smRNA information   
smRNA ID miR319a;b
Category mature miRNA
Stage M-to-S
Gene ID miR319a;b
Organelle Nucleus
Direction sense
Sequence AGGGAGCUCCCUUCAGUCCAA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
6.1 6.26 5.22 4.16 3.33 2.54 1.83
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT1G48090  AT1G48090.1  -
 miRNA  M-to-S  AT5G06100  AT5G06100.1  regulation of transcription,response to endogenous stimulus,regulation of abscisic acid mediated signaling
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 miRNA  M-to-S  AT5G06100  AT5G06100.1  MYB