smRNA information   
smRNA ID miR775
Category mature miRNA
Stage M-to-S
Gene ID miR775
Organelle Nucleus
Direction sense
Sequence UUCGAUGUCUAGCAGUGCCA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
5.82 5.44 4.57 4.02 3.92 3.67 3.4
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT5G07010  AT5G07010.1  response to endogenous stimulus,response to jasmonic acid stimulus