dependent synthetase and ligase family protein (TAIR:AT4G11030.1); Has 52797 Blast hits to 49694 proteins in 3271 species: Archae - 966; Bacteria - 33480; Metazoa - 2301; Fungi - 1946; Plants - 2035; Viruses - 1; Other Eukaryotes - 12068 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT5G25550.1 | protein_coding | 5:8893989-8895914 | -21.133 | 180 | 239 | 1176 | 1123 | Leucine-rich repeat (LRR) family protein Leucine-rich repeat (LRR) family protein;FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: petal, leaf whorl, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); Leucine-rich repeat (LRR) family protein (TAIR:AT3G24480.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_020392 | Ch4:9665049-9666099 | AT4G21610.1 | protein_coding | 4:11488976-11490423 | -21.1532 | 0 | 22 | 260 | 238 | lsd one like 2 CONTAINS the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of whichCONTAINS an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains.lsd one like 2 (LOL2);CONTAINS InterPro DOMAIN/s: Zinc finger, LSD1-type (InterPro:IPR005735); lsd one like 1 (TAIR:AT1G32540.1); Has 291 Blast hits to 191 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 255; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT2G29995.1 | protein_coding | 2:12796503-12799441 | -21.1638 | 235 | 277 | 80 | 37 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G07175.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G25680.1 | protein_coding | 2:10933005-10934604 | -21.1979 | 372 | 419 | 1086 | 1045 | molybdate transporter 1 Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. molybdate transporter 1 (MOT1);FUNCTIONS IN: molybdate ion transmembrane transporter activity, sulfate transmembrane transporter activity; INVOLVED IN: molybdate ion transport; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; sulfate transmembrane transporters (TAIR:AT1G80310.1); Has 761 Blast hits to 750 proteins in 291 species: Archae - 26; Bacteria - 503; Metazoa - 6; Fungi - 58; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G06750.1 | protein_coding | 3:2129551-2130451 | -21.258 | 615 | 670 | 62 | 7 | hydroxyproline-rich glycoprotein family protein hydroxyproline-rich glycoprotein family protein; Has 6317 Blast hits to 3436 proteins in 319 species: Archae - 0; Bacteria - 429; Metazoa - 2195; Fungi - 739; Plants - 2175; Viruses - 83; Other Eukaryotes - 696 (source: NCBI BLink). | ||
| XLOC_019408 | Ch3:15426764-15427680 | AT4G20700.1 | protein_coding | 4:11097843-11100408 | -21.2671 | 431 | 499 | 1354 | 1290 | Protein ofunknown function (DUF1204)CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF1204 (InterPro:IPR009596); RNA binding;RNA-directed DNA polymerases (TAIR:AT4G20520.1); Has 137 Blast hits to 137 proteins in 35 species: Archae - 8; Bacteria - 23; Metazoa - 36; Fungi - 6; Plants - 62; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G15340.1 | protein_coding | 3:5159698-5162945 | -21.433 | 229 | 292 | 1697 | 1635 | proton pump interactor 2Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. proton pump interactor 2 (PPI2); INVOLVED IN: regulation of proton transport; LOCATED IN: cellular_componentunknown; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G36690.1); Has 26949 Blast hits to 17849 proteins in 1448 species: Archae - 129; Bacteria - 3780; Metazoa - 11316; Fungi - 2383; Plants - 1083; Viruses - 91; Other Eukaryotes - 8167 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G27690.1 | protein_coding | 2:11809279-11811280 | -21.5877 | 610 | 672 | 153 | 85 | cytochrome P450, family 94, subfamily C, polypeptide 1 Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. "cytochrome P450, family 94, subfamily C, polypeptide 1" (CYP94C1);CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401); cytochrome P450, family 94, subfamily B, polypeptide 3 (TAIR:AT3G48520.1); Has 28009 Blast hits to 27927 proteins in 1460 species: Archae - 46; Bacteria - 2607; Metazoa - 10748; Fungi - 6059; Plants - 7560; Viruses - 3; Other Eukaryotes - 986 (source: NCBI BLink). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT2G44470.3 | protein_coding | 2:18354186-18358679 | -21.6379 | 573 | 643 | 1165 | 1097 | beta glucosidase 29 beta glucosidase 29 (BGLU29);FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); beta glucosidase 28 (TAIR:AT2G44460.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_012606 | Ch2:16025441-16028648 | AT4G04960.1 | protein_coding | 4:2532906-2535386 | -21.7044 | 1106 | 1160 | 1025 | 946 | Concanavalin A-like lectin protein kinase family protein Concanavalin A-like lectin protein kinase family protein;FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages;CONTAINS InterPro DOMAIN/s: Legume lectin, beta chain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); Concanavalin A-like lectin protein kinase family protein (TAIR:AT4G28350.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G26910.2 | protein_coding | 3:9914959-9918810 | -21.8491 | 729 | 772 | 119 | 72 | hydroxyproline-rich glycoprotein family protein hydroxyproline-rich glycoprotein family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G41100.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_013202 | Ch2:3641880-3642687 | AT3G05310.1 | protein_coding | 3:1510160-1513301 | -21.9164 | 134 | 175 | 1929 | 1893 | MIRO-related GTP-ase 3 Encodes a protein with similarity to MIRO GTPases. MIRO-related GTP-ase 3 (MIRO3);FUNCTIONS IN: GTP binding; INVOLVED IN: mitochondrion transport along microtubule, small GTPase mediated signal transduction; LOCATED IN: mitochondrial outer membrane, intracellular; EXPRESSED IN: central cell;CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF hand associated, type-1 (InterPro:IPR013566), Mitochondrial Rho-like (InterPro:IPR013684), EF hand associated, type-2 (InterPro:IPR013567), Mitochondrial Rho GTPase (InterPro:IPR021181), EF-HAND 2 (InterPro:IPR018249), MIRO (InterPro:IPR020860); MIRO-related GTP-ase 1 (TAIR:AT5G27540.2); Has 1943 Blast hits to 1932 proteins in 256 species: Archae - 0; Bacteria - 18; Metazoa - 950; Fungi - 261; Plants - 517; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink). | ||
| XLOC_031123 | Ch5:11401121-11401714 | AT2G32610.1 | protein_coding | 2:13836117-13839640 | -21.965 | 263 | 327 | 754 | 704 | cellulose synthase-like B1 encodes a gene similar to cellulose synthase cellulose synthase-like B1 (CSLB01);FUNCTIONS IN: cellulose synthase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: cellulose biosynthetic process, polysaccharide biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: root;CONTAINS InterPro DOMAIN/s: Cellulose synthase (InterPro:IPR005150); cellulose synthase-like B3 (TAIR:AT2G32530.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_012215 | Ch2:13505539-13507058 | AT2G46860.1 | protein_coding | 2:19253670-19255328 | -22.1468 | 1253 | 1295 | 838 | 790 | pyrophosphorylase 3Encodes a protein that might have inorganic pyrophosphatase activity. pyrophosphorylase 3 (PPa3);FUNCTIONS IN: inorganic diphosphatase activity, pyrophosphatase activity; INVOLVED IN: phosphate metabolic process, metabolic process; LOCATED IN: membrane, cytoplasm; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162); pyrophosphorylase 1 (TAIR:AT1G01050.1); Has 5975 Blast hits to 5975 proteins in 1836 species: Archae - 171; Bacteria - 4302; Metazoa - 246; Fungi - 260; Plants - 270; Viruses - 0; Other Eukaryotes - 726 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT1G69600.1 | protein_coding | 1:26182156-26183546 | -22.261 | 210 | 307 | 400 | 327 | zinc finger homeodomain 1 Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. zinc finger homeodomain 1 (ZFHD1);CONTAINS InterPro DOMAIN/s: Homeobox domain, ZF-HD class (InterPro:IPR006455), ZF-HD homeobox protein, Cys/His-rich dimerisation domain (InterPro:IPR006456), Homeodomain-related (InterPro:IPR012287); homeobox protein 26 (TAIR:AT5G60480.1); Has 480 Blast hits to 471 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 480; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_024070 | Ch4:3092474-3093625 | AT1G05680.1 | protein_coding | 1:1703002-1704838 | -22.2665 | 998 | 1087 | 1325 | 1267 | Uridine diphosphate glycosyltransferase 74E2 Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. Uridine diphosphate glycosyltransferase 74E2 (UGT74E2);CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); UDP-Glycosyltransferase superfamily protein (TAIR:AT1G05675.1); Has 8397 Blast hits to 8309 proteins in 513 species: Archae - 0; Bacteria - 605; Metazoa - 2499; Fungi - 31; Plants - 5061; Viruses - 123; Other Eukaryotes - 78 (source: NCBI BLink). | ||
| XLOC_013209 | Ch2:5715100-5715636 | AT1G34490.1 | protein_coding | 1:12609440-12610495 | -22.5787 | 238 | 286 | 213 | 169 | MBOAT (membrane bound O-acyl transferase) family protein MBOAT (membrane bound O-acyl transferase) family protein;CONTAINS InterPro DOMAIN/s: Wax synthase (InterPro:IPR017088); MBOAT (membrane bound O-acyl transferase) family protein (TAIR:AT1G34520.1); Has 686 Blast hits to 678 proteins in 232 species: Archae - 0; Bacteria - 388; Metazoa - 0; Fungi - 39; Plants - 230; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT3G53930.2 | protein_coding | 3:19966149-19970880 | -22.6604 | 744 | 784 | 52 | 14 | Protein kinase superfamily protein Protein kinase superfamily protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase, putative (InterPro:IPR020655), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); Protein kinase superfamily protein (TAIR:AT2G37840.1); Has 133875 Blast hits to 131243 proteins in 4644 species: Archae - 156; Bacteria - 15368; Metazoa - 49842; Fungi - 12879; Plants - 32788; Viruses - 546; Other Eukaryotes - 22296 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT5G63090.2 | protein_coding | 5:25308516-25311019 | -22.9082 | 597 | 652 | 61 | 14 | Lateral organ boundaries (LOB) domain family protein Involved in lateral organ development LATERAL ORGAN BOUNDARIES (LOB);CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); LOB domain-containing protein 25 (TAIR:AT3G27650.1); Has 986 Blast hits to 981 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 986; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019387 | Ch3:11428472-11429170 | AT4G33880.1 | protein_coding | 4:16239363-16241169 | -22.9248 | 548 | 653 | 756 | 659 | ROOT HAIR DEFECTIVE 6-LIKE 2 RSL2 was expressed concurrently with RSL4 and its expression was controlled by RHD6 and RSL1. Required for root-hair growth. ROOT HAIR DEFECTIVE 6-LIKE 2 (RSL2);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: root hair initiation, response to auxin stimulus, cell growth, regulation of transcription; LOCATED IN: nucleus;CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G14760.1); Has 3067 Blast hits to 2987 proteins in 166 species: Archae - 0; Bacteria - 15; Metazoa - 165; Fungi - 32; Plants - 2687; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). | ||
| XLOC_013199 | Ch2:2384422-2385073 | AT3G23350.1 | protein_coding | 3:8354077-8355410 | -22.9328 | 217 | 292 | 607 | 529 | ENTH/VHS family protein ENTH/VHS family protein;CONTAINS InterPro DOMAIN/s: Epsin, N-terminal (InterPro:IPR001026), Epsin-like, N-terminal (InterPro:IPR013809), ENTH/VHS (InterPro:IPR008942); ENTH/VHS family protein (TAIR:AT3G46540.1); Has 1024 Blast hits to 1024 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 583; Fungi - 200; Plants - 173; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT3G27809.1 | protein_coding | 3:10307417-10308403 | -23.0004 | 215 | 257 | 399 | 341 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT1G12665.1 | protein_coding | 1:4312331-4312935 | -23.0281 | 583 | 632 | 324 | 269 | Encodes a Plant thionin family protein LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G12663.1); Has 1554 Blast hits to 382 proteins in 88 species: Archae - 6; Bacteria - 293; Metazoa - 49; Fungi - 201; Plants - 321; Viruses - 145; Other Eukaryotes - 539 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT1G16130.1 | protein_coding | 1:5525293-5528212 | -23.051 | 500 | 558 | 1523 | 1474 | wall associated kinase-like 2 wall-associated kinase likewall associated kinase-like 2 (WAKL2);FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: integral to membrane; EXPRESSED IN: stem, cotyledon, leaf whorl, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible, LP.12 twelve leaves visible;CONTAINS InterPro DOMAIN/s: Wall-associated kinase (InterPro:IPR013695), EGF-like calcium-binding, conserved site (InterPro:IPR018097), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); wall associated kinase-like 4 (TAIR:AT1G16150.1); Has 122559 Blast hits to 120935 proteins in 4599 species: Archae - 125; Bacteria - 14250; Metazoa - 44921; Fungi - 10430; Plants - 34238; Viruses - 502; Other Eukaryotes - 18093 (source: NCBI BLink). | ||
| XLOC_019767 | Ch4:3840791-3842075 | AT3G44440.1 | protein_coding | 3:16070840-16071256 | -23.102 | 303 | 350 | 223 | 177 | unknown protein; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT1G24485.3 | protein_coding | 1:8678858-8681894 | -23.1935 | 483 | 529 | 1028 | 984 | FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system; protein kinase-related (TAIR:AT3G46280.1); Has 1310 Blast hits to 1260 proteins in 183 species: Archae - 0; Bacteria - 258; Metazoa - 162; Fungi - 42; Plants - 688; Viruses - 16; Other Eukaryotes - 144 (source: NCBI BLink). | ||
| XLOC_003925 | Ch1:28787818-28789937 | AT4G00005.1 | protein_coding | 4:1180-1536 | -23.422 | 456 | 527 | 177 | 83 | PRA1 (Prenylated rab acceptor) family protein PRA1 (Prenylated rab acceptor) family protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); prenylated RAB acceptor 1.B5 (TAIR:AT5G01640.1); Has 274 Blast hits to 274 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 272; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_031131 | Ch5:11802382-11803219 | AT2G16018.1 | protein_coding | 2:6972222-6973705 | -23.4722 | 579 | 634 | 587 | 542 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G42786.1 | protein_coding | 3:14876476-14877255 | -24.0796 | 230 | 277 | 779 | 731 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT3G09130.1); Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_019404 | Ch3:14408408-14409163 | AT2G29500.1 | protein_coding | 2:12633065-12634120 | -24.1226 | 265 | 397 | 461 | 355 | HSP20-like chaperones superfamily proteinHSP20-like chaperones superfamily protein;CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); HSP20-like chaperones superfamily protein (TAIR:AT1G07400.1); Has 6873 Blast hits to 6873 proteins in 1575 species: Archae - 184; Bacteria - 4083; Metazoa - 80; Fungi - 309; Plants - 1622; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink). | ||
| XLOC_001570 | Ch1:10056009-10056945 | AT1G28610.2 | protein_coding | 1:10053443-10055881 | -24.2108 | 432 | 493 | 886 | 824 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT2G27360.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT5G14420.1 | protein_coding | 5:4648081-4651442 | -24.3797 | 733 | 782 | 1763 | 1724 | RING domain ligase2Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. RING domain ligase2 (RGLG2);FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: N-terminal protein myristoylation, cytokinin metabolic process, auxin metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); RING domain ligase1 (TAIR:AT3G01650.1); Has 2368 Blast hits to 2301 proteins in 208 species: Archae - 0; Bacteria - 31; Metazoa - 1318; Fungi - 57; Plants - 528; Viruses - 55; Other Eukaryotes - 379 (source: NCBI BLink). | ||
| XLOC_031136 | Ch5:12134033-12135228 | AT3G53330.1 | protein_coding | 3:19772930-19773938 | -24.5226 | 672 | 730 | 538 | 460 | plastocyanin-like domain-containing protein plastocyanin-like domain-containing protein;FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 21717 Blast hits to 10031 proteins in 807 species: Archae - 52; Bacteria - 2924; Metazoa - 4901; Fungi - 2030; Plants - 8332; Viruses - 1129; Other Eukaryotes - 2349 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT3G62790.1 | protein_coding | 3:23223030-23224326 | -24.732 | 389 | 470 | 128 | 62 | NADH-ubiquinone oxidoreductase-relatedNADH-ubiquinone oxidoreductase-related;CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase, iron-sulphur subunit 5 (InterPro:IPR019342); NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 129 Blast hits to 129 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 62; Plants - 56; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT2G23300.1 | protein_coding | 2:9914246-9917427 | -24.9155 | 611 | 675 | 98 | 39 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT4G37250.1); Has 130463 Blast hits to 92142 proteins in 3849 species: Archae - 98; Bacteria - 10554; Metazoa - 34539; Fungi - 5704; Plants - 66254; Viruses - 237; Other Eukaryotes - 13077 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT5G32440.3 | protein_coding | 5:12076717-12078603 | -24.9521 | 604 | 677 | 271 | 205 | Ubiquitin system component Cue proteinUbiquitin system component Cue protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages;CONTAINS InterPro DOMAIN/s: Ubiquitin system component Cue (InterPro:IPR003892); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G80040.1). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT1G07476.1 | protein_coding | 1:2295553-2296497 | -25.0336 | 571 | 628 | 161 | 91 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G07473.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_024083 | Ch4:4009674-4009918 | AT2G08986.1 | protein_coding | 2:3618058-3626460 | -25.2513 | 69 | 121 | 3648 | 3593 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT1G40104.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_019394 | Ch3:12249462-12250360 | AT2G12900.1 | protein_coding | 2:5293897-5295480 | -25.3196 | 617 | 702 | 130 | 41 | Basic-leucine zipper (bZIP) transcription factor family protein Basic-leucine zipper (bZIP) transcription factor family protein;FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast;CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G12940.1); Has 1373 Blast hits to 1364 proteins in 175 species: Archae - 2; Bacteria - 73; Metazoa - 486; Fungi - 39; Plants - 637; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). | ||
| XLOC_029141 | Ch5:10789078-10790317 | AT2G32300.1 | protein_coding | 2:13722362-13723641 | -25.6135 | 731 | 786 | 630 | 567 | uclacyanin 1 Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. uclacyanin 1 (UCC1);FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972), Blue (type 1) copper domain (InterPro:IPR000923); Cupredoxin superfamily protein (TAIR:AT2G26720.1); Has 7686 Blast hits to 4254 proteins in 462 species: Archae - 22; Bacteria - 692; Metazoa - 1349; Fungi - 628; Plants - 1950; Viruses - 176; Other Eukaryotes - 2869 (source: NCBI BLink). | ||
| XLOC_009286 | Ch2:10267417-10270832 | AT2G32680.1 | protein_coding | 2:13859769-13862614 | -26.4368 | 230 | 282 | 2575 | 2523 | receptor like protein 23 receptor like protein 23 (RLP23);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 24 (TAIR:AT2G33020.1); Has 122044 Blast hits to 32861 proteins in 1177 species: Archae - 60; Bacteria - 10426; Metazoa - 30931; Fungi - 1442; Plants - 70180; Viruses - 48; Other Eukaryotes - 8957 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT5G35870.1 | protein_coding | 5:14020779-14021700 | -26.5104 | 532 | 571 | 265 | 217 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G04480.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT5G13760.1 | protein_coding | 5:4441858-4445014 | -26.7908 | 308 | 397 | 212 | 118 | Plasma-membrane choline transporter family protein Plasma-membrane choline transporter family protein;CONTAINS InterPro DOMAIN/s: Protein ofunknown function DUF580 (InterPro:IPR007603); Plasma-membrane choline transporter family protein (TAIR:AT3G04440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_008425 | Ch2:1391923-1393064 | AT2G24590.1 | protein_coding | 2:10449631-10451184 | -26.8934 | 224 | 270 | 359 | 316 | RNA recognition motif and CCHC-type zinc finger domains containing protein Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.RNA recognition motif and CCHC-type zinc finger domains containing protein;FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; LOCATED IN: nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); serine/arginine-rich 22 (TAIR:AT4G31580.2); Has 11952 Blast hits to 10510 proteins in 739 species: Archae - 6; Bacteria - 805; Metazoa - 6109; Fungi - 1395; Plants - 2528; Viruses - 91; Other Eukaryotes - 1018 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT1G01460.1 | protein_coding | 1:168559-171386 | -26.9048 | 480 | 567 | 1256 | 1181 | Phosphatidylinositol-4-phosphate 5-kinase, core Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. PIPK11;FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: cellular_componentunknown; EXPRESSED IN: sperm cell, sepal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis;CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); phosphatidylinositol phosphate kinase 10 (TAIR:AT4G01190.1); Has 2109 Blast hits to 1621 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 980; Fungi - 317; Plants - 416; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT5G24500.1 | protein_coding | 5:8367302-8368937 | -27.1262 | 393 | 461 | 599 | 527 | unknown protein; Has 133 Blast hits to 129 proteins in 40 species: Archae - 2; Bacteria - 0; Metazoa - 60; Fungi - 5; Plants - 29; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). | ||
| XLOC_010824 | Ch2:612785-614695 | AT4G35940.1 | protein_coding | 4:17021380-17024108 | -27.2399 | 516 | 573 | 227 | 159 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G17787.1); Has 45288 Blast hits to 24095 proteins in 1140 species: Archae - 93; Bacteria - 2895; Metazoa - 13424; Fungi - 2873; Plants - 1183; Viruses - 123; Other Eukaryotes - 24697 (source: NCBI BLink). | ||
| XLOC_005822 | Ch1:10389275-10391011 | AT1G70520.1 | protein_coding | 1:26584729-26587628 | -27.2704 | 585 | 656 | 1626 | 1555 | cysteine-rich RLK (RECEPTOR-like protein kinase) 2 Encodes a cysteine-rich receptor-like protein kinase. cysteine-rich RLK (RECEPTOR-like protein kinase) 2 (CRK2);FUNCTIONS IN: kinase activity; INVOLVED IN: response to ozone; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Protein ofunknown function DUF26 (InterPro:IPR002902), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); cysteine-rich RLK (RECEPTOR-like protein kinase) 42 (TAIR:AT5G40380.1); Has 123193 Blast hits to 121713 proteins in 4855 species: Archae - 110; Bacteria - 13886; Metazoa - 45515; Fungi - 10581; Plants - 34413; Viruses - 473; Other Eukaryotes - 18215 (source: NCBI BLink). | ||
| XLOC_019773 | Ch4:4309867-4311160 | AT1G64960.1 | protein_coding | 1:24129836-24134204 | -27.5711 | 265 | 332 | 3536 | 3473 | ARM repeat superfamily proteinARM repeat superfamily protein;FUNCTIONS IN: binding; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024071 | Ch4:3178719-3179585 | AT3G20930.1 | protein_coding | 3:7331662-7334485 | -28.2694 | 313 | 395 | 218 | 147 | RNA-binding (RRM/RBD/RNP motifs) family protein Encodes a unique protein that is both a member of the RIP (RNA-editing interacting protein) family and the RNA recognition motif (RRM)-containing family. It controls the editing extent of 62% of the plastid Cs targeted for editing in Arabidopsis. RNA-binding (RRM/RBD/RNP motifs) family protein;FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_processunknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); plastid developmental protein DAG, putative (TAIR:AT1G32580.1); Has 19538 Blast hits to 16159 proteins in 695 species: Archae - 6; Bacteria - 989; Metazoa - 10059; Fungi - 2542; Plants - 4206; Viruses - 0; Other Eukaryotes - 1736 (source: NCBI BLink). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT1G67390.1 | protein_coding | 1:25244690-25247343 | -28.5146 | 610 | 668 | 72 | 5 | F-box family protein F-box family protein;CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); F-box family protein (TAIR:AT3G60790.1); Has 1872 Blast hits to 1854 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1872; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | ||
| XLOC_028786 | Ch5:7414961-7415895 | AT3G51420.1 | protein_coding | 3:19083980-19086300 | -28.7576 | 601 | 675 | 119 | 51 | strictosidine synthase-like 4 Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. strictosidine synthase-like 4 (SSL4);FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT3G51430.1); Has 1288 Blast hits to 1275 proteins in 300 species: Archae - 9; Bacteria - 428; Metazoa - 223; Fungi - 4; Plants - 454; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). | ||
| XLOC_031137 | Ch5:12144798-12145822 | AT3G23130.1 | protein_coding | 3:8242256-8243372 | -29.5245 | 702 | 795 | 579 | 507 | C2H2 and C2HC zinc fingers superfamily protein Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. SUPERMAN (SUP);FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: flower development, negative regulation of transcription, specification of floral organ identity; LOCATED IN: intracellular; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); zinc finger protein 11 (TAIR:AT2G42410.1); Has 1049 Blast hits to 1049 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 1011; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT5G10660.2 | protein_coding | 5:3370096-3372348 | -29.5869 | 236 | 310 | 1248 | 1184 | calmodulin-binding protein-related calmodulin-binding protein-related;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G24880.1). | ||
| XLOC_001570 | Ch1:10056009-10056945 | AT1G28660.1 | protein_coding | 1:10071609-10073549 | -30.3452 | 158 | 220 | 1102 | 1040 | GDSL-like Lipase/Acylhydrolase superfamily protein GDSL-like Lipase/Acylhydrolase superfamily protein;FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT1G28670.1); Has 3386 Blast hits to 3342 proteins in 190 species: Archae - 0; Bacteria - 258; Metazoa - 0; Fungi - 2; Plants - 3114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). | ||
| XLOC_005442 | Ch1:7892602-7894638 | AT5G45840.2 | protein_coding | 5:18593917-18597907 | -30.3613 | 382 | 481 | 64 | 0 | Leucine-rich repeat protein kinase family proteinLeucine-rich repeat protein kinase family protein;FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages;CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); Leucine-rich repeat protein kinase family protein (TAIR:AT4G18640.1). | ||
| XLOC_010824 | Ch2:612785-614695 | AT2G02240.1 | protein_coding | 2:592160-593724 | -30.5354 | 382 | 438 | 961 | 905 | F-box family protein maternal effect embryo arrest 66 (MEE66);CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); phloem protein 2-B2 (TAIR:AT2G02250.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_016650 | Ch3:2189530-2192451 | AT3G05850.1 | protein_coding | 3:1743413-1746785 | -31.7461 | 186 | 254 | 2407 | 2336 | odes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). Mutator-like transposase family, has a 1.9e-58 P-value blast match to GB:AAA21566 mudrA of transposon="MuDR" (MuDr-element) (Zea mays) | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT2G18540.1 | protein_coding | 2:8042096-8045033 | -32.4289 | 214 | 297 | 2093 | 1992 | RmlC-like cupins superfamily protein RmlC-like cupins superfamily protein;FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710); RmlC-like cupins superfamily protein (TAIR:AT4G36700.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_009286 | Ch2:10267417-10270832 | AT1G71390.1 | protein_coding | 1:26906401-26908975 | -32.595 | 195 | 264 | 2280 | 2211 | receptor like protein 11 receptor like protein 11 (RLP11); INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 12 (TAIR:AT1G71400.1); Has 113280 Blast hits to 31339 proteins in 1188 species: Archae - 38; Bacteria - 9392; Metazoa - 25624; Fungi - 1167; Plants - 68360; Viruses - 2; Other Eukaryotes - 8697 (source: NCBI BLink). | ||
| XLOC_024083 | Ch4:4009674-4009918 | AT2G07981.1 | protein_coding | 2:3614986-3617716 | -32.8331 | 59 | 121 | 1222 | 1160 | unknown protein; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G08986.1); Has 174 Blast hits to 86 proteins in 29 species: Archae - 0; Bacteria - 13; Metazoa - 51; Fungi - 9; Plants - 37; Viruses - 3; Other Eukaryotes - 61 (source: NCBI BLink). | ||
| XLOC_019408 | Ch3:15426764-15427680 | AT5G54360.1 | protein_coding | 5:22071862-22072674 | -34.6397 | 533 | 611 | 810 | 723 | C2H2-like zinc finger protein C2H2-like zinc finger protein;FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast;CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT5G54350.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | ||
| XLOC_009286 | Ch2:10267417-10270832 | AT3G23120.1 | protein_coding | 3:8227222-8229619 | -35.5053 | 195 | 264 | 2319 | 2250 | receptor like protein 38 receptor like protein 38 (RLP38);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 37 (TAIR:AT3G23110.1); Has 120242 Blast hits to 33265 proteins in 1172 species: Archae - 42; Bacteria - 8485; Metazoa - 29672; Fungi - 1389; Plants - 71311; Viruses - 22; Other Eukaryotes - 9321 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G12875.1 | protein_coding | 2:5289411-5291470 | -36.5083 | 230 | 329 | 732 | 601 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | ||
| XLOC_024083 | Ch4:4009674-4009918 | AT1G40104.1 | protein_coding | 1:15081952-15085893 | -36.8975 | 58 | 120 | 1856 | 1794 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G08986.1); Has 88 Blast hits to 39 proteins in 18 species: Archae - 0; Bacteria - 17; Metazoa - 9; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | ||
| XLOC_019396 | Ch3:13406889-13407945 | AT1G77340.1 | protein_coding | 1:29068343-29070037 | -37.2118 | 428 | 555 | 139 | 45 | Pentatricopeptide repeat (PPR) superfamily protein Pentatricopeptide repeat (PPR) superfamily protein;CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G65560.1); Has 44266 Blast hits to 12730 proteins in 287 species: Archae - 5; Bacteria - 39; Metazoa - 433; Fungi - 553; Plants - 42031; Viruses - 0; Other Eukaryotes - 1205 (source: NCBI BLink). | ||
| XLOC_031142 | Ch5:13625843-13626916 | AT3G28560.1 | protein_coding | 3:10707096-10708591 | -38.2627 | 232 | 339 | 1283 | 1165 | BCS1 AAA-type ATPase BCS1 AAA-type ATPase; P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT3G28540.2); Has 552 Blast hits to 525 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 512; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). | ||
| XLOC_031135 | Ch5:12104696-12105860 | AT1G35830.1 | protein_coding | 1:13320675-13322511 | -42.4627 | 584 | 714 | 678 | 512 | VQ motif-containing protein VQ motif-containing protein;CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); VQ motif-containing protein (TAIR:AT5G65170.1); Has 1167 Blast hits to 1059 proteins in 155 species: Archae - 0; Bacteria - 36; Metazoa - 369; Fungi - 192; Plants - 292; Viruses - 57; Other Eukaryotes - 221 (source: NCBI BLink). | ||
| XLOC_009286 | Ch2:10267417-10270832 | AT3G23110.1 | protein_coding | 3:8222364-8224871 | -46.1543 | 195 | 264 | 2433 | 2364 | receptor like protein 37 receptor like protein 37 (RLP37);FUNCTIONS IN: kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); receptor like protein 38 (TAIR:AT3G23120.1); Has 116481 Blast hits to 31282 proteins in 1091 species: Archae - 43; Bacteria - 8551; Metazoa - 25997; Fungi - 1173; Plants - 71485; Viruses - 19; Other Eukaryotes - 9213 (source: NCBI BLink). | ||
| XLOC_009286 | Ch2:10267417-10270832 | AT3G23010.1 | protein_coding | 3:8174341-8176911 | -46.984 | 195 | 264 | 1779 | 1710 | receptor like protein 36 receptor like protein 36 (RLP36);CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); receptor like protein 38 (TAIR:AT3G23120.1); Has 98934 Blast hits to 26273 proteins in 1049 species: Archae - 38; Bacteria - 5801; Metazoa - 19602; Fungi - 835; Plants - 65537; Viruses - 10; Other Eukaryotes - 7111 (source: NCBI BLink). | ||
| XLOC_024076 | Ch4:3950404-3951724 | AT1G40104.1 | protein_coding | 1:15081952-15085893 | -47.1275 | 246 | 327 | 1856 | 1778 | unknown protein;FUNCTIONS IN: molecular_functionunknown; INVOLVED IN: biological_processunknown; LOCATED IN: cellular_componentunknown; BEST Arabidopsis thaliana protein match is:unknown protein (TAIR:AT2G08986.1); Has 88 Blast hits to 39 proteins in 18 species: Archae - 0; Bacteria - 17; Metazoa - 9; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | ||
| XLOC_008226 | Ch1:16637327-16637706 | AT2G18540.1 | protein_coding | 2:8042096-8045033 | -47.5307 | 211 | 317 | 2090 | 1930 | RmlC-like cupins superfamily protein RmlC-like cupins superfamily protein;FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_processunknown; LOCATED IN: endomembrane system;CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710); RmlC-like cupins superfamily protein (TAIR:AT4G36700.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | ||
| XLOC_011053 | Ch2:3293967-3294696 | ATMG00860.1 | protein_coding | M:235916-236392 | -85.7933 | 633 | 729 | 476 | 380 | DNA/RNA polymerases superfamily protein DNA/RNA polymerases superfamily protein. |
Cite:
Jung YK, Juhyeon L, Myeong HK, et al. Dynamic landscape of long noncoding RNAs during leaf aging in Arabidopsis[J]. Front Plant Sci. 2022. [Full
Text]