|
|
|
|
| smRNA ID |
siR1385 |
| Category |
siRNA |
| Stage |
G-to-M |
| Gene ID |
AT3G17185 |
| Organelle |
Nucleus |
| Direction |
antisense |
| Sequence |
TTGAGAAGAGATAGAATAGAA |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 7.06 |
6.74 |
5.65 |
4.54 |
3.42 |
2.45 |
1.57 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | G-to-M | AT3G06510 | AT3G06510.1 | response to abiotic stimulus |
| siRNA | G-to-M | AT5G14780 | AT5G14780.1 | response to wounding,response to metal ion,oxidation reduction |
| siRNA | M-to-S | AT5G12230 | AT5G12230.1 | - |
| siRNA | M-to-S | AT4G02380 | AT4G02380.1 | response to abiotic stimulus |
|