smRNA information   
smRNA ID siR2255
Category siRNA
Stage M-to-S
Gene ID ATCG01180
Organelle Chloroplasts
Direction sense
Sequence AGCTTATGCTCTGACCCGAGT
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.59 2.26 1.92 1.37 1 0.66 0.32
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT2G01100  AT2G01100.2  -
 siRNA  G-to-M  AT2G22430  AT2G22430.1  regulation of transcription,response to endogenous stimulus,response to abiotic stimulus,regulation of abscisic acid mediated signaling
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 siRNA  G-to-M  AT2G22430  AT2G22430.1  Homeobox