smRNA information   
smRNA ID miR161.2
Category mature miRNA
Stage M-to-S
Gene ID miR161.2
Organelle Nucleus
Direction sense
Sequence UAGUCACUUUCAAUGCAUUGA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
8.23 8.37 7.67 7.04 6.64 6.24 5.92
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT1G72680  AT1G72680.1  response to bacterium,response to metal ion,cellular carbohydrate catabolic process,phenylpropanoid metabolic process,oxidation reduction,glycoside metabolic process
 miRNA  M-to-S  AT1G72680  AT1G72680.1  response to bacterium,response to metal ion,cellular carbohydrate catabolic process,phenylpropanoid metabolic process,oxidation reduction,glycoside metabolic process
 miRNA  M-to-S  AT5G04235  AT5G04235.1  -
 miRNA  M-to-S  AT1G67060  AT1G67060.1  -
 miRNA  M-to-S  AT2G38250  AT2G38250.1  regulation of transcription
 miRNA  M-to-S  AT2G36950  AT2G36950.1  -
 miRNA  M-to-S  AT1G62620  AT1G62620.1  -
 miRNA  M-to-S  AT1G63370  AT1G63370.1  -
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  M-to-S  AT2G38250  AT2G38250.1  Trihelix