|
|
|
|
| smRNA ID |
siR1402 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
AT3G17185 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTCTTGACCTTGTAAGACCCC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 6.6 |
6.55 |
5.9 |
5.24 |
4.46 |
3.72 |
2.93 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT5G62000 | AT5G62000.2 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| siRNA | G-to-M | AT5G62000 | AT5G62000.3 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| siRNA | G-to-M | AT5G62000 | AT5G62000.1 | regulation of transcription,response to endogenous stimulus,response to auxin stimulus,reproductive structure development |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| siRNA | G-to-M | AT5G62000 | AT5G62000.2 | ARF |
| siRNA | G-to-M | AT5G62000 | AT5G62000.3 | ARF |
| siRNA | G-to-M | AT5G62000 | AT5G62000.1 | ARF |
| siRNA | G-to-M | AT5G62000 | AT5G62000.1 | ARF |
| siRNA | G-to-M | AT5G62000 | AT5G62000.1 | ARF |
|