|
|
|
|
| smRNA ID |
siR1840 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
AT5G52070 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TGTCAGTATAAATCTTTGATC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 2.52 |
1.93 |
1.07 |
0.48 |
0.38 |
0.25 |
0.17 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT1G29460 | AT1G29460.1 | response to endogenous stimulus,response to auxin stimulus |
| siRNA | G-to-M | AT4G37310 | AT4G37310.1 | oxidation reduction |
|
