|
|
|
|
| smRNA ID |
siR99 |
| Category |
siRNA |
| Stage |
M-to-S |
| Gene ID |
AT1G62910 |
| Organelle |
Nucleus |
| Direction |
antisense |
| Sequence |
GAACCATTTGATCAACTAAAG |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 0.91 |
1.19 |
1.71 |
2.18 |
1.96 |
1.36 |
0.3 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| siRNA | M-to-S | AT1G11910 | AT1G11910.1 | response to abiotic stimulus,response to osmotic stress,response to salt stress |
|