smRNA information   
smRNA ID miR172b-5p
Category mature miRNA
Stage M-to-S
Gene ID miR172b-5p
Organelle Nucleus
Direction sense
Sequence GCAGCACCAUUAAGAUUCAC
log2(RPM), smoothed   
4D 8D 12D 16D 20D 24D 28D
2.34 3.3 3.68 3.81 3.54 2.96 2.05
predicted smRNA target   
Category Stage Gene ID Transcript ID GO
 miRNA  G-to-M  AT3G61820  AT3G61820.1  -
 miRNA  G-to-M  AT3G49910  AT3G49910.1  -
 miRNA  G-to-M  AT4G17260  AT4G17260.1  response to endogenous stimulus,response to osmotic stress,cellular carbohydrate catabolic process,oxidation reduction
 miRNA  M-to-S  AT5G48410  AT5G48410.1  ion homeostasis
 miRNA  M-to-S  AT3G49601  AT3G49601.1  -
 miRNA  M-to-S  AT4G39420  AT4G39420.2  -
 miRNA  M-to-S  AT4G16680  AT4G16680.1  -