|
|
smRNA ID |
siR1209 |
Category |
siRNA |
Stage |
G-to-M |
Gene ID |
AT3G00000 |
Organelle |
Nucleus |
Direction |
sense |
Sequence |
GTCTGGAGAAGCGTCCTCAGC |
4D |
8D |
12D |
16D |
20D |
24D |
28D |
2.37 |
1.87 |
1.48 |
1.26 |
1.02 |
0.82 |
0.67 |
Category |
Stage |
Gene ID |
Transcript ID |
GO |
siRNA | G-to-M | AT1G54100 | AT1G54100.2 | response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,oxidation reduction |
|