smRNA information   
smRNA ID siR1169
Category siRNA
Stage G-to-M
Gene ID AT3G00000
Organelle Nucleus
Direction sense
Sequence GGAGCAATCCGGTCCGCCGAT
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
3.23 2.61 2.33 2.19 1.71 1.35 1.01
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT1G22640  AT1G22640.1  regulation of transcription,response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,response to wounding,response to auxin stimulus,response to metal ion,response to salicylic acid stimulus,response
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 siRNA  G-to-M  AT1G22640  AT1G22640.1  MYB