|
|
|
|
| smRNA ID |
miR319a;b |
| Category |
mature miRNA |
| Stage |
M-to-S |
| Gene ID |
miR319a;b |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
AGGGAGCUCCCUUCAGUCCAA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 6.1 |
6.26 |
5.22 |
4.16 |
3.33 |
2.54 |
1.83 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| miRNA | G-to-M | AT1G48090 | AT1G48090.1 | - |
| miRNA | M-to-S | AT5G06100 | AT5G06100.1 | regulation of transcription,response to endogenous stimulus,regulation of abscisic acid mediated signaling |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| miRNA | M-to-S | AT5G06100 | AT5G06100.1 | MYB |
|