|
|
|
|
| smRNA ID |
miR858a |
| Category |
mature miRNA |
| Stage |
M-to-S |
| Gene ID |
miR858a |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
AAGGUCGAACAGACAACGAAA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 2.71 |
2.12 |
1.35 |
0.77 |
0.49 |
0.26 |
0.09 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT3G46130 | AT3G46130.2 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus |
| miRNA | G-to-M | AT1G22640 | AT1G22640.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to wounding,response to auxin stimulus,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimul |
| miRNA | G-to-M | AT4G34990 | AT4G34990.1 | regulation of transcription,response to endogenous stimulus,response to osmotic stress,response to metal ion,response to salicylic acid stimulus,response to jasmonic acid stimulus,response to ethylene stimulus |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| miRNA | G-to-M | AT3G46130 | AT3G46130.2 | MYB |
| miRNA | G-to-M | AT1G22640 | AT1G22640.1 | MYB |
| miRNA | G-to-M | AT4G34990 | AT4G34990.1 | MYB |
|