|
|
|
|
| smRNA ID |
miR399a |
| Category |
mature miRNA |
| Stage |
M-to-S |
| Gene ID |
miR399a |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
CAGGGCAAAUCUCCUUUGGCA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 4.41 |
3.27 |
1.96 |
1.24 |
0.96 |
0.72 |
0.56 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT2G33770 | AT2G33770.1 | ion homeostasis |
| miRNA | G-to-M | AT2G23840 | AT2G23840.1 | - |
| miRNA | G-to-M | AT3G05690 | AT3G05690.1 | regulation of transcription |
| miRNA | G-to-M | AT5G06510 | AT5G06510.1 | regulation of transcription |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| miRNA | G-to-M | AT3G05690 | AT3G05690.1 | CCAAT-HAP2 |
| miRNA | G-to-M | AT5G06510 | AT5G06510.1 | CCAAT-HAP2 |
|