|
|
|
|
| smRNA ID |
TAS3A_S01 |
| Category |
tasiRNA |
| Stage |
G-to-M |
| Gene ID |
AT3G17185 |
| Organelle |
Nucleus |
| Direction |
sense |
| Sequence |
TTCTCCTACCTTGTCTATCCC |
| 4D |
8D |
12D |
16D |
20D |
24D |
28D |
| 5.51 |
5.1 |
4.41 |
3.69 |
2.75 |
2.14 |
1.67 |
| Category |
Stage |
Gene ID |
Transcript ID |
GO |
| tasiRNA | G-to-M | AT3G05345 | AT3G05345.1 | - |
| tasiRNA | G-to-M | AT5G14565 | AT5G14565.1 | response to bacterium,response to abiotic stimulus,response to osmotic stress,response to salt stress |
| tasiRNA | G-to-M | AT5G14530 | AT5G14530.1 | - |
| tasiRNA | M-to-S | AT1G05710 | AT1G05710.4 | regulation of transcription,response to endogenous stimulus,response to ethylene stimulus |
| tasiRNA | M-to-S | AT3G16857 | AT3G16857.2 | regulation of transcription,response to endogenous stimulus |
| tasiRNA | M-to-S | AT4G03290 | AT4G03290.1 | response to abiotic stimulus |
| Category |
Stage |
Gene ID |
Transcript ID |
TF Family |
| tasiRNA | M-to-S | AT1G05710 | AT1G05710.4 | bHLH |
| tasiRNA | M-to-S | AT3G16857 | AT3G16857.2 | ARR-B |
| tasiRNA | M-to-S | AT3G16857 | AT3G16857.2 | ARR-B |
| tasiRNA | M-to-S | AT3G16857 | AT3G16857.2 | ARR-B |
|