smRNA information   
smRNA ID siR1342
Category siRNA
Stage G-to-M
Gene ID AT3G06435
Organelle Nucleus
Direction sense
Sequence TTACCATAATCTACTTTACTG
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
1.34 1.27 0.78 0.29 0.13 0.08 0.18
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 siRNA  G-to-M  AT1G18710  AT1G18710.1  regulation of transcription,response to endogenous stimulus,response to abiotic stimulus,response to osmotic stress,response to salt stress,response to jasmonic acid stimulus
smRNA-DETF interaction   
Category Stage Gene ID Transcript ID TF Family
 siRNA  G-to-M  AT1G18710  AT1G18710.1  MYB
 siRNA  G-to-M  AT1G18710  AT1G18710.1  MYB