smRNA information   
smRNA ID miR400
Category mature miRNA
Stage M-to-S
Gene ID miR400
Organelle Nucleus
Direction sense
Sequence GUGACUUAUAAUACUCUCAUA
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
4.49 4.68 4.03 3.47 2.88 2.43 2.05
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT3G44880  AT3G44880.1  response to bacterium,oxidation reduction,reproductive structure development
 miRNA  G-to-M  AT2G11140  AT2G11140.1  -
 miRNA  G-to-M  AT3G15840  AT3G15840.1  oxidation reduction
 miRNA  M-to-S  AT3G44880  AT3G44880.1  response to bacterium,oxidation reduction,reproductive structure development
 miRNA  M-to-S  AT2G28680  AT2G28680.1  -