smRNA information   
smRNA ID miR399a
Category mature miRNA
Stage M-to-S
Gene ID miR399a
Organelle Nucleus
Direction sense
Sequence CAGGGCAAAUCUCCUUUGGCA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
4.41 3.27 1.96 1.24 0.96 0.72 0.56
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT2G33770  AT2G33770.1  ion homeostasis
 miRNA  G-to-M  AT2G23840  AT2G23840.1  -
 miRNA  G-to-M  AT3G05690  AT3G05690.1  regulation of transcription
 miRNA  G-to-M  AT5G06510  AT5G06510.1  regulation of transcription
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  G-to-M  AT3G05690  AT3G05690.1  CCAAT-HAP2
 miRNA  G-to-M  AT5G06510  AT5G06510.1  CCAAT-HAP2